ID: 1162686753

View in Genome Browser
Species Human (GRCh38)
Location 19:12393095-12393117
Sequence CATCTTAGCCTACTATTGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 2, 1: 0, 2: 0, 3: 2, 4: 73}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162686753_1162686757 16 Left 1162686753 19:12393095-12393117 CCCATCAATAGTAGGCTAAGATG 0: 2
1: 0
2: 0
3: 2
4: 73
Right 1162686757 19:12393134-12393156 TGAGGATGTACAACTGCTACAGG 0: 2
1: 0
2: 0
3: 4
4: 97
1162686753_1162686756 -2 Left 1162686753 19:12393095-12393117 CCCATCAATAGTAGGCTAAGATG 0: 2
1: 0
2: 0
3: 2
4: 73
Right 1162686756 19:12393116-12393138 TGTGGACAAAAAGTTATATGAGG 0: 2
1: 0
2: 1
3: 18
4: 241
1162686753_1162686758 22 Left 1162686753 19:12393095-12393117 CCCATCAATAGTAGGCTAAGATG 0: 2
1: 0
2: 0
3: 2
4: 73
Right 1162686758 19:12393140-12393162 TGTACAACTGCTACAGGAGCTGG 0: 2
1: 0
2: 0
3: 9
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162686753 Original CRISPR CATCTTAGCCTACTATTGAT GGG (reversed) Intronic
902170387 1:14605419-14605441 CCTACTAGCCTACTATTGACCGG + Intronic
903760293 1:25693062-25693084 CTTATTAGCCTACTGTTGACTGG + Intronic
905948268 1:41922009-41922031 CCTATTAGGCTAATATTGATTGG - Intronic
907747656 1:57229915-57229937 CATATTTCCCTACTGTTGATTGG - Intronic
913019033 1:114767993-114768015 AATTTTAGCCCACTATTCATTGG + Intergenic
916532507 1:165670955-165670977 CACCTTAGCCTCCTATAGCTGGG - Intronic
923121117 1:230992377-230992399 CATTTTAGCCAACTCTTGAGGGG - Intronic
1065942061 10:30573832-30573854 CAGCTGAGCCTTCTATTCATGGG + Intergenic
1073914782 10:108389590-108389612 CATATTGGCCTATCATTGATAGG - Intergenic
1077396906 11:2328839-2328861 CATCTTTGTCTTCTGTTGATCGG + Intergenic
1077681980 11:4250377-4250399 CTTCTATGCTTACTATTGATTGG - Intergenic
1079985425 11:27195336-27195358 CTTCTTAGCCTACTAATAAATGG - Intergenic
1093361337 12:18232855-18232877 CCTCTTAGCCTGCTTTTGCTGGG + Intronic
1097823264 12:64148929-64148951 CATCTTAGCTTTCTATAAATGGG + Exonic
1098076323 12:66735906-66735928 CATCTTTGCCCACTAGTCATGGG - Intronic
1100776907 12:97985135-97985157 CATCTTAGGCAACTTTTGATTGG + Intergenic
1104982162 12:132578057-132578079 AAACTTAGCCTACTGTTGACAGG + Intronic
1106659268 13:31781378-31781400 CATCATAAACTACCATTGATTGG - Intronic
1108206623 13:48096235-48096257 CGTCTTAGCCTACTTTTCCTAGG + Intergenic
1118690479 14:68334222-68334244 TTTATTAGCCTACTGTTGATTGG + Intronic
1119018778 14:71087384-71087406 GATATTAACTTACTATTGATAGG - Intronic
1119984053 14:79115666-79115688 GATCTCAGCCTAGTATTGATTGG + Intronic
1124962021 15:34405807-34405829 CAACTTCGGATACTATTGATTGG - Intronic
1124978644 15:34552028-34552050 CAACTTCGGATACTATTGATTGG - Intronic
1125049048 15:35276255-35276277 GTCCTTAGCCTACTTTTGATGGG + Intronic
1126190999 15:45878635-45878657 GTCCTTAGCCTACTTTTGATGGG - Intergenic
1126375597 15:47993817-47993839 CATTTTAGCATACTATTGCCAGG - Intergenic
1126768079 15:52028829-52028851 CTTCTCAGCCTACTACAGATTGG + Intronic
1129534037 15:76296280-76296302 CAAATTAGCCTTCTATTGTTAGG + Intronic
1144442684 17:15297967-15297989 CATTTTAGCCTGCTATTTCTAGG + Intergenic
1147028071 17:37606743-37606765 AATATTACCCTACTTTTGATTGG - Intronic
