ID: 1162685409

View in Genome Browser
Species Human (GRCh38)
Location 19:12379041-12379063
Sequence TTGTTGTTGTTGTTCAACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1192
Summary {0: 1, 1: 2, 2: 36, 3: 294, 4: 859}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162685409_1162685412 20 Left 1162685409 19:12379041-12379063 CCAGTGTTGAACAACAACAACAA 0: 1
1: 2
2: 36
3: 294
4: 859
Right 1162685412 19:12379084-12379106 GTGACATGTACTATGCAGGTAGG 0: 1
1: 0
2: 2
3: 13
4: 93
1162685409_1162685413 30 Left 1162685409 19:12379041-12379063 CCAGTGTTGAACAACAACAACAA 0: 1
1: 2
2: 36
3: 294
4: 859
Right 1162685413 19:12379094-12379116 CTATGCAGGTAGGCCTGCAATGG 0: 1
1: 1
2: 1
3: 6
4: 116
1162685409_1162685410 -2 Left 1162685409 19:12379041-12379063 CCAGTGTTGAACAACAACAACAA 0: 1
1: 2
2: 36
3: 294
4: 859
Right 1162685410 19:12379062-12379084 AAAAAAAACTATAATGTTATAGG 0: 1
1: 1
2: 9
3: 139
4: 1439
1162685409_1162685411 16 Left 1162685409 19:12379041-12379063 CCAGTGTTGAACAACAACAACAA 0: 1
1: 2
2: 36
3: 294
4: 859
Right 1162685411 19:12379080-12379102 ATAGGTGACATGTACTATGCAGG 0: 1
1: 0
2: 2
3: 12
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162685409 Original CRISPR TTGTTGTTGTTGTTCAACAC TGG (reversed) Intergenic
900991035 1:6098463-6098485 TTGTTGTTGTTCTTGCACGCAGG + Exonic
901845155 1:11977336-11977358 TTGTTGTTGTTGTTGTTGACAGG - Intergenic
901908514 1:12435452-12435474 TTGTTGTTGTTGTTCAGACAGGG - Intronic
902274895 1:15332254-15332276 TTCTCGTTGTTCTTCAAGACTGG + Intronic
902280229 1:15368910-15368932 TTGTTCTTGTTCTTCCACCCAGG - Intronic
902609952 1:17591246-17591268 TTTTTGTTGTTGTTTGAAACAGG + Intronic
903110273 1:21126988-21127010 TTGTTGTTGTTGTTGAGAAAAGG + Intronic
903135025 1:21303652-21303674 TTGTTGTTGTTTTTTGAGACAGG + Intronic
903165271 1:21515874-21515896 TTGTTGTTGTTTTTTGAGACAGG + Intronic
903604964 1:24568791-24568813 TTGTTGTTGTTATTAGAGACAGG + Intronic
903872665 1:26447821-26447843 TTGTTGTTGTTGTTGAAAAGAGG - Intronic
903946048 1:26963572-26963594 TTGTTGCTGTTGTTTGAGACAGG + Intergenic
903995451 1:27302733-27302755 TTGTTGTTGTTGTTTGAGACAGG - Intronic
904073673 1:27823165-27823187 TTGTTGTTGTTGTTCACTTGTGG + Exonic
904111941 1:28133099-28133121 TTGTTGTTGTTGTTGAAACAGGG + Intergenic
904569039 1:31446997-31447019 TTGTTGTTGTGGTCCAATTCAGG - Intergenic
905023615 1:34835310-34835332 TTGTTGTTGTTATTTGAGACAGG - Intronic
905716934 1:40160305-40160327 TTGTTGTTGTTTTTTGAGACAGG - Intergenic
905741054 1:40372279-40372301 TTGTTGTTGTTGTTTGAGACAGG + Intronic
906064708 1:42972170-42972192 TTTTTCTTGTTGTTAAAGACAGG + Intergenic
906230803 1:44162343-44162365 TTGTTGTTGTATTTGAAAACTGG + Intergenic
906329456 1:44872642-44872664 TTTTTGTTTTTTTTCAAGACAGG - Intronic
906391640 1:45422447-45422469 TTGTTGTTTTTGTTTGAGACAGG + Intronic
906630824 1:47366177-47366199 TTGTTGTTGTTGTTCAGACAGGG - Intronic
907083786 1:51649878-51649900 TTTTTGTTGTTGTTGAAAAAAGG + Intronic
907345713 1:53777885-53777907 TTGTTGCTGTTGTTGGAGACGGG + Intronic
908526260 1:64990556-64990578 TTGTTGTTGTTTTTGAAAACTGG - Intergenic
909118353 1:71568573-71568595 TTTTTGTTGTTATTTACCACTGG - Intronic
909165029 1:72211240-72211262 TTGTTGTTGTTGTTCATTTAAGG - Intronic
909424801 1:75510813-75510835 TTGTTGTTGTTGATCAGAATTGG - Intronic
909921058 1:81380468-81380490 TTTTTGTTGTTGTTTAACAATGG + Intronic
910538688 1:88329958-88329980 TTGTTGTTGTTGTTAGAGACAGG + Intergenic
911580156 1:99624883-99624905 TTGTTGTTGTTATTTGAGACAGG + Intergenic
911635614 1:100232309-100232331 TTGTTGTTGTTGGTAGAGACAGG + Intronic
911654858 1:100432103-100432125 TTGTTGTTGTTGTTAGGTACAGG + Intronic
912356451 1:109057938-109057960 TTGTTGTTGTTGTTAGAGACAGG - Intergenic
912398415 1:109367220-109367242 TTGTTGTTGTTTTTTGAGACAGG - Intronic
912433250 1:109640883-109640905 TTGTTTTTGTTTTTCAAGACCGG + Intergenic
912652753 1:111454460-111454482 TTGTTGTTGTTTTTTGAGACAGG + Intronic
912711826 1:111955406-111955428 CTGTTGTTGTTGTTTGAGACAGG - Intronic
912717650 1:111993280-111993302 TGGTTGTTGTTGTTCAAGGTAGG + Intergenic
913006405 1:114636659-114636681 TTGTTGCTGTTGTTTGAGACAGG - Intronic
913063677 1:115230469-115230491 TTTTTGTATTTGTTGAACACAGG + Intergenic
913452749 1:119003201-119003223 TTGTTGTTGTTTTTCAAAGTGGG + Intergenic
913492607 1:119395399-119395421 TTGTTGTTGTTGTTTGAGATGGG - Intergenic
913557725 1:119985235-119985257 TTTTTTTTGTTATTCATCACAGG - Intronic
914007177 1:143742543-143742565 TTATTGTTGTTGTTGAAAACTGG + Intergenic
914645995 1:149653037-149653059 TTATTGTTGTTGTTGAAAACTGG + Intergenic
914766565 1:150642978-150643000 TTGTTGTTGTTGTAGAACTGGGG + Intergenic
914813190 1:151044624-151044646 TTGTTGTTGTTGTTAGAGACAGG + Intronic
915825466 1:159071512-159071534 TTGTTGTTGTTGTTTGAGACAGG + Intronic
916435890 1:164777415-164777437 TTGTTGTTGTTGTTTGAGGCAGG - Intronic
916548150 1:165826313-165826335 TTGTTTTTGTTTTTTGACACAGG + Intronic
916893300 1:169135166-169135188 TTGTTTTTGTTTTTCAAGACAGG - Intronic
917213803 1:172657500-172657522 TTGTTGTTGTTGTTTAAAGCTGG - Intergenic
917249845 1:173046896-173046918 TTGTTGTTGTTTTTTGAGACAGG + Intronic
917349489 1:174062368-174062390 TTGTTGTTGTTGTTTGAGTCAGG + Intergenic
917552471 1:176048065-176048087 TTGTAGTTGTTTTTTAAGACAGG - Intronic
917875242 1:179280707-179280729 TTGTTGTCGTTGTTGAAAACTGG + Intergenic
918746744 1:188210922-188210944 TTTTTGTTGTTTTTTGACACAGG - Intergenic
918992624 1:191717414-191717436 TTGTTGTTGTTGTTTGAGAGGGG - Intergenic
919290750 1:195627489-195627511 TTGTTGTTGTTGTTTCAGATTGG - Intergenic
919383866 1:196894878-196894900 TTGTTGTTGTTTTTAGAGACAGG - Intronic
919829356 1:201529606-201529628 TTGTTGTTGTTGTTTGAGACAGG + Intergenic
919874452 1:201853237-201853259 TTGTTGTTATTTTTCCAGACAGG + Intronic
919892367 1:201984605-201984627 TTGTTGTTGTTGTTAAAACAGGG - Intronic
919918794 1:202155763-202155785 TTGTTGTTGTTTTTAGAGACAGG + Intronic
919966041 1:202526041-202526063 TTGTTGTTGTTGTTCTCCATTGG - Intronic
920355166 1:205366625-205366647 TTGTTGTTGTTGTTTTGCAATGG + Intergenic
920501699 1:206489702-206489724 TTATTGTTGTTGTTTGAGACAGG - Intronic
920615386 1:207487290-207487312 TTGCTGTTGTTGTTTGAGACAGG + Intronic
920863033 1:209726580-209726602 TTTTTGTTGTTGTTAGAAACAGG - Intronic
921015365 1:211185118-211185140 TTGTTGTTGTTTTTTGAGACAGG - Intergenic
921035469 1:211374216-211374238 TTTTTGTTGTTGTTAAACTCAGG - Exonic
921059075 1:211567150-211567172 TTGTTGTTGTTTTTTGAGACAGG - Intergenic
921088497 1:211819484-211819506 TTTTTGTTGTTGTTGGAGACAGG - Intronic
921112583 1:212053591-212053613 TTGTTGTTGTTGTTTGAGACAGG + Intronic
921486446 1:215721078-215721100 TTGTTGTTGTTTTTTGAGACAGG + Intronic
921973491 1:221176326-221176348 CTGTTGTTGTTGTTCATAAATGG - Intergenic
922111786 1:222565858-222565880 CTGTTGTTGTTGTTTGAAACAGG - Intronic
922114862 1:222603137-222603159 TTTTTGTTGTTGTTTCAGACAGG + Intergenic
922298276 1:224271485-224271507 TTGTTGCTGTTGTTTGAGACAGG - Intronic
922649405 1:227324324-227324346 TTGTTGTTGTTGTTTTAGGCAGG + Intergenic
923250584 1:232176555-232176577 TTGTTGTTGTTTTTAGAGACAGG - Intergenic
923547562 1:234933895-234933917 TTGTTGTTGTTGTTAGAGATGGG - Intergenic
923624407 1:235602263-235602285 TTGTTGTTGTTGTTGAGATCGGG - Intronic
923651392 1:235877410-235877432 TTGTTGTTGTTTTTGGAGACGGG + Intronic
923666619 1:236003862-236003884 TTGTTGTTGTTGTTTGGGACAGG - Intronic
923726229 1:236507879-236507901 TTGTTGTTGTTTTTAGAGACAGG + Intergenic
924712739 1:246543982-246544004 TTTTTGTTGTTGTTAGAGACAGG - Intronic
924932138 1:248741106-248741128 TTGTTGTTGCTGTTCAAGACAGG - Intronic
1063757707 10:9033316-9033338 TTGTTGTTGTTGTTGAAAGTTGG - Intergenic
1063855624 10:10249332-10249354 TTTTTGTTGTTGTTCAGTAAAGG - Intergenic
1064683038 10:17830833-17830855 TTGTTGTTGTTTTTAAACCTAGG - Intronic
1064696037 10:17966314-17966336 TTGTTGTTGTTTTTAGAGACAGG + Intronic
1064744860 10:18468446-18468468 CTGTTGTTGTTGTTTGAGACAGG - Intronic
1064995929 10:21296663-21296685 TTGTTTTTGTTTTTGAAGACAGG + Intergenic
1065038719 10:21668054-21668076 TTGTTGTTGTTGTTTTCTACTGG - Intronic
1065816732 10:29489552-29489574 TTGTTGTTGTTGTTGAGAAAGGG + Intronic
1065897696 10:30178676-30178698 TTGTTGTTGTTCTGCAATACGGG - Intergenic
1065960905 10:30733403-30733425 TTGTTGTTGTTGTTTGAGACAGG + Intergenic
1066029296 10:31402122-31402144 TTGTTGTTGTTGTTGTTAACAGG + Intronic
1066096354 10:32076266-32076288 TTGTTGTTGTTTTTTGAGACGGG + Intergenic
1066460276 10:35607412-35607434 TTGTTGTTGTTGTTGGACACAGG - Intronic
1066485440 10:35838527-35838549 TTGTTTTTGTTTTCCAAGACAGG + Intergenic
1066668821 10:37815698-37815720 TTTTTGTTGTTGTTGAAAAGTGG + Intronic
1066683645 10:37959917-37959939 TTGTTGTTGTTGTTTTAAAACGG + Intronic
1067412298 10:46075816-46075838 TTGTTGCTGTTGTTTGAGACAGG - Intergenic
1067515449 10:46937062-46937084 TTGTTGTTGTTGTTTAGTGCAGG + Intronic
1067561762 10:47309547-47309569 TTGTTGTTGTTGTTTGCTACGGG + Intronic
1067646801 10:48114748-48114770 TTGTTGTTGTTGTTTAGTGCAGG - Intergenic
1068452828 10:57213892-57213914 TTGTTGTTGTTGTTTAATCTCGG + Intergenic
1068534115 10:58221562-58221584 TTGTTATTGTTGTTTGAGACAGG + Intronic
1068768347 10:60790975-60790997 TTGTTGTTTTTGCTCAAGATTGG + Intronic
1068816510 10:61321238-61321260 TTGTAGTTGGTTTTCAACACTGG - Intergenic
1068921951 10:62494023-62494045 TTGTTGTTGTTGTTTAGAAATGG - Intronic
1069320081 10:67158965-67158987 TTGTTGTTTTTTTTAAAAACAGG - Intronic
1069438248 10:68406158-68406180 TTGTTGTTGTTGTTCAGTGAAGG - Intronic
1070182505 10:74028079-74028101 TTGTTTTTGTTTTTTAAGACAGG + Intronic
1070299494 10:75192905-75192927 TTGTTGTTGTTGTTAGAGAAAGG + Intergenic
1071243314 10:83735224-83735246 TTGTTGTGGTTGTGCATCAGTGG + Intergenic
1071681120 10:87706751-87706773 TTGTTGTTGTTGTTTGAGACAGG - Intronic
1071699398 10:87914158-87914180 TTGTTGTTGTTGTCAAAAACTGG + Intronic
1071722460 10:88160892-88160914 TTATTGTTGCTGTTGATCACTGG + Intergenic
1072170745 10:92859132-92859154 TTGTTATTATTGTTGAAAACTGG + Intronic
1072512684 10:96143990-96144012 TTGTTGTTGTTTTTTTAGACAGG + Intronic
1072814794 10:98495947-98495969 TTGTTGTTGTTGTTGGAAACTGG + Intronic
1072825410 10:98601129-98601151 TTGTTGTTGTTGTTCAGGGAAGG + Intronic
1073551497 10:104406089-104406111 TTGTTGTTGTTGTTTGAGACAGG - Intronic
1073673014 10:105613496-105613518 TTGTTGTTTTTGTTAGAGACAGG - Intergenic
1073940584 10:108693544-108693566 TTGTTGTTGTTGTTGAAAACTGG - Intergenic
1074010495 10:109473810-109473832 TTTTTGTTGTTGTTCTTCAGTGG + Intergenic
1074444761 10:113512347-113512369 TTGCTTTTGTTGTTGAAAACTGG + Intergenic
1074550829 10:114440632-114440654 TTGTTGTTGTTGGTAGAGACAGG + Intronic
