ID: 1162685668

View in Genome Browser
Species Human (GRCh38)
Location 19:12381809-12381831
Sequence CAGTGCATTCACATTTAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 112}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162685668 Original CRISPR CAGTGCATTCACATTTAAGC AGG (reversed) Intronic
901916075 1:12501687-12501709 CAGTGCGTTCACAGTTTAGCAGG + Intronic
907408292 1:54267509-54267531 CAGAACAGTCACATTTAGGCAGG + Intronic
907921627 1:58919431-58919453 AAGTGGATTCACATGTTAGCAGG + Intergenic
908051262 1:60233998-60234020 CAGTGGATTCACATTGAAATAGG - Intergenic
908249011 1:62250494-62250516 CAGTGTATTCCCATTTAACCTGG + Intronic
909724610 1:78819386-78819408 CACTGAAATCACATTTAAGATGG - Intergenic
910784234 1:90977055-90977077 GAGTTCACTCACATTAAAGCTGG + Intronic
911054256 1:93697159-93697181 CAGACCATTCACATCTAAACAGG + Intronic
911617070 1:100025303-100025325 GTGTGCATTCACATTTAATCAGG + Exonic
912046243 1:105462082-105462104 CAGAGCACTCACATATAAGTAGG + Intergenic
913270789 1:117091256-117091278 CACTGCAGGCACAGTTAAGCAGG + Intronic
917191199 1:172421256-172421278 AAGTGCATTCACAGTTGAGAAGG - Intronic
919931978 1:202226900-202226922 CTTTGCATTCCCATCTAAGCTGG - Intronic
921356282 1:214287276-214287298 CAGTGGAGTCACCATTAAGCTGG + Intronic
921371316 1:214425554-214425576 CTATGCATTCACATTAAAGCAGG + Intronic
922709514 1:227816239-227816261 CACTGCTTTCACAGGTAAGCGGG + Exonic
1068616958 10:59129485-59129507 GAGTGCAATCACATGGAAGCAGG + Intergenic
1068896896 10:62213967-62213989 CAGTGAATTCACTATTAAGAGGG + Intronic
1069324709 10:67218914-67218936 CAGTGTATTCCCATTTAACTTGG + Intronic
1074989323 10:118688849-118688871 TAGTGGATTCTCATTTGAGCTGG - Intronic
1080016428 11:27511506-27511528 CAATCCATTCACACTGAAGCAGG + Intergenic
1085838672 11:79984311-79984333 GAATGGATTCACGTTTAAGCTGG + Intergenic
1087519813 11:99217614-99217636 CAGGGCATGCAAATTTAAGTGGG - Intronic
1089837388 11:121383168-121383190 CAGTGCATTTACATAGAAGTAGG + Intergenic
1089985301 11:122807381-122807403 CAGCGTATTCAGATTTTAGCAGG - Intronic
1095724621 12:45437938-45437960 CATAGCATTTACATTTAAGTTGG + Intronic
1100659378 12:96680359-96680381 GAGTACATTCAAATTTAGGCTGG + Intronic
1103643470 12:122371829-122371851 CAGTGGGGTCACATTTTAGCAGG - Intronic
1103782765 12:123410141-123410163 AAATGCATTAACTTTTAAGCTGG - Intergenic
1104918004 12:132276027-132276049 CAGTGAATCCACATTGCAGCAGG + Intronic
1109512203 13:63392530-63392552 TATTGCATTCACAGTTATGCAGG - Intergenic
1109864330 13:68242984-68243006 CAGAGCATACACATTTATGCTGG - Intergenic
1112553200 13:100442375-100442397 CATTGCATTCAATTTAAAGCAGG - Intronic
1113313329 13:109153876-109153898 CAGTGGATTCACACTTCACCAGG - Intronic
1113596027 13:111533595-111533617 GAGTGGATTCACATTTCTGCAGG - Intergenic
1113920567 13:113906287-113906309 GAGTGCATTCTCACTGAAGCAGG + Intergenic
1114562838 14:23605518-23605540 CTGTACATTCACCTCTAAGCAGG - Intergenic
1117366608 14:55035761-55035783 CAGTGCATTCACATGTAAAATGG - Intronic
1121777849 14:96602618-96602640 CAGTGCATTTGTAGTTAAGCAGG + Intergenic
1124213644 15:27785929-27785951 AGGTGCATTCACATTGTAGCAGG - Intronic