1153411174 18:4794965-4794987 CATGTTTGCCCACTTTTGATGGG - Intergenic
1157144369 18:45146474-45146496 CATTTTAGTCTACCACTGATGGG + Intergenic
1160279690 18:77476473-77476495 GTTCTTAGCCAACTTTTGATGGG - Intergenic
1162686753 19:12393095-12393117 CATCTTAGCCTACTATTGATGGG - Intronic
1162691105 19:12432869-12432891 CATCTTAGCCTACTATTGATGGG - Intronic
1165197108 19:34112715-34112737 CATTTTAGCATCCTTTTGATTGG + Intergenic
1168237537 19:55072783-55072805 CATTTTTGCCTTCGATTGATGGG - Intronic
926315287 2:11705136-11705158 CATTTCAGGCTACTATTTATGGG - Intronic
932087815 2:68777122-68777144 CATCTTAGCCTGGAATTGCTTGG - Intronic
933252823 2:80047929-80047951 CATCTTATCCTACAAATAATAGG + Intronic
935464662 2:103382121-103382143 GTTCTTAGCCTTCAATTGATCGG - Intergenic
936407412 2:112218738-112218760 AATAATAGCCTACTGTTGATGGG - Intronic
939524367 2:143274647-143274669 CATGTTACCATACAATTGATTGG + Intronic
943226246 2:185182243-185182265 TTTCTTTGCTTACTATTGATAGG - Intergenic
945888477 2:215402389-215402411 CAGCTTAGTCTTATATTGATAGG - Intronic
946637154 2:221742184-221742206 TATCTTAGCCTAAGATGGATGGG + Intergenic
1171228102 20:23458140-23458162 CATCTTAACCAACTCTTGGTAGG - Intergenic
1176968004 21:15233359-15233381 CCACTTTGACTACTATTGATTGG + Intergenic
1181660638 22:24345583-24345605 AATCTTAGCCCATTATTTATTGG - Intronic
951607328 3:24450716-24450738 AAGCTGAGCCTACTATAGATTGG - Intronic
951965674 3:28381912-28381934 CACCTTGGCCTCCTATTGCTGGG - Intronic
956086011 3:65610128-65610150 CTTCTTAGCTTACTGTTGAGTGG - Intronic
959628557 3:108481990-108482012 CATCCTTGCCTACGATGGATAGG - Intronic
971267468 4:25107966-25107988 CAGCTGAGCTTACTATTGAATGG + Intergenic
977432064 4:96942487-96942509 CATCTTTGCCTACTATCTGTTGG + Intergenic
978516724 4:109576759-109576781 AACCTTGGACTACTATTGATGGG + Intronic
980815150 4:137937095-137937117 CATTTAAGCTTATTATTGATAGG - Intergenic
983605738 4:169581379-169581401 CATCTCAGCCTCCTATTAGTTGG + Intronic
989322688 5:40155204-40155226 CATCTTAACTTACTATTCCTGGG + Intergenic
997534289 5:134605359-134605381 CATCTTATATTACTAATGATGGG + Exonic
1003478193 6:6504763-6504785 CATCTGAGCCTCCTCTTGAGAGG - Intergenic
1011079121 6:83470408-83470430 AATCCTTGCCTATTATTGATGGG - Intergenic
1011944941 6:92889368-92889390 CATCTTAGCCTCCCATTAGTTGG + Intergenic
1016184924 6:141186594-141186616 CACCTTAGGCAACTATTAATTGG + Intergenic
1021385179 7:20020511-20020533 TTTATTAGCCAACTATTGATAGG - Intergenic
1022322116 7:29297379-29297401 CATCTTAGCCTCCTGCTGACAGG + Intronic
1023130143 7:36994848-36994870 CATCTTAGCCTGAAGTTGATTGG - Intronic
1023569635 7:41558706-41558728 CATCCTAGCCTTTTATTGAGAGG + Intergenic
1023645678 7:42312103-42312125 CATATCTGCCTACTATTGTTTGG - Intergenic
1023907479 7:44532775-44532797 CCTACTAGCCTACTATTGACTGG - Intronic
1036154901 8:6332428-6332450 TCTCTTAGCCTTTTATTGATTGG - Intergenic
1043169262 8:76944126-76944148 CATTCAAGGCTACTATTGATAGG + Intergenic
1048754085 8:137715787-137715809 AATTTGAGCCTTCTATTGATTGG + Intergenic
1059801280 9:117752043-117752065 CATCTTAGCCAAGTATTTAAGGG + Intergenic
1186804808 X:13129832-13129854 CATGTTAACTTACTATTTATAGG + Intergenic
1199769516 X:150965536-150965558 CACCTTAGCCTCCTAATGCTGGG + Intergenic