1075012452 10:118886381-118886403 TTGTTGTTGTTTTTTGAGACAGG + Intergenic
1075035545 10:119064071-119064093 TTGTTGTTGTTTTTTGAGACAGG - Intronic
1075578972 10:123602364-123602386 TTGTTGTTGTTGTTTGAGACAGG - Intergenic
1076099156 10:127760477-127760499 TTGTTTTTGTTTTTTAAGACAGG + Intergenic
1076473156 10:130734309-130734331 TTGTTGTTGTTGTTTGAGACAGG - Intergenic
1077092387 11:785261-785283 TTTTTGTTGTTGTTTGAGACAGG + Intergenic
1077889542 11:6409074-6409096 TTGTTGTTGTTGTTGAGAAAGGG + Intronic
1078383170 11:10862441-10862463 TTTTTGTTGTTGTTTGAGACAGG - Intergenic
1078810163 11:14752384-14752406 TTGTTGTTGTTGTTCTATCTTGG + Intronic
1079104681 11:17563018-17563040 TTGTTGTTGTTGTTTTACTTGGG + Intronic
1079206532 11:18420086-18420108 TTGTTGTTGTTGTTCTAAGACGG - Intronic
1079434807 11:20437506-20437528 TTATTGCTGATGTTGAACACAGG - Intronic
1079565987 11:21883473-21883495 TTGTTGTTATTAATCTACACAGG - Intergenic
1080141630 11:28927929-28927951 TTGTTGTTGCTGTTCAACTGTGG + Intergenic
1080144264 11:28961533-28961555 TTTGTGTTGATGTTCAATACAGG + Intergenic
1080614993 11:33937982-33938004 TTGTTTTTGTTGTTTTATACAGG + Intergenic
1080713652 11:34775345-34775367 TTGTTGTTGTTGTTGTTCTCTGG - Intergenic
1081843872 11:46224287-46224309 TTTTTGTTGTTGTTTGAGACAGG + Intergenic
1081846970 11:46247700-46247722 ATGTTGTGGTTTTTCAACAAGGG - Intergenic
1082251790 11:49990553-49990575 TTTTTCTTGTTGTTGAAAACTGG + Intergenic
1083368132 11:62155483-62155505 TTGTTGTTGTTGTTGGAGGCAGG + Intergenic
1083437199 11:62650711-62650733 CTGTTTTTGTTTTTCAAGACAGG + Intronic
1083481142 11:62948043-62948065 TTGTTGTTGTTTTACAACTAAGG - Intronic
1084368987 11:68725642-68725664 TTGTTGTTGTTGTTGGAAACGGG + Intronic
1085000602 11:73030012-73030034 TTGTTGTTGTTGTTAAAAACTGG - Intronic
1085141509 11:74147409-74147431 TTGCTGTTGTTATTTAAGACGGG - Intronic
1085188338 11:74595620-74595642 TTGTTGTTGTTGTTTGAGACAGG + Intronic
1085648127 11:78241187-78241209 TTATTGTTGATGTTGAACATAGG + Intronic
1085731115 11:78999644-78999666 TTGATTTTGTTGTTGAAAACTGG - Intronic
1085880100 11:80457093-80457115 TTGTTGTTGTTGTTAAAGTGGGG - Intergenic
1085971310 11:81594649-81594671 TTGTTGTTGTTGTTAAAGAAAGG + Intergenic
1086199089 11:84178713-84178735 TTGTTGTTGTTTTTGAAGCCTGG - Intronic
1086251268 11:84817412-84817434 ATGTTGTTGTTTTTCAATCCAGG + Intronic
1086357289 11:86016300-86016322 TTTTTGTTGTTGTTCTTCAGGGG - Intronic
1086549620 11:88040695-88040717 TTGTTGTTGTTGTTTGAGACAGG - Intergenic
1086722464 11:90137812-90137834 TTGTTGTTGTTGGTAGAGACAGG + Intronic
1086950877 11:92889096-92889118 TTGTTGTTGTTGTTAAAATAAGG + Intronic
1087069083 11:94057845-94057867 TTTTTGTTGTTCTTGAAAACTGG + Intronic
1087213948 11:95474585-95474607 CTGTTGCTGTTGTTGAACAGTGG - Intergenic
1087323505 11:96692887-96692909 TTGTTGTTGTTTTTCTGCATGGG + Intergenic
1087393188 11:97565464-97565486 TTGTTGTTGTTGTTCTAGGTTGG - Intergenic
1087520833 11:99233334-99233356 TTGTTGTTGTTGTTTCAAATTGG - Intronic
1087885700 11:103479867-103479889 TTGTTGTTGTTTTTTGAGACAGG + Intergenic
1088331341 11:108655723-108655745 TTGTTGTTGTTGTTTGAGATAGG - Intergenic
1088470298 11:110182593-110182615 TTGTTGTTGTTGTTTGAGACAGG - Intronic
1088482651 11:110309932-110309954 TTGTTGTTGTTGTTTTAGACAGG - Intergenic
1089394308 11:118125660-118125682 TTGTTGTTGTTTTTAGACACAGG + Intergenic
1089726987 11:120490635-120490657 TTGTTGTTGTTGTTTGAGACAGG + Intergenic
1090029357 11:123194540-123194562 TTTTTGTTGTTGTTTCAAACAGG - Intronic
1090245513 11:125213460-125213482 TTGTTGTTGTTATTTGAGACAGG + Intronic
1090468747 11:126959439-126959461 TTGTTGTTGTTGTTTTAGCCAGG + Intronic
1090530562 11:127587293-127587315 TTGTTGTTGTTGTTGTTCCCAGG - Intergenic
1090694585 11:129225683-129225705 TTGTTGTTGTTGTTGAAGACTGG - Intronic
1091494519 12:960635-960657 TTGTTGTTGTTTGTAAAGACAGG + Intronic
1091894805 12:4092784-4092806 TTGTTGTTGTTGTTTGAGACAGG + Intergenic
1092188819 12:6502584-6502606 TTGTTGTTGTTGTTAATTAGTGG + Intronic
1092546146 12:9452819-9452841 TTGTTGTTGTTGTTTCCCAGGGG - Intergenic
1092833254 12:12464975-12464997 TTGTTATTGTTGTTAGAAACAGG + Intronic
1092867610 12:12777927-12777949 TTGTTGTTGTTTTTTGAGACAGG + Intronic
1093012245 12:14120038-14120060 TTTTTGTTGTTGTTAGAGACAGG - Intergenic
1093393923 12:18656727-18656749 TTGTTGCTGTTGTTTGAGACAGG - Intergenic
1093955710 12:25216020-25216042 TTTTTGTTGTTTTTTAACAAAGG - Intronic
1094024388 12:25947310-25947332 TTGTTGTTGTTGTTGTTGACAGG + Intergenic
1094260901 12:28498077-28498099 TTGTTCTTGTTGTTCTTAACAGG - Intronic
1094506803 12:31069245-31069267 TTGTTGTTGTTGTTTCCCAGGGG + Intergenic
1095146081 12:38728147-38728169 TTTTTGTTGTTGTTGAATGCTGG - Intronic
1095437061 12:42201595-42201617 CTGTTGTTGTTGTTGAGCCCAGG + Intronic
1095469327 12:42519811-42519833 TTGTTGTTGTTGTTAGAGATGGG + Intronic
1095515553 12:43001219-43001241 TTTTTATTGTTGTTCTACTCTGG + Intergenic
1095773928 12:45991554-45991576 TTTTTGTTGTTGTTTGAGACAGG - Intronic
1096181468 12:49553316-49553338 TTGTTGTTGTTGTTTGAGACAGG + Intronic
1096339015 12:50781454-50781476 TTGTTTTTGTTTTTCAAGGCAGG + Intronic
1096986914 12:55765724-55765746 TTGTTGTTGTTGTTTTCCCCTGG - Intronic
1097093991 12:56530818-56530840 TTGTTGTTGTTGCTTAATTCCGG + Intronic
1097903965 12:64901443-64901465 TTGTTGTTGTTGTTTGAGACAGG + Intergenic
1098101899 12:67026926-67026948 TTGTTGTTGTTGTTTAAAACTGG + Intergenic
1098153403 12:67572005-67572027 TTGTTTTTGTTTTTCAAGACGGG + Intergenic
1098159503 12:67635892-67635914 TTGTTGTTGTTTTTCAAGATGGG - Intergenic
1098318501 12:69216639-69216661 TTGTTGTTGTTGTTAGAGACAGG + Intergenic
1098439269 12:70500824-70500846 TTGATGTTGTTGTTTGATACAGG - Intergenic
1098476855 12:70914815-70914837 CTGTTGTTGTTGTTAGAGACAGG - Intronic
1098570779 12:71985344-71985366 TTGTTGTTGTTGTTTTCCAATGG + Intronic
1098610487 12:72451588-72451610 TTGTTGTTGTTGTTCAAAATTGG + Intronic
1098727506 12:73987112-73987134 TTTTTGTTGTTGTTGAAAACTGG + Intergenic
1098758555 12:74394690-74394712 TTGTTGTTGTTTTTAAAGGCAGG - Intergenic
1098913117 12:76230678-76230700 CTGTTGTTGTTGTTTGAGACAGG + Intergenic
1099172821 12:79385739-79385761 TTGTTGTTGTTTTTTAATTCAGG + Intronic
1099257184 12:80328311-80328333 TTGTTGTTGTTGTTTGTGACAGG - Intronic
1099456463 12:82868845-82868867 TTGTTGTTGTTGTTGTTCAGTGG + Intronic
1099604083 12:84779608-84779630 TTGTTGCTGTTGTTAAAAAGTGG - Intergenic
1099853189 12:88131128-88131150 TAGTTGTGGTGGTTCAACAAAGG - Intronic
1100103864 12:91144330-91144352 TTTTTGTTGTTGTTCAGAGCTGG - Exonic
1100302150 12:93317620-93317642 TTGTTTCTGTTGGACAACACTGG - Intergenic
1100304194 12:93335593-93335615 TTTTTGTTGTTGTTTGAGACAGG - Intergenic
1100410859 12:94317865-94317887 TTGTTGTTGTTGTTTGGCATAGG + Intronic
1100502097 12:95183829-95183851 TTGTTTTTGTTGTTTGAGACAGG - Intronic
1100922063 12:99499397-99499419 TTGTTGTTGTTGTTAAAATTGGG - Intronic
1101120025 12:101569690-101569712 TTGTTGTTGTTGTTGAAATGGGG + Intronic
1101556390 12:105813925-105813947 TTGTTGTTGTTGTTCCAAGATGG + Intergenic
1101577646 12:106012831-106012853 TTGTTGTTGTTGTTTAATTGTGG - Intergenic
1101612003 12:106301570-106301592 TTGTTGTTGTTTTTGAACGGTGG + Intronic
1101665082 12:106805489-106805511 TTGTTGTTGTTGTTTGAGACAGG - Intronic
1101685201 12:107012357-107012379 TTGTTGTTCCTGTTCTGCACAGG - Intronic
1102159064 12:110753982-110754004 TTGTTGTTGTTGTTTGAGACAGG - Intergenic
1102215570 12:111159150-111159172 TTGTTGTTGTTGCTGGAAACAGG + Intronic
1102216593 12:111166022-111166044 TTGTTGTTGTTTTTATAGACTGG + Intronic
1102273468 12:111560742-111560764 TTTTTTTTGTTGTTGAAAACTGG - Intronic
1102401465 12:112633192-112633214 TTGTTGTTGTTTTTAGAGACAGG - Intronic
1102459034 12:113088852-113088874 TTGTTGTTGTTGTTTAAGCTGGG + Intronic
1102673771 12:114642426-114642448 TTGTTGTTGTTCTTTGAGACAGG - Intergenic
1102902984 12:116653047-116653069 TTGTTGTTGTTGTTTGAGACAGG - Intergenic
1103077293 12:117994350-117994372 TTGTTGTTGTTGTTTGACACAGG - Intergenic
1103183292 12:118934010-118934032 TTGTTGTTGTTGTTAGAGACAGG - Intergenic
1103667083 12:122577081-122577103 TTGTTGTTGTTTTTTGAGACAGG + Intronic
1103910088 12:124347360-124347382 TTGTTGTTGCTGTTTGAGACAGG - Intronic
1104136481 12:125944474-125944496 TTGTTGTTGTTGTTTTAGGCAGG - Intergenic
1104342582 12:127965080-127965102 TTGTTGTTGTTGTTTTGCAGGGG + Intergenic
1104415012 12:128590781-128590803 TTGTTTTTGTTTTTAAAGACAGG + Intronic
1104688950 12:130810014-130810036 TTGTTGTTGTTGTTTGACCTGGG - Intronic
1104886530 12:132112614-132112636 TTGTTGTTGTTGTTTTAAACAGG + Intronic
1105582208 13:21709189-21709211 TTGTTGTTGTTGTTTTAAAAAGG - Intergenic
1105674806 13:22659592-22659614 TTGTTGTTGTTGTTGTTAACAGG + Intergenic
1106452188 13:29892702-29892724 AAGTTGTTGGTGTTCATCACTGG - Intergenic
1106539393 13:30676340-30676362 TTGTTGTTGTTTTTTAAAAAAGG - Intergenic
1106894756 13:34287893-34287915 TTGTTGTTGTTGTTGTTCAGAGG + Intergenic
1106894757 13:34287896-34287918 TTGTTGTTGTTGTTCAGAGGTGG + Intergenic
1106993344 13:35450479-35450501 TTGTTGTTGTTGTTTGAGACAGG - Intronic
1107110349 13:36690967-36690989 TTGTTGTTGTTGTGGAAAACTGG - Intronic
1107392323 13:39979213-39979235 TTGTTCCTGTTGTCCACCACAGG + Intergenic
1107775980 13:43841712-43841734 TTGTTGTTGTTGTTGAAGTGGGG + Intronic
1107854357 13:44600188-44600210 TTGTTGTTGTTGTTTGAGACGGG + Intergenic
1107881682 13:44837721-44837743 TTGTTGTTGTTGTCTGAGACAGG + Intergenic
1108089302 13:46830148-46830170 TTGTTGTTGTTGGTCATTTCAGG + Intergenic
1108213843 13:48164590-48164612 TTGTTGTTGTTGTTAAATTGAGG - Intergenic
1108723224 13:53153316-53153338 TCATTTTTATTGTTCAACACAGG + Intergenic
1108789791 13:53954607-53954629 TTGTTGTTGTTGTGTTACAATGG - Intergenic
1109032543 13:57210778-57210800 TTTTTGTTGTTGTTCCAGACAGG + Intergenic
1109167687 13:59056304-59056326 TTGTTGTTGTTGTTGAGTTCTGG + Intergenic
1109879657 13:68454402-68454424 TTTTTGTTGTTGTACAAAATAGG - Intergenic
1110692854 13:78452225-78452247 TTGTTGTTGTTGTTTGAGACAGG + Intergenic
1111290530 13:86162777-86162799 TTGTTGTTGTTGTTCCCTTCTGG - Intergenic
1111476356 13:88753549-88753571 TTGCTGTTGTTGCTGAAAACTGG + Intergenic
1111480142 13:88813419-88813441 TTTTTGTTGTTGTTCATCCAGGG - Intergenic
1111570159 13:90073615-90073637 TTGTTGTTGTTGTTGAGGCCAGG - Intergenic
1111687414 13:91518354-91518376 TTGTTGTTGTTGTTTGAGATGGG - Intronic
1111794869 13:92905769-92905791 TTTTTGTTGTTGTTGAAAGCTGG - Intergenic
1112010913 13:95293184-95293206 TTTTTGTTGTTGTTAGAGACAGG - Intronic
1112117903 13:96377345-96377367 TTGTTGTTGTTGTTTGAGACAGG - Intronic
1112129984 13:96512552-96512574 TTTTTGTTGTTGTTCTTCAGTGG + Intronic