1125933312 15:43615421-43615443 CAGAGCACTCACACTAAAGCAGG + Exonic
1125946410 15:43714883-43714905 CAGAGCACTCACACTAAAGCAGG + Intergenic
1132359263 15:101198932-101198954 CAGAGCCTTCACCTTTATGCTGG + Intronic
1136509175 16:30725152-30725174 CAGTGATGTCACATTTAACCTGG + Intronic
1137789603 16:51164024-51164046 TAGTGCATTCACAGATAACCTGG + Intergenic
1141792784 16:86248221-86248243 CGGGGCATTCACATTTCAGCTGG - Intergenic
1202995184 16_KI270728v1_random:102158-102180 CAGTGCAATCAAATTCAAACAGG + Intergenic
1203021871 16_KI270728v1_random:414500-414522 CAGTGCAATCAAATTCAAACAGG + Intergenic
1151617574 17:75224353-75224375 CAGTGGATTCAGATTAAAACTGG - Intronic
1152814500 17:82399480-82399502 CAGTGAAGACACAGTTAAGCTGG - Intronic
1153269650 18:3307569-3307591 CAGTGGATTCAGATGAAAGCTGG - Intergenic
1157737270 18:50061080-50061102 CATTGTATTTACATTTTAGCTGG - Intronic
1157807496 18:50668980-50669002 AAGTGCATTCAGATGTACGCAGG + Intronic
1158787559 18:60733768-60733790 CACTTCATTTACATTTAACCAGG + Intergenic
1162673001 19:12274174-12274196 CAGTCCATTCACATTGAAGCAGG - Intronic
1162685668 19:12381809-12381831 CAGTGCATTCACATTTAAGCAGG - Intronic
1162685722 19:12382286-12382308 CAGTCCATTCACGTTCAAGCAGG - Intronic
1162691064 19:12432095-12432117 CCATCCATTCACATTCAAGCAGG - Intronic
1168456348 19:56511921-56511943 CACTGCATGCACATTTAACCTGG - Intronic
925644240 2:6019831-6019853 CAGTGCATTTACAATTATGCTGG - Intergenic
925777082 2:7346302-7346324 CAGTGTCTTCACATTTAAATGGG - Intergenic
927611139 2:24541903-24541925 CAGTGCAGTGAGATTTAAGAGGG + Intronic
928274432 2:29887041-29887063 CAGTGCTTTCACATTTTACTGGG + Intronic
931556610 2:63513017-63513039 CAGTAAATTCAGGTTTAAGCAGG + Intronic
938610023 2:132937907-132937929 CAGTGCATCAGCATTTATGCTGG - Intronic
939778500 2:146414910-146414932 TAGTTCCTTCACATTAAAGCTGG - Intergenic
940255966 2:151729567-151729589 AACTGCATTCTCATTAAAGCAGG - Intronic
941968845 2:171328338-171328360 CAATTTATTCCCATTTAAGCTGG + Intronic
943897040 2:193377612-193377634 CAGTGCTTTCAAATTTTTGCCGG + Intergenic
944446286 2:199793772-199793794 TAGTGGATTCACATTACAGCTGG - Intronic
1170506939 20:17036381-17036403 CAGTGATTTCACATTTTAACTGG + Intergenic
1171126336 20:22605220-22605242 CAGTGAAGTGGCATTTAAGCTGG + Intergenic
1171134968 20:22687837-22687859 AAGTACATTCACAGTGAAGCAGG - Intergenic
1173980484 20:47220211-47220233 CGGTGCTTTCACATTTCAGATGG - Intronic
1177972459 21:27807572-27807594 CAGATCATCCACATTCAAGCTGG - Intergenic
1177997666 21:28121463-28121485 CAGTGAATTCACTTTTAGGATGG + Intergenic
1179804851 21:43830748-43830770 CAGTGCATGCACACATAGGCAGG - Intergenic
1182059409 22:27386264-27386286 CAGGGCATGCGCATTGAAGCTGG - Intergenic
1184157833 22:42680267-42680289 CAGTGCATTCACATTGTTGTGGG + Intergenic
950020904 3:9787096-9787118 CAGGGCATCCACATCTAAGCGGG + Exonic
950973729 3:17216815-17216837 AAGTGTATTCACATATAAGTGGG - Intronic
954565272 3:51594732-51594754 CAGTGCATTAACAAATAAGACGG - Intronic
955582467 3:60439227-60439249 CAGTCAATTCATATTTAAGGAGG + Intronic
956351818 3:68345567-68345589 CAGTAGAGTGACATTTAAGCTGG + Intronic
956643198 3:71433790-71433812 CAGGGCATTCACATTCATCCAGG - Intronic