1112249064 13:97762197-97762219 TTGTTGTTGTTGTTGAAAAATGG - Intergenic
1112277378 13:98033968-98033990 TTGTTGTTGTTTTTTGAAACAGG + Intergenic
1112353514 13:98655814-98655836 TTGTTGTTGTTGTTTTAAAGAGG + Intergenic
1112390557 13:98980029-98980051 TTATTGTTGTTGTTTGAGACAGG + Intronic
1112631448 13:101165475-101165497 TTGTTGTTGTTATTTGAGACAGG + Intronic
1112893648 13:104270238-104270260 TTGTTGTTGTTGTTAAAGATGGG + Intergenic
1113173878 13:107538009-107538031 TTGTTGTTGTTGTTTGAGATGGG - Intronic
1113246706 13:108404441-108404463 TTGTTGTTATTGTTTAAGATTGG - Intergenic
1114832140 14:26157436-26157458 TTGTTGTTGTTTTTTCAGACAGG + Intergenic
1114955121 14:27807781-27807803 TTATTGTTGTTGTTTAACACAGG + Intergenic
1115209570 14:30952110-30952132 TTTTTTTTGTTGTTTAAGACAGG - Intronic
1115246832 14:31304201-31304223 TTGTTGTTTTTGTTTGACACAGG - Intronic
1115255151 14:31392978-31393000 TTGTTGTTGTTTTTGGAAACAGG - Intronic
1115544107 14:34449387-34449409 TTTTTGTTTTTTTTCAAGACAGG - Intronic
1115853763 14:37608313-37608335 TTGTTGTTGTTTTTTGAGACAGG + Intronic
1116116005 14:40651389-40651411 TTGTTGCTGTTGTTGAAAGCAGG - Intergenic
1116173841 14:41438982-41439004 TTGTTGATGGTTTTCAACAGAGG + Intergenic
1116403831 14:44543450-44543472 TTGTTTTTGTTATTCAAGGCAGG + Intergenic
1116632494 14:47353623-47353645 TTGTTGTTATTGGTCTACTCAGG - Intronic
1117386520 14:55219474-55219496 TTGTTTCTGTTGTTCATCACTGG - Intergenic
1117399769 14:55348232-55348254 TTGTTGTTGTTTTTGGAGACAGG + Intronic
1117700657 14:58410075-58410097 TTGTTGTTGTTGTTGTTGACAGG + Intronic
1117909118 14:60619603-60619625 TTTTTGTTGTTGTTTGAGACAGG + Intergenic
1118433403 14:65746081-65746103 TTGTTGTTGTTGTTATATAGAGG + Intergenic
1118458844 14:65969609-65969631 TTGTTGTTGTTTTTAGAGACAGG - Intronic
1118750246 14:68802188-68802210 TTTTTGTTGTTGTTGAAAACTGG + Intergenic
1118836430 14:69481313-69481335 TTGTTGTTGTTGTTAGAGACAGG - Intergenic
1118966030 14:70586460-70586482 TTGTTGTTGTTTTTAAACATGGG - Intronic
1119056531 14:71427962-71427984 TTGTTGTTGTTGTTGAAAACTGG + Intronic
1119249882 14:73143017-73143039 TTGTTGTTTTTGTTGTTCACAGG + Intronic
1119306800 14:73614193-73614215 TTGTTGTTGTTGTTTGAGGCAGG - Intronic
1119537758 14:75416833-75416855 TTGTTGTTGTTGTTTGAGACAGG - Intergenic
1119617063 14:76105810-76105832 TTGTTGTTGTTGTTTGAGACAGG + Intergenic
1119633318 14:76253173-76253195 ATTTTATTGTTGTTCAAGACGGG - Intronic
1119885743 14:78139911-78139933 TTGTTGTTTTTTTTCAATACTGG - Intergenic
1120341146 14:83222455-83222477 TTGTGGTTGTTGTTAAAAACTGG + Intergenic
1120399093 14:84005487-84005509 TTGTTATTGTTATTCTAGACAGG - Intergenic
1120527723 14:85596509-85596531 TTGTTGTTGTTGTTTAAATGTGG + Intronic
1121689106 14:95862981-95863003 TTGTTGTTGTTGTTGGAGACAGG - Intergenic
1122209324 14:100164908-100164930 TTTTTGTTGTTGTTGGACATTGG - Intergenic
1122305612 14:100764459-100764481 TTGTTGTTGTTTTTAGAGACAGG - Intergenic
1122512281 14:102279298-102279320 TTGTTGTTGTTGTTTGAGACAGG + Intronic
1122556068 14:102580767-102580789 TTGTTGTTGTTGTTGTTGACAGG + Intergenic
1122653358 14:103239754-103239776 TTGTTTTTGTTGTTTGAGACAGG + Intergenic
1122762128 14:104036983-104037005 TTGTTGTTGTTTTTTGAGACAGG + Intronic
1123498764 15:20859629-20859651 TTGTTGTTGTTGTTAGAGACAGG + Intronic
1123555998 15:21433257-21433279 TTGTTGTTGTTGTTAGAGACAGG + Intronic
1123592240 15:21870591-21870613 TTGTTGTTGTTGTTAGAGACAGG + Intergenic
1123890132 15:24769156-24769178 TTGTTGTTGTTGTTGTTGACAGG - Intergenic
1124070817 15:26391595-26391617 TTGTTGTTGTTGTTTAATTAGGG + Intergenic
1124570854 15:30862591-30862613 ATGTTTTTGTTGTTGAAAACTGG + Intergenic
1124709324 15:31992573-31992595 TTGTTGTTGTTGTTGTTCCCTGG + Intergenic
1125251585 15:37711363-37711385 TTGCTGGTGTTTTCCAACACAGG - Intergenic
1125306256 15:38319278-38319300 TTGTTGTTGTTGTTGCAAAATGG + Intronic
1125549160 15:40531618-40531640 TTGTTGTTGTTGTTTGAGACAGG + Intronic
1125607085 15:40945765-40945787 TTGTTGTTGTTGTTAGAGACTGG - Intergenic
1125631126 15:41147878-41147900 TTGTTGTTGTTGTTCTACTTGGG + Intergenic
1125764190 15:42122135-42122157 TTGTTGTTGTTGTTGAACTCAGG + Intergenic
1125790434 15:42361464-42361486 TTATTGTTGTTGTTTGAGACTGG - Intronic
1125916840 15:43495183-43495205 TTATTGTTGTTGTTTCAGACAGG - Intronic
1125929700 15:43591499-43591521 TTGTTGTTGTTTTTTGAGACAGG - Intergenic
1125942867 15:43691331-43691353 TTGTTGTTGTTTTTTGAGACAGG - Intergenic
1126159408 15:45596201-45596223 TTGTTGTTGTTGTTTGAGACAGG + Intronic
1126499632 15:49330952-49330974 TTGTTGTTGTTGTTGAAACAGGG - Intronic
1126506630 15:49412307-49412329 TTCTTTTTGTTGTGCAATACAGG + Intronic
1126819754 15:52490722-52490744 TTGTTGTTGTTGTTTGAGACAGG + Intronic
1127255768 15:57291528-57291550 TTGTTGTTGTTGTTTGAGACAGG + Intronic
1127430952 15:58907612-58907634 TTGTTGTTGTTGTTGAGACCTGG - Intronic
1128038673 15:64550337-64550359 TTGTTGTTGTTGTTAAATTGTGG + Intronic
1128481337 15:68042268-68042290 TTTTTGTTGTTGTTGAAAACTGG + Intergenic
1128664668 15:69529427-69529449 TTCTTGTTGTTGTTTGAGACAGG + Intergenic
1128962564 15:72022859-72022881 TTGTTGTTGTTGTTGAAAACTGG - Intronic
1129260121 15:74361401-74361423 TTGTTGTTGTTGTTTTACGTGGG - Intronic
1129425654 15:75460679-75460701 TTGTTGTTGTTGTTTGAGACAGG - Intergenic
1129557583 15:76529047-76529069 TTGTTGTTGTTGTTTGAGACAGG + Intronic
1129575402 15:76738146-76738168 TTCTTTTTGTTTTTCAAGACTGG + Intronic
1129806023 15:78458813-78458835 TTGTTGTTGTTTTTTGAGACAGG + Intronic
1129978222 15:79841240-79841262 TTGTTGTTGTTGTTAGAGACGGG + Intronic
1130327187 15:82890334-82890356 TTGTTGTTGTTTTTTGAGACAGG - Intronic
1130626281 15:85518821-85518843 TTTTTGTTGTTGTTTGAGACAGG - Intronic
1130630096 15:85559107-85559129 TTGTTGATCTTGGTCAACAGTGG + Intronic
1131490822 15:92861264-92861286 TTGTTGTTGTTGTTTGAGATGGG + Intergenic
1131603591 15:93876544-93876566 TTCTTGTTGTTGTTAAAAATTGG + Intergenic
1131634912 15:94222210-94222232 TTGTTGTTGTTGTTAAATGTAGG - Intergenic
1131721681 15:95175803-95175825 TTGTTGTTGTTGTTTGAGATGGG + Intergenic
1132052303 15:98617044-98617066 TTATTGTTGTTGTTTGAGACAGG - Intergenic
1202964341 15_KI270727v1_random:160468-160490 TTGTTGTTGTTGTTAGAGACAGG + Intergenic
1133000385 16:2848073-2848095 TTATTGTTGTTGTTAGAGACAGG - Intergenic
1133198333 16:4186555-4186577 TTGTTGTTGTTGTTGTAGAGAGG + Intergenic
1133989133 16:10691317-10691339 TTGTTGATGTTGTTTGAGACAGG - Intronic
1134119541 16:11574019-11574041 TTGTTGTTGTTTTTAAAGACAGG + Intronic
1134162754 16:11905060-11905082 TTGTTGTTATTGTTTGATACAGG - Intronic
1134218792 16:12337345-12337367 TTGTTGTTGTTGTTCAAGACAGG + Intronic
1134463621 16:14452044-14452066 TTGTTGTTGTTGTTTGAGACAGG - Intronic
1134465306 16:14470954-14470976 TTGTTGTTGTTGTTAGAGATGGG + Intronic
1134620473 16:15685258-15685280 TTGTTTTTGTTTTTCGAGACAGG + Intronic
1134686272 16:16160797-16160819 TTGTTGTTGCTGTTTGAGACAGG - Intronic
1135085952 16:19474663-19474685 CTTTTGTTGTTGTTTAAGACAGG - Intronic
1135118383 16:19743265-19743287 TTGTTGTAGTTATTACACACAGG + Intronic
1135432456 16:22397050-22397072 TTTTTGTTGTTTTTTAAGACAGG - Intronic
1135502625 16:23010425-23010447 TTGTTGCTGTTGTTTGAGACAGG + Intergenic
1135753631 16:25077765-25077787 TTGTTGTTGTTATTGGAGACAGG - Intergenic
1135853876 16:25988587-25988609 TTGTTTTTGTTGTTAAAGGCAGG + Intronic
1136357348 16:29753781-29753803 TTTTTGTTGTTGTTAGAGACAGG - Intergenic
1136407352 16:30055803-30055825 TTTTTGTTGTTGTTTGAGACAGG + Intronic
1136496224 16:30646476-30646498 TTGCTGTTGTTGTTTGACACAGG - Intergenic
1136664768 16:31800491-31800513 TTGTTGTTGTTGTTTGAGATAGG + Intergenic
1137297018 16:47104571-47104593 TTTTTCTTGTTTTTCAAAACTGG - Intronic
1137431686 16:48423224-48423246 TTATTGTTGTTGTTAGAGACAGG - Intronic
1137600190 16:49751225-49751247 TTGTTGTTGTTGTATGAGACAGG + Intronic
1137770390 16:51011881-51011903 TTGTTTCTCTTGTTCACCACTGG + Intergenic
1137930066 16:52578643-52578665 TTTGTGTTGTTGGTCAACATAGG - Intergenic
1138013949 16:53412548-53412570 TTGTTGTTGTTGTTAGAGACGGG + Intergenic
1138646554 16:58429891-58429913 TTGTTGTTGTTGTTGAAACAGGG + Intergenic
1138735046 16:59240605-59240627 TTGTTGTTGTTGTTGGAGACAGG - Intergenic
1139119525 16:63998596-63998618 TTGCTGTTGTTGTTAGAAACTGG - Intergenic
1139413274 16:66783728-66783750 TTGTTGTTGTTGTTTAGAAGTGG + Intronic
1139462792 16:67135987-67136009 TTGTTGTTGTTGTTCATGGTTGG - Intronic
1139842104 16:69889958-69889980 TTGTTGTTGTTGTTTGAGACAGG + Intronic
1139845206 16:69916198-69916220 TTGTTGTTGTTGTTTGAGACAGG + Intronic
1139941814 16:70610977-70610999 TTTTTGTTGTTGTTTGAGACAGG + Intronic
1140031277 16:71341161-71341183 TTTTTGTTTTTTTTCAAGACAGG - Intergenic
1140131938 16:72170437-72170459 CTGTTGTTGTTGTTTGAGACAGG + Intronic
1140184894 16:72760163-72760185 TTGTTGCTGTTGTTGAAAACTGG + Intergenic
1140231403 16:73120264-73120286 TTGTTATTGTTGTTAGAGACAGG + Intergenic
1140251475 16:73298183-73298205 TTGTTGTTGTTGTTAGAGACAGG - Intergenic
1140694362 16:77517592-77517614 TTGTTGTTGTTATTTGAGACAGG - Intergenic
1141336069 16:83156553-83156575 TTGTTGTGGTTGTTGCACAAAGG + Intronic
1141357836 16:83365274-83365296 CTGATGTTGTAGTTCAAGACAGG + Intronic
1141370286 16:83480308-83480330 TTATTGTTGTTGTTTGAGACAGG - Intronic
1142399279 16:89850839-89850861 TTGTTGTTGTTTTTTTAGACAGG + Intronic
1142550348 17:734482-734504 TTGTTGTTGTTGGTAGAGACAGG + Intronic
1142675558 17:1511282-1511304 TTGATGTTGTTTTACAATACAGG - Intronic
1142679228 17:1536123-1536145 TTGTTGTGGTTAATTAACACAGG - Intronic
1142872794 17:2831887-2831909 TTGTTGTTGTTTTTTGAGACAGG - Intronic
1143427179 17:6849230-6849252 TTGTTGTTGTTGTACCCCAGTGG - Intergenic
1143603925 17:7969651-7969673 TTGTTGTGGTTGCTCAAGGCAGG - Intergenic
1143693573 17:8591775-8591797 TTTTTGTTGTTGTTTGACAGGGG - Intronic
1143945723 17:10590389-10590411 TTGTTGTTTTTGTTTGAGACAGG - Intergenic
1144402329 17:14918274-14918296 TTGTTGTTGTTGTTTAATCTAGG - Intergenic
1144470109 17:15531824-15531846 CTTTTGTTGTTGTTGAAAACTGG + Intronic
1144739526 17:17573785-17573807 TTGTTTTTGTTTTTTAAGACAGG + Intronic
1144926234 17:18811828-18811850 CTTTTGTTGTTGTTGAAAACTGG - Intergenic
1145226058 17:21128902-21128924 TTGTTGTTGTTGTTTGAGACAGG - Intronic
1145972625 17:28965631-28965653 TTGATGTTGTTTTTCGAAACAGG - Intronic
1146093959 17:29909949-29909971 TTGTTGTTGTTTTTAGAAACGGG + Intronic
1146107421 17:30052658-30052680 TTATTGTTGTTGTTTAACAGTGG + Intronic
1146720200 17:35118746-35118768 TTATTGTTGTTGTTTCAGACAGG + Intronic
1146754763 17:35419875-35419897 TTGTTGTTGTTGTTGATGATGGG - Intronic
1146794404 17:35771045-35771067 TTGTTGTTGTTGTTTGAGACAGG - Intronic
1146808492 17:35884645-35884667 TTGTTGTTGTTGTTTGAAACAGG + Intergenic
1146962784 17:36998714-36998736 TTGTTGTTGTTCTTAGAGACAGG - Intronic
1147305491 17:39561308-39561330 TTTTTGTTGTTTTTGAACAGGGG + Intronic
1147454620 17:40529415-40529437 TTGTTATGATAGTTCAACACTGG - Intergenic
1147576314 17:41601743-41601765 TTGTTGTTGTTGTTTGAGACAGG + Intergenic
1147682560 17:42260581-42260603 TTGTTGTTGTTGTTAGAGACTGG + Intronic
1147771326 17:42869804-42869826 TTTTTGTTGTTGTTTGAAACAGG + Intergenic
1147815232 17:43204968-43204990 TTGTTGTTGTTTTTTGAGACAGG - Intronic
1147850742 17:43440615-43440637 TTGTTGTTGTTGTTTGAGATGGG + Intergenic
1148113798 17:45162728-45162750 TTTCTGTTGTTGTTCAAAGCAGG + Exonic
1148201883 17:45754597-45754619 TTGTTGTTGTTGTTTGAGACAGG - Intergenic
1148522372 17:48291110-48291132 TTTTTGTTTTTGTTTAAGACAGG - Intronic
1149073006 17:52565560-52565582 TTGTTGTTGTTGTTATTCCCTGG + Intergenic
1149104082 17:52941569-52941591 TTATTATTGTTGTTAAAAACTGG + Intergenic
1149224764 17:54456813-54456835 TTTTTGTTGTTGTTCTACTTGGG - Intergenic
1149490469 17:57081375-57081397 TTGTTGTTGTTGTTAAGGTCAGG + Intergenic
1149692605 17:58590559-58590581 TTGTTGTTGTTGTTTGAGACAGG + Intronic
1149791145 17:59478499-59478521 TTGTTGTTGTTTTTTGAAACGGG - Intergenic
1150160334 17:62892655-62892677 TTGTTGTTGTTGTTTTAAAGAGG + Intergenic
1150193313 17:63266855-63266877 TTGTTGTTGTTGTTTGAAACAGG + Intronic
1150247055 17:63684131-63684153 TTGGTGCTGTTGTTCGAGACAGG - Intronic
1150457047 17:65314489-65314511 TTTTTGTTGTTGTTCCATATTGG + Intergenic
1150585334 17:66512433-66512455 TTTTTGTTGTTGTTGGAGACAGG - Intronic
1150646867 17:66984204-66984226 TTTTTGTTGTTGTTAGAAACGGG - Intronic
1150721834 17:67620057-67620079 TTGTTGTTGTTTTTTGAGACAGG + Intronic
1150762012 17:67970961-67970983 TTGCTGTTGTTGTTCTGCCCAGG + Intronic
1150905974 17:69337816-69337838 TTGTTGTTGTTGTTTGAGACAGG - Intergenic
1151075479 17:71267369-71267391 TTGTTGTTGTTGTTGGAAATGGG + Intergenic
1151346179 17:73503197-73503219 TTGTTGTTCTTCTTCAACGCCGG - Intronic
1151355621 17:73556333-73556355 TTGTTGTTGTTGTTTAATAAAGG + Intronic
1151480093 17:74365338-74365360 TTGTTGTTGTTGTTAGATATGGG + Intergenic
1151650430 17:75465003-75465025 TTGTTGTTGTTGTTAGAGACAGG + Intronic
1151861983 17:76771031-76771053 TTTTTGTTGTTGTTAGAGACAGG - Intronic
1151868846 17:76822842-76822864 TTCTTGTTGTTGTTTGAGACAGG + Intergenic
1151947681 17:77328369-77328391 TTGTTGTTGTTGTTTGATACGGG + Intronic
1152185159 17:78851557-78851579 TCGTTGTTGTTGTTTGAGACAGG + Intergenic
1152429626 17:80241263-80241285 TTCTTGTTGTTGTTTGAGACAGG + Intronic
1152512078 17:80797136-80797158 TTGTTGTTGTTTTTCCAGACAGG + Intronic
1152836501 17:82536332-82536354 TTTTTGTTGTTGTTGCAAACTGG + Intronic
1153033434 18:736165-736187 TTGTTGTTGTTTTTCGAGATAGG - Intronic
1153175006 18:2361803-2361825 TTGTTGTTTTTGTTTATCTCAGG + Intergenic
1153344580 18:4011826-4011848 TTGTTGTTGTCGTTTGAGACAGG - Intronic
1153657841 18:7301208-7301230 ATTTTGTTGTTGTTGAAAACTGG + Intergenic
1154381199 18:13851576-13851598 TTGTTGTTGTTGTTGAGACCAGG - Intergenic
1154456810 18:14536402-14536424 TTGTTGTTGTTGTTAGAGACAGG + Intronic
1154965750 18:21354414-21354436 TTCTTGTTGTTGTTGAAAACTGG - Intronic
1155293558 18:24365005-24365027 TTGTTGTTGTTTTTTGAGACAGG - Intronic
1155314018 18:24553082-24553104 TTCTTGTTGTTGTTTGAGACAGG - Intergenic
1155467608 18:26155349-26155371 TTGTTCTTTTTGTTCAAAATTGG - Intronic
1155788425 18:29932288-29932310 TTCTTGTTCTTTTTCAAAACTGG - Intergenic
1156156250 18:34306119-34306141 TTGTTCTTTTTGCTCAACATAGG - Intergenic
1156295717 18:35788938-35788960 TTGTTGTTGTTGTTTGAGATAGG + Intergenic
1156390552 18:36646767-36646789 TTGTTGTTGTTGTTTACACCAGG - Intronic
1156568973 18:38230147-38230169 ATGTTGCTGTTGTTCATGACGGG - Intergenic
1156669304 18:39448242-39448264 TTGTTGTTGTTTTTGGAGACAGG - Intergenic
1156735440 18:40252693-40252715 TTGTTGTTGTTTTTATAAACTGG + Intergenic
1156975382 18:43215832-43215854 TTGTTGTTGTTGTTGTTCATTGG - Intergenic
1157219324 18:45814811-45814833 TGGTTGTTCTTGTTCATCATGGG + Intergenic
1157253096 18:46113732-46113754 TTGTTGTTGTTGCTGGAAACTGG + Intronic
1157259967 18:46169094-46169116 TTGTTGTTGTTTTTTGAGACCGG - Intergenic
1157262110 18:46184715-46184737 TTGTTGTTGTTGTTAGAGACAGG - Intronic
1157832852 18:50873085-50873107 TCGTTGTTGTTGTTCAAGATAGG - Intergenic
1158089443 18:53693786-53693808 TTGTTGTTGTTGTTGGATACAGG + Intergenic
1158142728 18:54272476-54272498 TTGTTGTTGTTGTTGAGAAGGGG + Intronic
1158526027 18:58214649-58214671 TTGTTGTTGTTGTTTTAAACGGG + Intronic
1159091630 18:63855693-63855715 TTGTTGTTGTTGTTAGAAACGGG + Intergenic
1159187427 18:64993738-64993760 TTGTTGTTGTTGTTGTTCCCTGG + Intergenic
1159433188 18:68382973-68382995 TTGTTGATGTAGTTTAATACTGG - Intergenic
1159723943 18:71930156-71930178 TCGTTGTTGTTGTTGAAAATGGG + Intergenic
1160220132 18:76969797-76969819 TTGTTGTTGTTGTTCACTTTTGG + Exonic
1160609470 18:80074125-80074147 CTTTTGTTGTTGTTCAAGACAGG + Intronic
1161094285 19:2380276-2380298 TTGTTGTTTTTTTTTAAGACAGG - Intergenic
1161223313 19:3129511-3129533 TTGTTGTTGTTGTTTAGCTGTGG - Intergenic
1162037466 19:7949490-7949512 TTTTTGTTTTTGTTTAAGACAGG - Intergenic
1162143315 19:8597463-8597485 TTGCTGTTGTTGTTAAAGATGGG + Intronic
1162365576 19:10247063-10247085 TTGTTGTTGTTGTTTGAGACAGG - Intergenic
1162423894 19:10582349-10582371 TTGTTGTTGTTGTTAGAGATAGG - Intronic
1162685409 19:12379041-12379063 TTGTTGTTGTTGTTCAACACTGG - Intergenic
1162837296 19:13329069-13329091 TTGTTGTTGTTGTTCTTTAATGG - Intronic
1163408323 19:17137396-17137418 TTGTTGTTGTTGTTTGAGACAGG - Intronic
1163616483 19:18331936-18331958 TTGTTGTTGTTGTTTGAGACAGG + Intergenic
1163731680 19:18953360-18953382 TCTTTGTTGTTTTTCAAGACAGG - Intergenic
1164140396 19:22455171-22455193 TTGTTGTTGTTGTTCAATCTTGG + Intronic
1164567966 19:29342117-29342139 TTGTTGTTGTTGTTGAAAACTGG - Intergenic
1164579644 19:29426717-29426739 TTGTTGTTGTTGTTTAGATCAGG + Intergenic
1164853932 19:31505953-31505975 TTGTTGTTGTTGTTTGACACAGG + Intergenic
1165042429 19:33078626-33078648 TTGTTGCTGTTGTTAGAGACAGG + Intergenic
1165202199 19:34154228-34154250 TTTTTGTTGTTGTTAGAGACAGG - Intergenic
1165250496 19:34529619-34529641 TTGTTGTTGATGTTCAGGAATGG + Intergenic
1165251222 19:34537376-34537398 TTTTTGTTGTTGTTGAATACTGG + Intergenic
1165275739 19:34749654-34749676 TTTTTGTTGTTGTAGAAGACTGG - Intergenic
1165685858 19:37819106-37819128 TTGTTGTTGTTGTTGTTAACAGG - Intergenic
1165913765 19:39245490-39245512 GTTTTGTTGTTGTTTAAGACAGG + Intergenic
1165917195 19:39268134-39268156 GTTTTGTTGTTGTTTAAGACAGG - Intergenic
1166023037 19:40050375-40050397 TTGTTGTTGTTGTTTTCCAGGGG - Exonic
1166025945 19:40084796-40084818 TTGTTGTTGTTGTTTTCCAGGGG - Exonic
1166088636 19:40493553-40493575 TCGTTGTTGTTTTTAATCACAGG + Intronic
1166188232 19:41156842-41156864 TTGTTGTTGTTGTTTGAGACAGG - Intergenic
1166196912 19:41212684-41212706 TTGTTGTTGTTGTTTGAGATGGG - Intergenic
1166574681 19:43826738-43826760 TTATTGTTGTCTTTCAACAGCGG + Intronic
1166768903 19:45268737-45268759 TTGTTGTTGTTTTTAGAGACAGG - Intronic
1166858490 19:45795566-45795588 TTGTTGTTGTTGTTTGAGACAGG - Intergenic
1166926208 19:46270251-46270273 TTGTTGTTGTTTTTGGAGACAGG - Intergenic
1167598988 19:50442724-50442746 TTGTTGTTGTTGTTGTTAACAGG - Intronic
1167623744 19:50573148-50573170 TTGTTGTTGTTGTTTGAGACAGG - Intergenic
1167730823 19:51253101-51253123 TTTTTGTTTTTTTTTAACACAGG - Intronic
1168431252 19:56282653-56282675 TTGTTGTTGTTGTTCATCAAAGG - Intronic
1168670986 19:58240975-58240997 TTATTGTTGTTGTTTGAGACAGG + Intronic
925343759 2:3155048-3155070 TTGTTTTTATTGTTCCATACTGG + Intergenic
926447396 2:12960455-12960477 TTGTTGTTGTTGTTGAAAACTGG + Intergenic
926855020 2:17246165-17246187 TTGTTGTTGTTGCTCAAGAAGGG - Intergenic
927483923 2:23475903-23475925 TTTTTGTTGTTGTCCAGCCCAGG + Intronic
927752352 2:25680765-25680787 TTGCTGTTGTTGTTTCAGACAGG + Intergenic
927782303 2:25949536-25949558 TTGTTGTTGTTGTTTGAGACAGG - Intronic
927834092 2:26377872-26377894 TTTTTGTTGTTGTTGAAAACTGG + Intronic
928126772 2:28621878-28621900 TTGTTGTTCTTGTACAGTACAGG + Intronic
928229499 2:29484878-29484900 TTGTTGTTGTTGCTAATGACAGG + Intronic
928745256 2:34406273-34406295 TTGTTGTTGTTGTTCTTTTCTGG + Intergenic
928831572 2:35492133-35492155 TTTTTGTTGGTGTTCATCAAAGG + Intergenic
929101872 2:38322877-38322899 TTGTTGTTGTTGTTAAATAGAGG - Intronic
929108289 2:38385238-38385260 TTGTTTTTTTTTTTCAAGACAGG - Intergenic
929134170 2:38606842-38606864 TTGTTGTTGTTGGTAGAGACGGG + Intergenic
929629906 2:43448880-43448902 TTGTTGTTGTTGTTGGAAACAGG - Intronic
929716103 2:44311456-44311478 TTGTTGTTGTTGTTAAAAACCGG + Intronic
929777389 2:44937766-44937788 TTGTTGTTGTTGTTTTTCAAAGG + Intergenic
930392105 2:50774234-50774256 TTGTTGTTGTTGTTTTAAAAAGG - Intronic
930443076 2:51433162-51433184 TTGTTGTTGTTGCTAAAAAAGGG - Intergenic
930709916 2:54540999-54541021 TTTTTGTTGTTATTAACCACAGG - Intronic
930829412 2:55726845-55726867 TTGTTGTTGTTGTTTTAGACAGG - Intergenic
931358833 2:61560554-61560576 TTGTTGTTGTTTTTAAACCAAGG - Intergenic
931562299 2:63574679-63574701 TTTTTCTTATTGTTCAATACTGG - Intronic
932369231 2:71173812-71173834 TTGCTGTTGTTGTTTGAGACAGG - Intergenic
932530521 2:72525482-72525504 TTGTTGTTGTTGTTCTAGCCAGG - Intronic
932610257 2:73193697-73193719 TTGTTGTTGTTGTTGGAGACAGG - Intergenic
932867214 2:75356271-75356293 TTGTTGTTGTTTTTTATAACTGG + Intergenic
932977138 2:76616255-76616277 TTGTTGTTGTTGTTTGAGACAGG - Intergenic
933124312 2:78585438-78585460 TTGTTGTTGTTTTTCTTGACTGG - Intergenic
933517323 2:83321475-83321497 TTGTTGTTGTTGTTTTAAATGGG + Intergenic
933796289 2:85922650-85922672 TTGTTGTTGTTTTTTGAGACAGG + Intergenic
933932849 2:87172204-87172226 TTGTTGTTGTTTTTGGAGACAGG - Intergenic
934061376 2:88297331-88297353 TTGTTACTGTTGTTCAAAATGGG - Intergenic
934902907 2:98175092-98175114 TTTTTGTTGTTGTTGACAACTGG - Intronic
935077904 2:99763540-99763562 TTGTTGTTGTGATTAAAGACAGG - Intronic
935448550 2:103183289-103183311 TTGTTGTTGTTGTTGTTAACTGG + Intergenic
935462793 2:103358416-103358438 TTGTTTTTGTTTTTCCAAACTGG + Intergenic
935928043 2:108091717-108091739 TTATTGCTGTTATTCAACATAGG - Intergenic
936700979 2:115011568-115011590 TTGTTGTTGTTGTTTAATGCTGG + Intronic
936704158 2:115051065-115051087 TTGTGTTTGTTGTTGAAAACTGG - Intronic
936804597 2:116314136-116314158 TTCTTGTTGCTTTCCAACACTGG + Intergenic
937188873 2:120073161-120073183 TTGTTTTTGTTTTTCAGCATTGG + Exonic
937190963 2:120098213-120098235 TTGTTGTTGTTTTTTGAGACAGG + Intronic
937382073 2:121387489-121387511 TTGGTCTTATTTTTCAACACTGG - Intronic
937417023 2:121723546-121723568 TTGTTGTTGTTGTTAGAGACAGG - Intergenic