957348896 3:78997510-78997532 CAATGCACTCAGATTGAAGCAGG + Intronic
959731380 3:109606837-109606859 CAGTGAATTGTCAGTTAAGCTGG - Intergenic
960297834 3:115966180-115966202 CAGTGTATCCACATTTTGGCTGG - Intronic
962608928 3:137056660-137056682 CACAGCAGACACATTTAAGCAGG + Intergenic
963792629 3:149600019-149600041 CATTGCATTTACATTTTATCAGG + Intronic
966225967 3:177598326-177598348 CAGTTCAATCACATTTTGGCTGG + Intergenic
978144974 4:105362143-105362165 CAGTGGCTTCTCATTTAACCAGG + Intergenic
983231065 4:165129279-165129301 CAGTGGATTCATATTTGAGCAGG + Intronic
985980311 5:3457042-3457064 CATCGCATTCTCATTTGAGCTGG - Intergenic
987857717 5:23442888-23442910 CAGTGTATTCAGACTTAAGGTGG - Intergenic
988730627 5:33969482-33969504 CCCTTCTTTCACATTTAAGCTGG + Intronic
988962455 5:36383743-36383765 CTCTGAATTCACATTTAAGTGGG + Intergenic
989136231 5:38157835-38157857 TTGTGCATTAACATTTGAGCTGG - Intergenic
989151315 5:38302363-38302385 GCTTGCATTCACATTTCAGCTGG + Intronic
990216994 5:53545149-53545171 CACTGCATTCATAGTTAAGGTGG + Intergenic
995146324 5:108790712-108790734 TAGTACATTCACAGTTATGCAGG + Intronic
995934959 5:117499703-117499725 GAGTTCATTCACATTTAAACAGG + Intergenic
998336322 5:141375492-141375514 CAGTGCATTCACAGAGAAGATGG - Exonic
999123656 5:149229997-149230019 CAGAGCTATCACATTTAAGGGGG - Intronic
1006554844 6:34857108-34857130 CAGAGCATTCACAGTAAAACTGG - Intronic
1006608477 6:35277142-35277164 CAGTGCAGTTACACTAAAGCGGG + Intronic
1010000059 6:70940098-70940120 CACTGCATTCACAGGTAAGAAGG + Intronic
1013807189 6:114009250-114009272 CAGTTCTTTCACTTTTAACCTGG + Intronic
1014398887 6:120962687-120962709 CAGTGTATTCACTTTAAATCAGG + Intergenic
1018368563 6:163147419-163147441 CAGTTCATTCATCTTTAAGTTGG - Intronic
1021859335 7:24890707-24890729 CAGTGTATGCATATTAAAGCAGG + Intronic
1022847839 7:34228588-34228610 CAGTGCACTCACTTGTGAGCAGG + Intergenic
1022902453 7:34824670-34824692 CAGTGCATTCACTTTTGAGAGGG - Intronic
1024841522 7:53592552-53592574 CAGTGAATTCAAATATAAGTAGG - Intergenic
1031538012 7:122959081-122959103 CAGTGCATTCACATTTCTAGTGG + Intergenic
1033489130 7:141824551-141824573 CAGTGCATTCATATTCATGGTGG - Intergenic
1035812677 8:2505602-2505624 CAGTGCATTCTCAGGGAAGCCGG - Intergenic
1039195003 8:35021318-35021340 AAGTGCATTTTCATTTAAACAGG + Intergenic
1051250480 9:15153774-15153796 CAGGTAATTCACATTTGAGCTGG - Intergenic
1054902464 9:70383573-70383595 GAGGGTCTTCACATTTAAGCTGG - Intergenic
1055463629 9:76542588-76542610 CAGTGCATTCTGCTTTAGGCTGG + Intergenic
1056476334 9:86954851-86954873 AAGTGCTTTCACATTTTAGTCGG - Intergenic
1058865564 9:109159364-109159386 GAGTGGATTAACATTTAAGTGGG + Intronic
1059388634 9:113984812-113984834 ATGTGTATTCACATTCAAGCCGG - Intronic
1059460834 9:114428884-114428906 CTGTGCATTTACATCTAAACTGG + Intronic
1186269078 X:7865490-7865512 CACAGCATTCACATTTTAGCTGG - Intergenic
1189046322 X:37595382-37595404 AAGTGAAAACACATTTAAGCAGG - Intronic
1193289321 X:79753315-79753337 CAGTGCATTCACAGCTAAGTTGG - Intergenic
1195515421 X:105769778-105769800 CAGAGCATTCACACTTGTGCTGG + Intergenic
1202134077 Y:21642755-21642777 CAGTGCATACAGATATAATCTGG - Intergenic