937611723 2:123869723-123869745 TTGTTGTTGTTTTTTGAAACAGG + Intergenic
937764818 2:125648829-125648851 TTGTTGTTGTTGTTGAAAACAGG + Intergenic
938255053 2:129851368-129851390 TTGTTGTTGTTGCTGAAAATTGG - Intergenic
938285644 2:130113534-130113556 TTGTTGTTGTTGTTAGAGACAGG + Intronic
938336287 2:130502097-130502119 TTGTTGTTGTTGTTAGAGACAGG + Intronic
938353537 2:130618565-130618587 TTGTTGTTGTTGTTAGAGACAGG - Intronic
938429962 2:131225370-131225392 TTGTTGTTGTTGTTAGAGACAGG - Intronic
938474774 2:131598552-131598574 TTGCTGTTGTTGTTAGAGACAGG - Intergenic
938508238 2:131909681-131909703 TTGTTGTTGTTGTTCATGTAGGG + Intergenic
938751808 2:134338768-134338790 TTTTTGTTGTTTTTCATCCCTGG + Intronic
938866963 2:135432761-135432783 TTGTTGTTGTTGTTCCTTTCTGG - Intronic
938878462 2:135559115-135559137 TTGTTGTTGTTGTCGGAGACAGG + Intronic
938894645 2:135738029-135738051 TTGTTGTTGTTGTTTGAGACAGG + Intergenic
939065408 2:137478429-137478451 TTGTTGTTGTTATCCACCTCTGG + Intronic
939106582 2:137955470-137955492 TTGTTGTTGTCTTTAAAGACAGG - Intergenic
939163357 2:138614538-138614560 TTGTTGTTGTTGTTGAAATGAGG - Intergenic
939419231 2:141944263-141944285 TTATTATTGTTATTCAATACTGG + Intronic
939441254 2:142253138-142253160 TTGTTGTTGTTGTTGAAACAGGG - Intergenic
939449973 2:142361545-142361567 TTGTTGTTGTTGTTGTTTACAGG + Intergenic
939505911 2:143047068-143047090 TTGTTGTTGTTTTAAAAGACAGG + Exonic
939646286 2:144703130-144703152 TTTTGATTGTTGTTTAACACGGG + Intergenic
939916332 2:148048435-148048457 TTATTGTTGATTTTCAACATAGG - Intronic
940311770 2:152286681-152286703 TTGTTTTTATTTTTCAAGACAGG + Intergenic
940346068 2:152630461-152630483 TTGTTGTTGTTGTTGCATGCAGG + Intronic
940701414 2:157048278-157048300 TTGTCTTTGTTGTTAAATACAGG - Intergenic
940762983 2:157758409-157758431 TTGTTGTTGTTGTTCACGTGTGG + Intronic
940766609 2:157796542-157796564 TTGTTGTTGTTGTTTGAAACGGG - Intronic
941063228 2:160871672-160871694 TTGTTGTTGTTGGTAGAGACAGG + Intergenic
941067912 2:160924198-160924220 TTGTTGTTGTTTTTAGAGACAGG - Intergenic
941685887 2:168448133-168448155 TTGTTGTTGTTGTTGTTCAGAGG + Intergenic
942033576 2:171988715-171988737 TTGTTGTTGTTGGTAGAGACAGG + Intronic
942251971 2:174054851-174054873 TTGTTGTTATTTTTAGACACAGG - Intergenic
942462935 2:176181694-176181716 TTGTTGTTGTTGTTTGAGACAGG - Intergenic
942784801 2:179688482-179688504 TTGTTGTTGTTGTTTTGCAGGGG - Intronic
943174840 2:184457475-184457497 TTGTTGTTGTTGTTGAAAGCTGG - Intergenic
943217736 2:185060132-185060154 TTGTTGTTGTTTTTAAACATAGG + Intergenic
943273481 2:185837949-185837971 TTGTAGTTGTTTTTCAAAATTGG - Intergenic
943331952 2:186570531-186570553 TTGTTGTTGTTTTTTGAGACAGG + Intergenic
943874154 2:193040925-193040947 TTATTGTTGTTGTTAAAACCGGG - Intergenic
944009211 2:194952933-194952955 TTGTTGTTGTTGTTGTACAGAGG - Intergenic
944301217 2:198126895-198126917 TTGTTGTTGTTGTTTGAGACAGG - Intronic
944610110 2:201394684-201394706 TTGTTGTTGTTTTTTAAATCTGG + Intronic
944754859 2:202750505-202750527 TTGTTGTTGTTGTTTGAGACAGG - Intronic
944811921 2:203335431-203335453 TTGTTGTTGTTGTTAGAAATGGG + Intronic
945160880 2:206889359-206889381 TTGTTGTTGTTGTTTGAGATAGG + Intergenic
945280369 2:208030144-208030166 TTGTTTTTGTTTTTTAAGACAGG - Intergenic
945678921 2:212889352-212889374 TTGTTATTGTTGTTTGAGACAGG - Intergenic
946304565 2:218848412-218848434 TTGTCGTTGTTGTTTGAGACAGG - Intergenic
946390547 2:219413574-219413596 TTGTTGTTGTTGTTGAAACAGGG - Intergenic
946776444 2:223147353-223147375 TTTTTGTTGTTGTGCAAAATAGG - Intronic
946914093 2:224498328-224498350 TTGTTTTTGTTGTTCAAAACTGG + Intronic
947393448 2:229663830-229663852 TTTTTGTTGTTGTTCCAAGCTGG + Intronic
947824973 2:233099515-233099537 TTGTTGTTGTTGAAGAGCACAGG - Intronic
947925984 2:233923041-233923063 TTGTTGTTGTTGTTAGAGATGGG + Intronic
948114578 2:235484953-235484975 TTGTTTTTGTTTTTTAACAATGG - Intergenic
948410270 2:237754569-237754591 TTGTTGTTGTTGTTTTTAACTGG + Intronic
1168884069 20:1232821-1232843 TTGTTGTTGTTGTTCCTAAAAGG - Intronic
1168954129 20:1822435-1822457 TTGTTGTTGTTGTTGAAAACTGG - Intergenic
1169407784 20:5337646-5337668 TTGTTTTTGTTGTTGAAAACAGG - Intergenic
1169891954 20:10463046-10463068 TTGTTGTTGTTTTTAGAGACAGG - Intronic
1170306858 20:14947894-14947916 TTGTTGTACTTGATAAACACTGG - Intronic
1170870219 20:20199254-20199276 TTGTTGTTGTTGTTGAACAAAGG + Intronic
1171073016 20:22093642-22093664 TTGTTTTTGTTGTTGAAAACTGG + Intergenic
1171996525 20:31735908-31735930 TTGTTTTTGTTTTTAAAGACAGG + Intergenic
1172218383 20:33252800-33252822 TTTTTATTGTTGTTGAACACTGG - Intergenic
1172427528 20:34865171-34865193 TTATTGTTGTTGTTTGAGACAGG + Intronic
1172637177 20:36417787-36417809 TTGTTGTTGTTGTTTGAGATGGG + Intronic
1173211669 20:41038395-41038417 TTGTTGTTGTTTTTTAGCATTGG - Intronic
1173398530 20:42703344-42703366 TTGTTTTTGTTACTCAACAGAGG - Intronic
1175455659 20:59111459-59111481 TTGTTGTTGTTGTTTTAGAAAGG - Intergenic
1175861950 20:62155227-62155249 TTGTTGTTGTTGGTAGAGACAGG - Intronic
1176104220 20:63378102-63378124 TTGGTGTTGCTGCTCAGCACGGG - Intronic
1176785256 21:13248883-13248905 TTGTTGTTGTTGTTCATGTAGGG - Intergenic
1176817353 21:13616923-13616945 TTGTTGTTGTTGTTAGAGACAGG - Intronic
1177466644 21:21492329-21492351 TTTTTGTTGTTGTTCTCCACAGG - Intronic
1177696689 21:24581946-24581968 TTGTTGTTGTTGATTGAGACAGG - Intergenic
1178252883 21:31021336-31021358 TTGTTGTTGTGTTTTGACACAGG + Intergenic
1178559941 21:33629217-33629239 TTGTTGTTGTTTTTTGAGACAGG - Intronic
1178570988 21:33736977-33736999 TTGTTTTTGTTTTTTAAGACAGG - Intronic
1179013102 21:37571752-37571774 TTGTTTTTGCTGTTGAAAACTGG + Intergenic
1179028287 21:37698533-37698555 TTGTTGTTGTTGTTTGAGACAGG + Intronic
1179161714 21:38904796-38904818 TTGTTGTTGTTGTTCTACTGAGG - Intergenic
1180031846 21:45215588-45215610 TTGTTGTTGTTGTTTCAGATGGG - Intronic
1180964317 22:19778269-19778291 TTGTTGTTGTTGTTAGAGATGGG + Intronic
1180977777 22:19859263-19859285 TTGTTGTTGTTGTTAAAGCTAGG + Intergenic
1181150527 22:20880005-20880027 TTGTTGTTGTTGTTTGAGATAGG - Intronic
1181278416 22:21702015-21702037 TTGTTGTTGTTTTTTGAGACAGG - Intronic
1181346721 22:22224565-22224587 TTGATGCTGCTGTTCAACAATGG + Intergenic
1181616814 22:24060615-24060637 TTGTTGTTGTTGTTTGAGACAGG + Intronic
1182370622 22:29807901-29807923 TTGTTGTTGTTGTTTGAGACAGG - Intronic
1182378290 22:29864989-29865011 TTGTTGTTGTTGTTAAAGACAGG + Intergenic
1182674361 22:32026373-32026395 TTGTTGTTGTTGTTTGAGACAGG - Intergenic
1182677573 22:32051648-32051670 TTGTTGTTGTTGTTTGAAACAGG - Intronic
1182703969 22:32263178-32263200 TTGTTGTTTTTGTTAGAGACAGG + Intergenic
1182889419 22:33804678-33804700 TTGTTGTTTTTGTTTAAGCCAGG - Intronic
1183451287 22:37896797-37896819 TTGTTGTTGTTGTTTTGCCCAGG + Intergenic
1183825588 22:40384235-40384257 TTGTTGTTGTTGTTAGAGACAGG - Intronic
1183900196 22:40999693-40999715 TTGTTTTTGTTTTTCAAGACAGG + Intergenic
1183915384 22:41114185-41114207 TTGTTGTTGTTGTTTGAGATAGG + Intronic
1183989319 22:41587614-41587636 TTGTTGTTGTTGTTAGAGACCGG - Intronic
1184052120 22:42015044-42015066 TTTTTGTTGTTGTTGAAAACTGG + Intronic
1184138466 22:42563207-42563229 TTGTTGTTGTTGTTTTCAACAGG + Intronic
1184284343 22:43460327-43460349 TTGTTGTTGTTTTTTGAGACAGG + Intronic
1184532106 22:45062506-45062528 TTGTTGTTGCTGTTAGAAACAGG + Intergenic
1185028249 22:48427717-48427739 GTGTTGGTCTTGTTAAACACGGG + Intergenic
949293927 3:2498480-2498502 TCGTTGTTGTTGTTGGAGACAGG + Intronic
949349163 3:3107373-3107395 TTGTTGTTGTTGTTTTAAGCAGG - Intronic
949533934 3:4980766-4980788 TTGTTGTTGTTGTCAAATAAGGG + Intronic
950612776 3:14136948-14136970 TTTCTGTTGTTGATGAACACAGG + Intronic
950731096 3:14958675-14958697 TTGTTGTTGTTGTTCCAGATTGG + Intronic
951286838 3:20823526-20823548 TTGTTGTTGTTTTTCCTCCCAGG - Intergenic
951517685 3:23579515-23579537 TTGTTGTTGTTGTTGAGAAAGGG - Intronic
952120629 3:30239525-30239547 TTTTTGTTGTTGTTGAATAAGGG + Intergenic
952254462 3:31683522-31683544 TTGTTGTTGTTGTTTTTAACTGG - Intronic
952284301 3:31953424-31953446 TTGTTGTTGCTGTTGAGGACAGG + Intronic
952352944 3:32558225-32558247 TTGTTGTTGTTGTTTGAGACAGG - Intronic
952619249 3:35316557-35316579 TTGTTGTTGTTGTTAAAAATTGG - Intergenic
953034432 3:39199783-39199805 TTGTTGTTGTTGTTTGAGACAGG - Intergenic
953942166 3:47109640-47109662 TTTTTGTTGTTTTCCGACACAGG - Intronic
953992123 3:47492107-47492129 TTGTTGTTGTTGTTCAAGACAGG + Intergenic
954804314 3:53207307-53207329 TTGTTGTTGTTTTTTGAGACAGG - Intergenic
954918141 3:54165790-54165812 TTGTTGTTGTTTTTAGAGACAGG - Intronic
954983723 3:54770542-54770564 TTTTTGTTGTTTTTCTAAACGGG + Intronic
955556417 3:60142500-60142522 TTGTTGTTATTGTTTTACAAAGG + Intronic
955602330 3:60659846-60659868 TTGTTGTTGTTGTTGAAAACCGG + Intronic
956077599 3:65522520-65522542 TTGTATTTGTTGTTGTACACTGG - Intronic
956269446 3:67434507-67434529 TTGTTGTTATTGTTAGAGACAGG - Intronic
956654446 3:71535531-71535553 TTGTTGTTGTTGTTAGAGATGGG - Intronic
957049437 3:75399916-75399938 TTGTTGTTGTTGTTTGAGATGGG - Intergenic
957175160 3:76798884-76798906 TTGTTGTTGTTGTTTAGAAAAGG - Intronic
957589212 3:82173621-82173643 TTGTTTTTGTTTTTTAAGACAGG + Intergenic
957629152 3:82696046-82696068 TTGTTGTTGTTGTGGAATACTGG - Intergenic
957792350 3:84958368-84958390 TTGTTGTTGTTGTTGTTCAGAGG - Intergenic
958033306 3:88140701-88140723 GTGTTCTTGTGGTACAACACTGG - Exonic
958150453 3:89686449-89686471 TTGTTGTTGTTGTTTAAAGAAGG + Intergenic
958459433 3:94375492-94375514 TTGTTGTTGTTGTTTGAGACAGG - Intergenic
958624946 3:96612115-96612137 TTGTTGGTTCTGTTCACCACTGG - Intergenic
958867169 3:99515007-99515029 TTGTTGTTGTTTTTGGAGACAGG + Intergenic
959346045 3:105195923-105195945 TTGTTGCTGTTTTTCTTCACTGG - Intergenic
959349529 3:105243914-105243936 TTGTTGTTGTTGTTGATTCCAGG + Intergenic
959809910 3:110604286-110604308 TTGTTGTTGTTGTTGAAAACTGG - Intergenic
959854769 3:111138951-111138973 TTGTTGTTGTTTTTTAAGAAAGG - Intronic
960066380 3:113378045-113378067 TTGTTGTTGTTGTTTGAGATGGG + Intronic
960137983 3:114124775-114124797 TTGTTGTTGTTTTTTGAGACAGG + Intergenic
960140497 3:114147628-114147650 TTGTTGTTGTTTTTGGAGACAGG + Intronic
960369877 3:116821800-116821822 TTGTTGTTGTTTTGCAAAGCTGG - Intronic
960652184 3:119963038-119963060 TTGTTGTTGGTGTATAACAGGGG - Intronic
960812637 3:121639552-121639574 TTGTTGTTGTTTTTTGAGACAGG + Intronic
961025211 3:123549740-123549762 TTGTTGTTGTTTTTGGAGACAGG - Intronic
961025259 3:123550134-123550156 TTGTTGTTGTTGTTGAAACAGGG - Intronic
961169220 3:124784490-124784512 TTGTTGTTGTTGTTTGAGATAGG - Intronic
961184777 3:124905202-124905224 TTTTTGTTGTTGTTAGAGACAGG - Intergenic
961577102 3:127846342-127846364 TTGTTGTTGTTTTTTGAGACAGG + Intergenic
961769061 3:129235143-129235165 TTGTTGTTGTTGTTTGAGATAGG + Intergenic
961815150 3:129546102-129546124 TTGTTATTGTTATTTGACACAGG - Intronic
961881754 3:130066392-130066414 TTGTTGTTGTTTTTTAAGATGGG - Intergenic
961995774 3:131240538-131240560 TTGTTGTTGTTGTTAGAAACAGG + Intronic
962237710 3:133721883-133721905 TTGTTGCTGTTGTTCGAGACAGG + Intergenic
962559821 3:136593495-136593517 CTGTTGATGTTTTTCAAAACTGG - Intronic
962703292 3:138019739-138019761 GTGTGGTTTTTTTTCAACACAGG - Intronic
963012007 3:140778931-140778953 CTGTTGTTGTTGTTTAAAATAGG - Intergenic
963055112 3:141179937-141179959 TTGTTGTTGTTGTTTTAAATTGG - Intergenic
963444643 3:145388600-145388622 TTTTTGTTGTTGTTGAAAACTGG - Intergenic
963940180 3:151089579-151089601 TTATTGTTGTTGTTAACCAGTGG + Intronic
964084398 3:152798760-152798782 TTGTTGTTGTTTTTTGAGACGGG + Intergenic
964127435 3:153250040-153250062 TTGTTGTTGTTGTACATAGCAGG + Intergenic
964747784 3:160027875-160027897 TTGTTGTTGTTGTTAGAGATGGG - Intronic
964809121 3:160643617-160643639 TTGTTGTTGTTGTTAGAGATAGG + Intergenic
965145486 3:164896677-164896699 TTGTTGTTGTTGTTGTTGACAGG + Intergenic
965265696 3:166539529-166539551 TTGTTGTTGTTGTTAAAACTTGG - Intergenic
965320232 3:167245051-167245073 TTGTTGTTGTTGTTCCTTATTGG - Intronic
965550884 3:169963903-169963925 TTGTTGTTGTTGTTGAAGACAGG - Intergenic
965857828 3:173110137-173110159 TTGTTGTCGTTGTTCCATACAGG - Intronic
966360410 3:179123078-179123100 TTGCTGTTGTTGTTTGAGACAGG + Intergenic
966602514 3:181789539-181789561 TTGTTGTTGTTTTTCTAGACAGG + Intergenic
966625280 3:182009068-182009090 TTGTTGTTGTTGTTGAAATATGG + Intergenic
966705914 3:182913348-182913370 TTGTTGTTGTTACTGAACATTGG + Intronic
966968612 3:185020767-185020789 TTGTTGTTGTTGTTAAAATAGGG - Intronic
966989842 3:185218240-185218262 TTGTTGTTGTTGTTTATTTCAGG - Exonic
967202717 3:187087226-187087248 TTGTTGTTGTTCTTTGATACAGG - Intergenic
967778887 3:193414141-193414163 TTGTTGTTGTTGTTTATCGGGGG - Intronic
967839249 3:193991506-193991528 TTGTTGTTGTTGTTTAATCCAGG + Intergenic
969213339 4:5704709-5704731 TTGTTGTTGTTGTTTGAGAGAGG + Intronic
969434519 4:7180131-7180153 TTTTTTTTGTTGTTGAAAACTGG + Intergenic
969727212 4:8927567-8927589 TTGTTGTTGTTTTTTAAGACAGG - Intergenic
970389646 4:15594806-15594828 TTGTTGTTGTTGCTTTAAACAGG + Intronic
970562188 4:17293091-17293113 TTGTTGTTGTTGTTTTAGAGAGG - Intergenic
971430735 4:26564753-26564775 TTTTTGTTGTTGTTCCACTTGGG + Intergenic
971442870 4:26709044-26709066 TTGTTGTTGTTGTTGAAAAAGGG + Intronic
971867967 4:32196946-32196968 TTGTTGTTGTTGTTAGAAATTGG - Intergenic
972130049 4:35821446-35821468 TTGTTGTTGTTGTTCTATTCTGG - Intergenic
972131673 4:35843677-35843699 TTGTTGTTGTTGTTACAGACTGG + Intergenic
972137185 4:35906857-35906879 TTGTTGTTGTTGTTCTGTTCAGG + Intergenic
972932421 4:44089571-44089593 TTGTTGTTGTTGTTGAAATGAGG - Intergenic
973770550 4:54202478-54202500 TTGTTGTTGTTGTTTGAGATAGG - Intronic
974849965 4:67392539-67392561 TTGTTGTTGTTGTTCTCAATGGG + Intergenic
975082945 4:70302308-70302330 TTGTTGTTGTTGTTAAAAGTGGG + Intergenic
975142411 4:70931900-70931922 TTGTTGTTGTTGTTCAGACGTGG + Intronic
975272494 4:72452082-72452104 TTGTTGTTATTGTTTGAAACTGG - Intronic
975488379 4:74960591-74960613 TTTTTGTTGTTGTTGAATACTGG - Intronic
975523774 4:75327665-75327687 TTGTTGTTGTTGTTGTTCAATGG + Intergenic
975557418 4:75678156-75678178 TTGTTGTTGTTGTTTGAGACAGG + Intronic
975962921 4:79934519-79934541 TTGTTGTTGTTGTTTTAGACAGG - Intronic
976018918 4:80595466-80595488 TTATTCATGATGTTCAACACTGG + Intronic
976278399 4:83301948-83301970 TTGTTGTTGTTTTTTGAGACGGG - Intronic
976710986 4:88071568-88071590 TTGTTGTTGTTGTTAAAGATTGG + Intronic
976998901 4:91470529-91470551 TTGCTGTTGTTGTTAGAGACAGG + Intronic
977004918 4:91554574-91554596 TTCTTGTAGTCCTTCAACACAGG - Intronic
977045450 4:92063335-92063357 TTGTTGTTGTTGTTGAAAGCTGG - Intergenic
977076695 4:92461700-92461722 TTGTTGTTGTTGTTTAAATCTGG + Intronic
977256837 4:94750334-94750356 TTGTTGTTGTTGTTACACAGAGG + Intergenic
977473696 4:97475745-97475767 TTGTTGATCTTGTTGAACAGAGG + Intronic
977585534 4:98771795-98771817 TTCTTGTTGTTGTTTGAGACAGG - Intergenic
977596306 4:98885451-98885473 TTGTTGTTGTTGTTTGAGACAGG + Intronic
977734578 4:100398373-100398395 TTGTTGTTGTTGTTGCTCACAGG - Exonic
977779668 4:100966049-100966071 ATGTTGTTATTGTTCATGACTGG - Intergenic
977781936 4:100991509-100991531 TTGTTGTTTTTGCTCAATATTGG - Intergenic
978858189 4:113417412-113417434 TTGTTGTTGTTGTTGTACCTAGG + Intergenic
979183597 4:117759369-117759391 TTGTTTTTGTTTTTAAAGACAGG + Intergenic
979207733 4:118060872-118060894 TTAATGTTGCTGTTTAACACCGG + Intronic
979267366 4:118718810-118718832 TTGTTGTTGTTTTTTGAGACAGG - Intergenic
979480141 4:121207147-121207169 TTGTTGCTGTTGTTAATGACTGG + Intronic
979906007 4:126294509-126294531 TTGTTGTTGTTGCATGACACAGG + Intergenic
980312647 4:131153575-131153597 TTGTTGTTATTGTTGAAAAAGGG - Intergenic
980620185 4:135291308-135291330 TTGTTGTTGTTGTTTGAGACAGG + Intergenic
981743719 4:148031051-148031073 TTGTTGTTGTTGTTGGAGATGGG - Intronic
981823182 4:148909669-148909691 TTGTTGCTGTTGTTGTTCACAGG - Intergenic
981875389 4:149537031-149537053 TTGTTGTTATTGTTGAGCACTGG - Intergenic
981910202 4:149970540-149970562 TGGTTGTTGTTCTTCTAAACAGG - Intergenic
982014364 4:151138835-151138857 TTGTTGTTGTTTTTTGAGACGGG + Intronic
982157065 4:152534483-152534505 TTGTTGTTGTTTTTTAAAAAAGG + Intronic
983115490 4:163810982-163811004 TTGTTGTTGTTGTTAAATTTGGG + Intronic
984145514 4:176055376-176055398 TTGTTGTTGTTGTTGGAGAGAGG - Intergenic
985235096 4:187863813-187863835 TTGTTGTTGTCGTTAAGCTCTGG - Intergenic
985917471 5:2933807-2933829 TTGTTGTTGTTGTTTGAGACAGG - Intergenic
986675080 5:10177321-10177343 TTGTTGTTGTTGTTTTACTAGGG + Intergenic
986682230 5:10244521-10244543 TTGTTGTTGTTGTTAGAGATAGG - Intronic
986894498 5:12348687-12348709 TTTTTGTTGTTGTTAGAGACAGG + Intergenic
986989680 5:13537189-13537211 TTGTTGTTGTTGTTTTACCGTGG + Intergenic
987123437 5:14789221-14789243 TTGTTGTTGTTTTTGGAGACAGG - Intronic
987341656 5:16944741-16944763 TTGTTGTTGTTTTTTGAGACAGG + Intergenic
987363657 5:17129039-17129061 TTGTTGTTGTTGTTGGAGACAGG - Intronic
987436426 5:17900023-17900045 TTGTTGTTGTTGTAAAACTTGGG + Intergenic
987913502 5:24181625-24181647 TTATTGTTGTTGTTCATCTAGGG - Intergenic
988167735 5:27616520-27616542 TCGTTTTTGTTGTTCTAAACAGG + Intergenic
988285689 5:29213361-29213383 TTTTTGTTGTTGTTCCTCCCTGG + Intergenic
990027121 5:51206313-51206335 TTGTTGTTGTTGTTAGAGACAGG - Intergenic
990263432 5:54049604-54049626 TTGTTGTTGTTGTTTGAGATAGG + Intronic
990320192 5:54622194-54622216 CTGTTGCTGTTTTTCAAAACTGG - Intergenic
990432597 5:55751237-55751259 TTGTTGTTGTTTTTTGAGACAGG + Intronic
990444151 5:55878425-55878447 TTGTTGTTGTTGTTAAAAATTGG + Intronic
990653721 5:57931389-57931411 TTGTTGTTGTTTTTTGACAATGG + Intergenic
991158936 5:63472321-63472343 TTGTTGTTGTTTTTAAACTGTGG - Intergenic
992278085 5:75141794-75141816 TTGTTGTTGTTGTTTGAGACAGG - Intronic
992300906 5:75379174-75379196 TCGTTGTTGTTGTTTTAAACAGG - Intronic
992738943 5:79753576-79753598 TTGTTGTTGTTTTTAGACATGGG - Intronic
993108490 5:83626904-83626926 TTGTTGTTGTTTTTCTAAACAGG + Intergenic
993551437 5:89278647-89278669 TTGTTGTTGTTGTTCTAATGGGG + Intergenic
993712496 5:91240277-91240299 TTGTTCTTGTTGTTTTACCCTGG - Intergenic
993720574 5:91317795-91317817 TTGTTGTTGTTGTTTGAAGCAGG + Intergenic
994415392 5:99463590-99463612 TTGATGATGTGGGTCAACACAGG + Intergenic
994689980 5:103005938-103005960 TTGTTGTTGTTGTTTGAGACAGG + Intronic
994898489 5:105738375-105738397 TTGTTGTTGTTGTTGTTCCCTGG - Intergenic
994943908 5:106360951-106360973 TTGTTGCTGCTGTTTAACAGTGG - Intergenic
994945656 5:106385623-106385645 TTATTGCTGTTGTTCAGAACAGG + Intergenic
995434306 5:112118774-112118796 TTGTTGTTGTTTTTTAAAAGGGG + Intergenic
995436059 5:112136884-112136906 TTGTTGCTGTTGTTTAACAGAGG - Intergenic
995879836 5:116832130-116832152 TTGTTTTTGTTGTTTGAGACAGG + Intergenic
995905755 5:117120680-117120702 TTGTTGTTGTTGTTCTTTACAGG + Intergenic
995970150 5:117959054-117959076 TTGTTGTTATTGTTGAAAACTGG - Intergenic
996062529 5:119047924-119047946 TTGTTGTTGTTGTTCGAGGCAGG - Intronic
996082416 5:119270431-119270453 TTGTTGTTGTTTTTAGAGACAGG + Intronic
996372594 5:122769230-122769252 TTGTTGTTGTTTTTCTTCACAGG - Intergenic
997308106 5:132855614-132855636 TTGTTGTTGTTGTTAAAGACAGG + Intergenic
998307175 5:141090273-141090295 TTGTTGTTGTTGTTTGAGACAGG + Intergenic
999342683 5:150786291-150786313 TTGTTGTTGTTTTTCGAGACAGG + Intronic
999387264 5:151163149-151163171 TTATTGTTGTTGTTGGAGACAGG + Intergenic
999516295 5:152304936-152304958 ATTTTGTTGTTGTTGAACCCAGG + Intergenic
999612905 5:153390147-153390169 TTGTTGTTGTTGTTAAAAACTGG + Intergenic
999760929 5:154700587-154700609 TTGTTGTTGTGGTTTGAGACAGG + Intergenic
999760932 5:154700627-154700649 TTGTTGTTGTTGTTTGAGACAGG + Intergenic
999835827 5:155370706-155370728 TTGTTGTTGTTGTTTCAGATGGG - Intergenic
999877621 5:155825752-155825774 TTGTTGTTGTTTTTTGAGACAGG + Intergenic
999971219 5:156865522-156865544 TTGTTGTTGTTGTTTGAGACAGG + Intergenic
1000503014 5:162076266-162076288 TTATTGTTATTGTTTAATACAGG + Intronic
1000983510 5:167842249-167842271 TTGTTTTTGTTTTTAATCACAGG - Intronic
1001418687 5:171570004-171570026 TTGTTGTTGTTGTTGAAAACTGG + Intergenic
1001589206 5:172853924-172853946 TTGTTGCTATTGTTCCACATGGG + Intronic
1001618759 5:173064388-173064410 TTGTTGTTGTTGTTTGAGACAGG + Intronic
1001641974 5:173250911-173250933 TTGTTGTTGTTGTTTTTGACAGG + Intergenic
1002112354 5:176926629-176926651 TTGTTGTTGTTGTTTGAGACAGG - Intronic
1002503343 5:179661751-179661773 TTGTTGTTGTTGTTTGAGACAGG + Intergenic
1002645551 5:180651361-180651383 TTGTTGTTGTTGTTTTAGACAGG + Intergenic
1002688437 5:181033751-181033773 TTGGTGGTTTTGTTCACCACCGG + Intergenic
1004076018 6:12344864-12344886 TTTTTGTTGTTGTTTGAGACAGG + Intergenic
1004151803 6:13127393-13127415 TTGTTGTTGTTGTTAGAGATGGG - Intronic
1004197730 6:13520332-13520354 TTGTTGTTGTTGTTTGAGATAGG + Intergenic
1004672182 6:17807912-17807934 TTGCTGTTGTTGTTTATCAGGGG - Intronic
1004680244 6:17886869-17886891 TTGTTGTCGTTGTTAAAAAGAGG + Intronic
1004864658 6:19840171-19840193 TTGTTTTTGTTTTTCAACTGAGG + Exonic
1005689600 6:28290099-28290121 TTGTTGTTGTTGTTTGAGATAGG + Intronic
1005754862 6:28917133-28917155 TTATTGTTGTTGTTTGAGACAGG - Intronic
1006467990 6:34207455-34207477 TTGTTGTTGTTGTTTGAAACAGG + Intergenic
1006529346 6:34637891-34637913 TTGTTGTTGTTGTTGAAACTGGG + Intronic
1006657010 6:35604179-35604201 TTGTTGTTGTTGTTAAGAATGGG + Intronic
1006736987 6:36280793-36280815 TTGTTGTTGTTGTTTGAGGCAGG + Intronic
1006818288 6:36868834-36868856 TTGTTGTTGTTTTTGGAGACAGG - Intronic
1006858667 6:37154514-37154536 TTGTTATTGTTGTTGGAGACAGG + Intergenic
1006868717 6:37230958-37230980 TTGTTGTTGTTGTTTAAGTTAGG + Intronic
1007016376 6:38471549-38471571 TTGTTGTTGTTGTTTTAAGCAGG + Intronic
1007552480 6:42740717-42740739 TTGTTGTTGTTTTTTACAACAGG - Intergenic
1007648902 6:43404686-43404708 TTGTTGTTATTTTTCAAAAGTGG + Intergenic
1007872535 6:45056865-45056887 ATTTTGTTGTTGTTTAAGACTGG - Intronic
1008066690 6:47057369-47057391 TTGTTGTTTTTATTGAACATAGG - Intergenic
1008196236 6:48524848-48524870 TTGTTTTGGTTATTGAACACAGG + Intergenic
1008436014 6:51477540-51477562 TTGTTGTTGTTGTGGAAGAAGGG - Intergenic
1009168970 6:60375548-60375570 TTTTTGTTTTTTTTAAACACAGG + Intergenic
1009361977 6:62825792-62825814 TTGTTGTTGTTGTTTTAGACAGG - Intergenic
1009559937 6:65226582-65226604 TGGTTGTTGTTGTTCTACTCAGG - Intronic
1010044439 6:71424810-71424832 TTGTTGTTGTTGTTTGAGTCAGG + Intergenic
1010427988 6:75747894-75747916 TTTTTGTTGTTGGTAAACACAGG - Intergenic
1010808520 6:80268036-80268058 TTTTTGTTGTTGTTTAGCATTGG + Intronic
1010933402 6:81831465-81831487 ATGTATTTGTTTTTCAACACAGG + Intergenic
1011059838 6:83252297-83252319 TTGTTGTTGTTGTTTGAGACAGG + Intronic
1011411493 6:87071144-87071166 TTATTTTTGTTTTTCAAGACAGG + Intergenic
1011805418 6:91067258-91067280 ATGTTGTTTTTTTTTAACACAGG + Intergenic
1011812637 6:91150777-91150799 TTCTTGTTTTCGTTCAACAGTGG + Intergenic
1011860142 6:91744838-91744860 TTGTTGTTTTTGTGAAAGACAGG + Intergenic
1011879172 6:92002000-92002022 CTGTTGCTGTTGTTTAACACGGG + Intergenic
1011973817 6:93265962-93265984 TTTTTCCTGTTTTTCAACACAGG - Intronic
1012063378 6:94515063-94515085 TTGTTGTTGTTGTTGATGATAGG - Intergenic
1012142378 6:95639952-95639974 TTGTTGTTTTTTTTAAACCCAGG - Intergenic
1012812994 6:103984583-103984605 TTGTTGTTGTTTTTTAATGCTGG - Intergenic
1012884692 6:104832397-104832419 TTGTTGTTGTTGTTTGATACAGG + Intronic
1012998729 6:105999473-105999495 TTGTTGTTGTTGTTCAGCCAGGG + Intergenic
1013114872 6:107095164-107095186 TTATTGTTGTTGTTTGAGACAGG - Intronic
1013176516 6:107682122-107682144 TTGTTGTTGTTTTTAGAGACAGG + Intergenic
1013299301 6:108788363-108788385 TTGTTGTTGTTTTTTGAGACTGG - Intergenic
1014226509 6:118854357-118854379 TTGTTGTTGTTTTTAGACAGAGG + Intronic
1014699993 6:124673552-124673574 TTGTTGTTGTTGTTTAATAATGG + Intronic
1015055885 6:128902683-128902705 TTGTTGTTGTTTTTAGAGACAGG + Intronic
1015277067 6:131394339-131394361 TTTTTGTTGTTCTTGAAAACTGG + Intergenic
1015759429 6:136642565-136642587 TTCTTGTTGTTGTTCTAGAAAGG - Exonic
1016088151 6:139941434-139941456 TTGTTGTTGTTGTTGATTACTGG - Intergenic
1016796171 6:148119943-148119965 TTGTTGTTGTTTTCCAATGCAGG - Intergenic
1016877129 6:148876765-148876787 TTGTTGTTGTTGTTCTCTATTGG + Intronic
1017171193 6:151456655-151456677 TTGTTGTTGTTTTTTGAGACAGG + Intronic
1017423872 6:154300606-154300628 TTTTTGTTGTTTTTAGACACAGG - Intronic
1017463712 6:154675084-154675106 TTGTTGTTGTTGTTTGAGACAGG + Intergenic
1017482542 6:154872002-154872024 TTGTTGTTATTGTTTTAGACAGG + Intronic
1018154378 6:160972078-160972100 TTGTTGTTGTTTTTTGAGACAGG - Intergenic
1018776983 6:167026458-167026480 TTTTTGTCGTTGTTCAATATGGG - Intronic
1019465803 7:1188170-1188192 TTGTTTTTGTTTTTCTAGACAGG + Intergenic
1019991989 7:4698556-4698578 TTGTTGTTGTTGTTTGAGATAGG + Intronic
1020021181 7:4870132-4870154 CTGTTGTTGTTGTTTGAGACAGG - Intronic
1020173211 7:5861748-5861770 TTGTTGTTGTTGTTAGAGACAGG + Intergenic
1020377894 7:7508685-7508707 TTGTTGTTGTTGTTTGAGACAGG + Intronic
1020510252 7:9047539-9047561 TTGTTGTTGTTGTTTGAGACAGG - Intergenic
1020538060 7:9426089-9426111 TTGTTGTTGTTGTTGTTCAAAGG + Intergenic
1021271901 7:18599043-18599065 TTGTTTTTGTTGTTCATCGTAGG + Intronic
1021355445 7:19649474-19649496 TTGTTGTTGTTGTTTAGAAATGG - Intergenic
1021394470 7:20130234-20130256 TTGTTCTTGTTGATGAACACTGG - Intergenic
1021535888 7:21704011-21704033 TTGTTGTTGTTGTTCTATCTTGG - Intronic
1021547287 7:21828822-21828844 TTGTTGTTGTTGTTTAATTCTGG + Intronic
1021970204 7:25958454-25958476 TTGTTTTTGTTTTTTAAGACAGG + Intergenic
1022328647 7:29356557-29356579 TTGTTGTTGTTGTGTAAAAATGG + Intronic
1022721589 7:32946273-32946295 TCGTTGTTGTTGTTGTAGACAGG + Intergenic
1022966167 7:35474355-35474377 TTGTTGTTGTTGTTGAAAATTGG - Intergenic
1023100071 7:36708615-36708637 TTTTTTTTGTTGTTGAAAACTGG + Intronic
1023475575 7:40574435-40574457 TTGTTGTTGTTGTTTGAGCCAGG + Intronic
1023645498 7:42309065-42309087 TTGATCTTGTTATTCATCACTGG - Intergenic
1023846974 7:44127660-44127682 TTGTTGTTGTTGTTGAAAACTGG + Intergenic
1023910137 7:44548366-44548388 TTGCTGTTGCTGTTGAAAACTGG - Intergenic
1024918309 7:54528189-54528211 TGGTTGCTGTTGTTCAAAGCAGG - Intergenic
1025072244 7:55910499-55910521 TTGTTTTTGTTTTTTAAGACAGG + Intronic
1025144066 7:56489896-56489918 TTGTTGTTGTTTTTTGAGACAGG + Intergenic
1026067160 7:67084838-67084860 GTGTTGATGTTGTTCAACTGGGG + Intronic
1026643938 7:72151715-72151737 TTGTTGTTGTTGTTAGAGACAGG + Intronic
1026748916 7:73034416-73034438 TTTTTGTTGTTGTTTGAGACAGG - Intergenic
1026752564 7:73062561-73062583 TTTTTGTTGTTGTTTGAGACAGG - Intergenic
1026756215 7:73090692-73090714 TTTTTGTTGTTGTTTGAGACAGG - Intergenic
1026827357 7:73592894-73592916 TTGTTGTTGTTATTTGAGACAGG + Intergenic
1026937629 7:74267777-74267799 TTGTTGTTGTTGTTAGAGATGGG - Intergenic
1027035113 7:74919711-74919733 TTTTTGTTGTTGTTTGAGACAGG - Intergenic
1027091190 7:75302732-75302754 TTTTTGTTGTTGTTTGAGACAGG + Intergenic
1027094835 7:75330705-75330727 TTTTTGTTGTTGTTTGAGACAGG + Intergenic
1027130704 7:75588766-75588788 TTGTTGTTGCTGTTTGAGACAGG - Intronic
1027165771 7:75833385-75833407 TTGTTGTTGTTGTTGGAGACAGG - Intergenic
1027324505 7:77036980-77037002 TTTTTGTTGTTGTTTGAGACAGG - Intergenic
1027388425 7:77681055-77681077 TTATTGTTGTTGTTTGAGACAGG - Intergenic
1027394757 7:77742830-77742852 TTGTTGTTGTTGTTTAAGACAGG - Intronic
1027413418 7:77947114-77947136 TTGTTGTTGTTTTTAAAGACAGG - Intronic
1027605539 7:80294117-80294139 TTGTTGTTGTTGTTAGATACAGG + Intergenic
1027754715 7:82198091-82198113 TTGTTGTTTTTGTTTTATACTGG - Intronic
1027766054 7:82343649-82343671 TTGTTGTCGTTGTTTAATTCTGG + Intronic
1028156773 7:87438741-87438763 TTTTTGTTGTTTTTTAAGACAGG - Intronic
1028167762 7:87558116-87558138 TAGTTGTTTTTGGACAACACTGG - Intronic
1028849172 7:95517172-95517194 TTGTTGTTATTGTTGGAGACAGG + Intronic
1028902007 7:96112209-96112231 TTGTTGTTGTTGTTAGATCCTGG + Intergenic
1028935653 7:96461202-96461224 TTGTTGTTGTTGTTTGTGACAGG + Intergenic
1029085534 7:98008781-98008803 TTGTTGTTGTTGTTAGAGACAGG - Intergenic
1029239016 7:99145255-99145277 TTGTTGTTGTTTTTTGAGACAGG + Intergenic
1029394943 7:100301428-100301450 TTTTTGTTGTTGTTTGAGACAGG + Intergenic
1029679518 7:102098602-102098624 TTTCTGTTGTTGTTAAAGACTGG - Intronic
1029871296 7:103695746-103695768 CTGCTGTCATTGTTCAACACTGG - Intronic
1029912499 7:104169070-104169092 TTGTTGTTTTTTTTAAAGACAGG - Intronic
1030192772 7:106825879-106825901 TTTTTGTTGTTGTTCTATCCAGG - Intergenic
1030258579 7:107539218-107539240 TTGTTGTTGTTTTTTGAGACAGG - Intronic
1030361297 7:108597977-108597999 TTGTTGTTGTTGTTCAGATGAGG + Intergenic
1030529355 7:110693838-110693860 TTGTTGTTGTTGTTAATAAAAGG + Intronic
1030593782 7:111511639-111511661 TTTTTTTTTTTGTTCAACAGAGG - Intronic
1030837789 7:114310669-114310691 TTGTTGTTGTTGGACAACCTGGG + Intronic
1031083588 7:117281241-117281263 TTGTTATTGTTGTTTGAGACAGG + Intronic
1031501222 7:122519370-122519392 TTGTTGTTGTTGTTGTTCAAAGG - Intronic
1031735907 7:125361251-125361273 TTGCTGTTGTTATTAGACACAGG - Intergenic
1032027178 7:128453033-128453055 TTGTTGTTGTTGTTGAGAAAGGG - Intergenic
1032360972 7:131254349-131254371 TTTTTGTTGTTGTTGAAAACTGG - Intronic
1032430066 7:131853692-131853714 TGTTTGTTGTTTTTCAGCACTGG + Intergenic
1032605977 7:133354212-133354234 TTTTTGTTGTTGTTGAAAACTGG + Intronic
1033028049 7:137796069-137796091 TTTTTGTTGTTGTTGAAAACTGG - Intronic
1033069057 7:138185354-138185376 TTGTTGTTGTTGTTTGAGACAGG + Intergenic
1033107639 7:138543838-138543860 TTGTTGTTGTTGTTTGAAACAGG + Intronic
1033134070 7:138770043-138770065 TTGTTGTTGTTGTTTGAGACAGG - Intronic
1033164464 7:139027669-139027691 TTATTGTTGTTTTTGAAGACAGG - Intronic
1033849350 7:145476203-145476225 TTGTTGTTGTTTTTTAAGACTGG + Intergenic
1034102110 7:148458841-148458863 TTGTTGTTGTTGTTTGAGAGGGG + Intergenic
1034217371 7:149418805-149418827 TTGTTGTTGTTGTTGGAGACAGG + Intergenic
1034713236 7:153216004-153216026 TTGTTGTTGTTGTTAAAGGCTGG + Intergenic
1034762497 7:153686268-153686290 TTGTTATTGTTGTTTGAGACAGG + Intergenic
1035709541 8:1701607-1701629 TTGTTGTTGTTGTTGTTCACGGG + Exonic
1035709542 8:1701610-1701632 TTGTTGTTGTTGTTCACGGGTGG + Exonic
1035828171 8:2666917-2666939 TTTCTGTTGTTTTTAAACACAGG + Intergenic
1035997531 8:4565166-4565188 TTGTTATTGTTTTTCATCATTGG - Intronic
1036068193 8:5408488-5408510 TTTTTGTTGTTGTTCAGCTGAGG - Intergenic
1036098611 8:5752703-5752725 TTGTTGTTGTTGTTAAAAATGGG + Intergenic
1036117119 8:5970762-5970784 TTGTGGTTGTTTTTAGACACAGG - Intergenic
1036285744 8:7443032-7443054 TTGTTGTTGTTTTTTGAAACAGG - Intronic
1036335729 8:7868497-7868519 TTGTTGTTGTTTTTTGAAACAGG + Intronic
1036426787 8:8652539-8652561 TTTTTATTGTTGTTCAAGACAGG + Intergenic
1036623663 8:10446288-10446310 TTGTTGTTGTTGTTTGAAATAGG + Intergenic
1036791409 8:11723333-11723355 TTGTTTTTTTTTTTTAACACAGG - Intronic
1037455613 8:19060626-19060648 TTGTTGTTGTTGTTTGAGATGGG - Intronic
1038304002 8:26383161-26383183 TTGTTGTTGTTGTTGTGCAGGGG - Exonic
1038318285 8:26506588-26506610 TTGTTGTTGTTGTTTTAACCTGG - Exonic
1038661089 8:29497601-29497623 GTTTTGTCGTTGTTCAACTCTGG + Intergenic
1039116776 8:34100079-34100101 TTGTTGTTGTTATACAGGACAGG + Intergenic
1039121760 8:34155962-34155984 TGGTTAGTGTTGTACAACACTGG + Intergenic
1039263688 8:35801790-35801812 TTGTTGTTGTTTTTAGAAACAGG + Intergenic
1039349024 8:36740919-36740941 TTGTTGTTGTTGTTGCAGAGAGG + Intergenic
1039577746 8:38637873-38637895 TTGTTGTTGTTGTTCAATATTGG + Intergenic
1039974949 8:42355042-42355064 TCGTTGTTGTTTTTCGAGACGGG + Intronic
1040597600 8:48854682-48854704 TTGTTGTTGTTGTTTAGATCAGG - Intergenic
1040628425 8:49179358-49179380 TTGTTTTTGTTGTTGGAGACAGG - Intergenic
1040719312 8:50297954-50297976 TTGTTTTTGTTGTCAAAAACAGG + Intronic
1041139465 8:54800917-54800939 TTGTTGTTGTTGTTAGAAGCTGG + Intergenic
1041192441 8:55367366-55367388 TTGTGGTTGTTGATGTACACTGG + Intronic
1041273411 8:56131991-56132013 TTGTTGTTGTTGTTAAAGACAGG - Intergenic
1041526264 8:58809989-58810011 TTTTTGTTGTTGTTAGAGACCGG + Intronic
1042123941 8:65518142-65518164 TTGTTGTTGTTGTTGAAATCTGG - Intergenic
1042228593 8:66534870-66534892 TTGTTGTTGTTGTTGAGGCCAGG + Intergenic
1042260562 8:66854975-66854997 TTGTTGTTGTTGTTAGAGACAGG - Intronic
1042390011 8:68223305-68223327 TTGTTTTTGTTTTTAAAGACTGG + Intronic
1042816937 8:72888106-72888128 TTGTTGTTGTTGTTTGAGACAGG + Intronic
1043024735 8:75051761-75051783 TTGTTGTTGTTGTTAAGTGCTGG - Intergenic
1043367514 8:79552217-79552239 TGGTTGTTGTTGTTGTACAGCGG - Intergenic
1043383104 8:79723586-79723608 TTCTTGTTGTTGTTTCAAACAGG - Intergenic
1043409741 8:79981317-79981339 TTGTTTTTGTTTTTTAAGACAGG - Intronic
1043435752 8:80235178-80235200 TTGTTGTTGTTGTTTGAGACAGG + Intergenic
1043458817 8:80438937-80438959 TTGTTGTTGTTGTTTGAGACAGG - Intergenic
1043508159 8:80923154-80923176 GTGTTTTTGTTTTTCAAGACAGG + Intergenic
1043947273 8:86268688-86268710 TTGTTGTTGTTGTTTGAGACAGG + Intronic
1044308297 8:90663816-90663838 TTGTTGTTGTTGTTTGAGACAGG + Intronic
1044423050 8:92020984-92021006 TTGTTGTTGTTGTTTTATACTGG - Intronic
1044489144 8:92791628-92791650 TTGTTTTTGTTTTTTAAGACAGG - Intergenic
1044859254 8:96506641-96506663 TTGTTGTTGTTGTTCACATGGGG + Intronic
1045139321 8:99262790-99262812 TTGTTGTTGTTGTTTCAAACAGG + Intronic
1045237884 8:100372064-100372086 TTGTTGTTGTTTTTTGAGACAGG + Intronic
1045284049 8:100774437-100774459 TTGTTGTTGTTGTTAAGAAGGGG + Intergenic
1045342185 8:101264872-101264894 TTGCTGTTGTTGTTGGACACTGG - Intergenic
1045748442 8:105452744-105452766 TTGTTGTTGTTGTTTGAGACAGG - Intronic
1045945452 8:107789579-107789601 TTGTTGTTGTTGTTCCAGAGTGG - Intergenic
1046235333 8:111416874-111416896 TTGTTGTTGTTGTTGATGAAGGG + Intergenic
1046626273 8:116579795-116579817 TTGTTGTTGTTGTTGTTGACAGG + Intergenic
1046936564 8:119890306-119890328 TTGTTGTTGTTGTTTGAGACAGG + Intronic
1047306103 8:123654277-123654299 TTGTTGTTGTTGAGCATCCCAGG + Intergenic
1047786113 8:128155388-128155410 TTGTTGTTGTTGTTAAATGATGG - Intergenic
1048146213 8:131846354-131846376 TTGTTGTTGTTGTTCGAGACAGG - Intergenic
1049054134 8:140221642-140221664 TTGTTGTTGTTGTTTGGGACGGG + Intronic
1049177109 8:141200753-141200775 TTGTTGTTGTTGTTTAATTTAGG - Intergenic
1049629676 8:143646668-143646690 TTTTTGTTGTTGTTTGAGACAGG + Intronic
1049640925 8:143715552-143715574 TTGTGGTTGTTGTTTGAGACAGG + Intergenic
1049648088 8:143745735-143745757 TTATTGTTGTTGTTTGAGACAGG + Intergenic
1049863699 8:144919373-144919395 TTCTTGTTGTTGTTGGAGACGGG + Intergenic
1050112995 9:2235816-2235838 TTGTTGTTGTTGTTAGAGATAGG + Intergenic
1050202926 9:3167342-3167364 TTGTTGCTGTTGTTTTAAACAGG + Intergenic
1050230841 9:3525222-3525244 TTGTTGTTGTTGTTCACTTGTGG - Intronic
1051031346 9:12684051-12684073 TGATTGTTGTTGTTGAACACTGG + Intergenic
1051439412 9:17068260-17068282 TTGTTGTTGTTGTTTGAGACAGG + Intergenic
1051686716 9:19665629-19665651 TTGTTGTTGTTGTTTGAGACAGG + Intronic
1051744476 9:20281917-20281939 TTGTAGTCTTTGTTGAACACTGG + Intergenic
1051919960 9:22253114-22253136 TTATTGTGGATGTTCAACAAGGG - Intergenic
1052130435 9:24839320-24839342 TTGTTGTTGTTGTACAATTATGG - Intergenic
1052722290 9:32186920-32186942 TTTTTGTTGTTGTTGAAGACAGG - Intergenic
1052843692 9:33315713-33315735 TTTTTGTTGTTGTTAGAGACTGG - Intronic
1054766039 9:69043419-69043441 TTGTTGTTGTTGTTTGAGACAGG + Intronic
1054824692 9:69561457-69561479 TTGATGTTATTGTTTAACTCAGG - Intronic
1054829695 9:69609802-69609824 TTGTTGTTGTTGTTTGAGACAGG + Intronic
1055344229 9:75317602-75317624 TTTTTGTTGTTGTTAAAAAGTGG + Intergenic
1055523685 9:77108468-77108490 TTGTTGTTGTTGCATAACATGGG - Intergenic
1055846477 9:80569615-80569637 TTGTTGTTGTTGTTGCAAACTGG - Intergenic
1055859945 9:80737470-80737492 TTTTTGTTGTTGTTTTACACAGG - Intergenic
1055949937 9:81721332-81721354 TTGTTGTTGTTGTTATTCTCAGG + Intergenic
1055997246 9:82173157-82173179 TTCTTGTTCATGTTCAATACTGG - Intergenic
1056037707 9:82626011-82626033 GTGTTGCTGTTGTTTAACATCGG - Intergenic
1056311597 9:85346803-85346825 TTGATGTTTTTGTTCCACTCAGG - Intergenic
1056385985 9:86097872-86097894 TTGTTGTTGTTGTTGAGGGCTGG - Intronic
1056582206 9:87897563-87897585 TTGTTGTAGTTGTTGAAAACTGG - Intergenic
1057335752 9:94153638-94153660 TTGTTGTTGTTGTTTTAGACGGG - Intergenic
1057343965 9:94230975-94230997 TTGTTGTTGATGTTGAAAACTGG + Intergenic
1057425473 9:94945730-94945752 ATGCTGTTGGTGTTCAAAACGGG + Intronic
1057786176 9:98088926-98088948 TTGTTGTTGTTTTTTAAGTCTGG + Intronic
1057832600 9:98418527-98418549 TTGTTGTTGTTGTTTGAGACAGG - Intronic
1058168653 9:101651304-101651326 TTGGTGTTGTTTTTCTCCACAGG - Intronic
1058227782 9:102387965-102387987 TTGTTGCTGTTGTTCAAATTTGG + Intergenic
1058402183 9:104632317-104632339 TTGTTGTTGTTCTTTGAGACAGG + Intergenic
1058907116 9:109490732-109490754 TTGTTGTTGTTGTTCCAAGATGG - Intronic
1059902471 9:118943622-118943644 TTGTTGTTGTTGTTGTTGACAGG - Intergenic
1060370117 9:123061121-123061143 TTGTTATTGTTGTATAAGACAGG + Intronic
1060511540 9:124238208-124238230 TTGCTGTTGTTGTTTGAGACGGG + Intergenic
1061021959 9:128021721-128021743 TTGTTGTTGTTGTTTAAGGCAGG + Intergenic
1061639554 9:131941546-131941568 CTGTTGTCGTTGTTTACCACTGG - Intronic
1061916602 9:133758654-133758676 TTGTTGGTCTTGTTCAACATTGG + Intergenic
1203530010 Un_GL000213v1:132574-132596 TTGTTGTTGTTGTTAGAGACAGG + Intergenic
1185674620 X:1839279-1839301 TTGTTGTTGTTTTTTGAGACGGG + Intergenic
1185813132 X:3129008-3129030 TTGTTGTTATTGTTTAAGACAGG - Intergenic
1186688652 X:11951860-11951882 TTGTTGTTGTTGTTAGAGACGGG - Intergenic
1187047426 X:15660799-15660821 TTGTTGTTGTTGTTGGAGACAGG - Intronic
1187229575 X:17408015-17408037 TTGTTGTTGTTGTTGGAGACAGG + Intronic
1187353048 X:18540173-18540195 TTGTTGTTGTTGTTTGAGACAGG + Intronic
1187517093 X:19982271-19982293 TTGTTGTTGTTGTTGGAGAGAGG - Intergenic
1187725316 X:22196171-22196193 TTTTTGTTGTTGTTAAAGACAGG - Intronic
1187983313 X:24782930-24782952 TTGTTGTTGTTGTTTAATGAGGG + Intronic
1188112279 X:26206726-26206748 TTGTTGTTGTTGTTGAAGACAGG + Intergenic
1188371350 X:29373612-29373634 TTGTTGTTGTTGTTTTAATCAGG + Intronic
1188663162 X:32785980-32786002 TTGTTGTAGTTGTTAATCAAAGG - Intronic
1188810689 X:34650998-34651020 TTGTTGTTGTTGTTCTTCAAAGG + Intronic
1188853445 X:35161407-35161429 TTGTTGTTGTTTTTTAAGACGGG + Intergenic
1189013749 X:37073992-37074014 TTGTTGTTGTTTTTTGAGACAGG - Intergenic
1189070800 X:37861936-37861958 TTGTTGTTGTTTTTTGAGACAGG + Intronic
1189303221 X:39967875-39967897 TTGTTGTTGTTGTCTTAGACAGG + Intergenic
1189306239 X:39988876-39988898 TTGTTTTTGTTTTTTAAGACGGG + Intergenic
1189424756 X:40888751-40888773 TTGTTTTTCTCCTTCAACACTGG + Intergenic
1189445006 X:41072828-41072850 TTGTTGTTGTTTTTCTAAACAGG + Intergenic
1189453809 X:41165170-41165192 TGGTTGTTGTTGTTGGAGACAGG + Intronic
1189477836 X:41370215-41370237 TTGTTGTTGTTTTTTGAGACAGG + Intergenic
1189724569 X:43955127-43955149 TTGTAGTTCTTGTTAAGCACAGG - Intronic
1190201893 X:48368853-48368875 TTGTTTTTGTTTTTTAAGACAGG - Intergenic
1190208645 X:48426558-48426580 TTGTTTTTGTTTTTTAAGACAGG + Intergenic
1190224700 X:48536097-48536119 TTGTTGTTGTTTTTAGAGACAGG + Intergenic
1190506468 X:51131333-51131355 TTGTTGTTGTTGTTACATCCTGG + Intergenic
1190529483 X:51361013-51361035 TTGTTGTTGTTGTTTTCCATGGG - Intergenic
1190635160 X:52425943-52425965 TTGTTGTTGCTGTTTCAGACCGG - Intergenic
1190794249 X:53726150-53726172 TTGTTGTTGTTTTTTGACACAGG - Intergenic
1190971480 X:55353228-55353250 TTGTTGAGGTTGTTCATCACCGG - Intergenic
1191604479 X:63045516-63045538 TTGTTGTTGTTGTTTTAATCTGG + Intergenic
1191729805 X:64321130-64321152 TTGTTGTTGTTGTTGAAAACTGG - Intronic
1192409250 X:70918430-70918452 TTGTTGTTGTTGTTTGAGGCAGG + Intergenic
1192422475 X:71045771-71045793 TTTTTGTTGTTGTTTGAGACAGG + Intergenic
1192715538 X:73637931-73637953 ATCTCGTTGTTGTTGAACACTGG + Intronic
1192776474 X:74250854-74250876 TTGTTGTTGTTGTTAGAGAATGG - Intergenic
1192786353 X:74339893-74339915 TTGTTTTTGTTGTTGCAAACTGG + Intergenic
1192817722 X:74612303-74612325 TTGTTGTTGTTGTTCTATACAGG + Intronic
1192958499 X:76100465-76100487 TTGTTGTTGTTGCTCAATTTTGG + Intergenic
1193959215 X:87902688-87902710 TTGTTGTTGTTGTTTAAATCAGG - Intergenic
1194007238 X:88510095-88510117 TTGTTGTTGTTGTTTAGAACAGG + Intergenic
1194086523 X:89534934-89534956 TTGTTGTTGTTGTTGTACCCCGG + Intergenic
1194202084 X:90964840-90964862 TTGTTGTTGTTGTTTAAAAGTGG + Intergenic
1194462497 X:94189554-94189576 TTGTTGCTGTTGTTTAATAGCGG + Intergenic
1194709789 X:97221712-97221734 TTGTTGTTGTTGTTAAGTAAAGG + Intronic
1194948442 X:100095822-100095844 TTGTTGTTGTTTTTTGAGACAGG - Intergenic
1195014309 X:100763525-100763547 TTGTTGTTGTTGTTCTATCTGGG + Intergenic
1195175304 X:102309278-102309300 GTATTGTTGTTGTTCAATCCCGG - Intronic
1195183561 X:102377815-102377837 GTATTGTTGTTGTTCAATCCCGG + Intronic
1195493462 X:105501616-105501638 TTGTTGTTGTTGTTTGAAAGAGG - Intronic
1195629252 X:107037014-107037036 TTGTTGTTGTTGTCGAAAACTGG - Intergenic
1196078517 X:111605170-111605192 TGGTTATTATTGTTCAACTCTGG - Intergenic
1196249374 X:113441317-113441339 TTGTTGTGGTTGTTGAAAACTGG - Intergenic
1196652963 X:118187565-118187587 TTGTTGTTGTTGTTGAAACAGGG - Intergenic
1197257739 X:124282032-124282054 TTGTTGTTGTTGTTTAGCAAAGG - Intronic
1198411777 X:136377196-136377218 TTGTTGTTGTTGTTTGAGAGTGG + Intronic
1198493786 X:137169973-137169995 TTGTTGTGGTTGTTCTACTTTGG - Intergenic
1198601885 X:138293080-138293102 TTGTTGTTGTTTTTAACCAGAGG + Intergenic
1199172089 X:144744214-144744236 TTGTTGTTGTTGTTAGGCCCTGG - Intergenic
1199272890 X:145905874-145905896 TTGTTGTTGTTGTTAGAGATGGG - Intergenic
1199341279 X:146680080-146680102 TTGTTTTTGTTTTTCCTCACTGG - Intergenic
1199733459 X:150661027-150661049 TTGTTGTTGTTGTTTGAGACAGG + Intronic
1200098521 X:153675533-153675555 TTGTTGTTGTTGTTTGAGACAGG + Intronic
1200547922 Y:4540291-4540313 TTGTTGTTGTTGTTTAAAAGTGG + Intergenic
1200712600 Y:6501523-6501545 TTGTTGTTGTTGTTGTTCATAGG + Intergenic
1200739659 Y:6839808-6839830 TTGTTGTTGTTATTGAAAAATGG + Intergenic
1201021317 Y:9660515-9660537 TTGTTGTTGTTGTTGTTCATAGG - Intergenic
1201170346 Y:11255242-11255264 TTCTTGCTGTTGTTCAATACAGG + Intergenic
1201268472 Y:12231534-12231556 TTGTTGTTATTGTTTAAGACAGG + Intergenic
1201494639 Y:14579704-14579726 TTGTTGTTGTTTTTAGAGACAGG - Intronic
1202301654 Y:23421838-23421860 TTGTTGTTGTTGTTCTCCATTGG - Intergenic
1202569157 Y:26248760-26248782 TTGTTGTTGTTGTTCTCCATTGG + Intergenic