ID: 1162689096

View in Genome Browser
Species Human (GRCh38)
Location 19:12414033-12414055
Sequence AGGCTGCCACAGAACTTTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 161}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162689089_1162689096 8 Left 1162689089 19:12414002-12414024 CCTGCGGCCTGTGCGGGTCCCAG 0: 1
1: 0
2: 0
3: 18
4: 215
Right 1162689096 19:12414033-12414055 AGGCTGCCACAGAACTTTCAGGG 0: 1
1: 0
2: 1
3: 16
4: 161
1162689084_1162689096 29 Left 1162689084 19:12413981-12414003 CCCGGGGTCTTCTCTACGGCTCC 0: 1
1: 0
2: 1
3: 11
4: 123
Right 1162689096 19:12414033-12414055 AGGCTGCCACAGAACTTTCAGGG 0: 1
1: 0
2: 1
3: 16
4: 161
1162689085_1162689096 28 Left 1162689085 19:12413982-12414004 CCGGGGTCTTCTCTACGGCTCCT 0: 1
1: 0
2: 2
3: 13
4: 109
Right 1162689096 19:12414033-12414055 AGGCTGCCACAGAACTTTCAGGG 0: 1
1: 0
2: 1
3: 16
4: 161
1162689090_1162689096 1 Left 1162689090 19:12414009-12414031 CCTGTGCGGGTCCCAGTGTGCCA 0: 1
1: 0
2: 2
3: 6
4: 121
Right 1162689096 19:12414033-12414055 AGGCTGCCACAGAACTTTCAGGG 0: 1
1: 0
2: 1
3: 16
4: 161
1162689092_1162689096 -10 Left 1162689092 19:12414020-12414042 CCCAGTGTGCCAGAGGCTGCCAC 0: 1
1: 0
2: 1
3: 18
4: 184
Right 1162689096 19:12414033-12414055 AGGCTGCCACAGAACTTTCAGGG 0: 1
1: 0
2: 1
3: 16
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162689096 Original CRISPR AGGCTGCCACAGAACTTTCA GGG Intronic
902109672 1:14067755-14067777 TGGTTGCCCCAGAACTTTCAAGG - Intergenic
902359228 1:15933067-15933089 AGGCTGCTACAGAATCTTCTAGG + Exonic
902673746 1:17993992-17994014 AGGCTGCCACTGCCATTTCAGGG + Intergenic
903373146 1:22849913-22849935 CAGCTGCCACACACCTTTCAGGG - Intronic
903735215 1:25525680-25525702 AGGATCCCACAGGAGTTTCATGG + Intergenic
905754124 1:40493399-40493421 AGGCTGGGAAAGAACATTCATGG - Intronic
906977975 1:50595841-50595863 AGGCTAACAAAGAACTTTCTAGG - Intronic
907050737 1:51328630-51328652 AGGTTTCCACAAGACTTTCAAGG + Intronic
907582433 1:55584195-55584217 AGGGTGCCACACAGCTCTCAGGG - Intergenic
907744191 1:57196354-57196376 AGGCTGCCAAGGCACTTTCTTGG + Intronic
908142680 1:61203530-61203552 AGGCTGCCTCAAAACTTTTGTGG + Intronic
909181740 1:72433023-72433045 AGGCTGCCACAGAACTGCCACGG + Intergenic
911749419 1:101479616-101479638 AGTATTCCTCAGAACTTTCAGGG + Intergenic
913098376 1:115540779-115540801 AGGCTGCCAGAGAGCTTCCCTGG - Intergenic
913609320 1:120494873-120494895 AGGCAGCCACAGAAGGTGCAGGG + Intergenic
914204501 1:145515580-145515602 AGGCAGCCACAGAAGGTGCAGGG - Intergenic
914371046 1:147024651-147024673 AGGCAGCCACAGAAGGTGCAGGG + Intergenic
914483625 1:148088768-148088790 AGGCAGCCACAGAAGGTGCAGGG - Intergenic
914581871 1:149026966-149026988 AGGCAGCCACAGAAGGTGCAGGG - Intronic
917874091 1:179269687-179269709 AGGCTGCTACAGTGCTTACAAGG + Intergenic
922218894 1:223542972-223542994 TGCCTGCCACAGAACATGCATGG + Intronic
923074176 1:230594573-230594595 AGGCTGCCAAAGATTCTTCAGGG + Intergenic
924580838 1:245322882-245322904 ATGCTGCCACCTAACTTACAAGG - Intronic
1066189020 10:33038052-33038074 TGCCTGCCACAGAAGTTTCAGGG + Intergenic
1066635974 10:37501044-37501066 AGGGTGCCACATAATTTCCAAGG + Intergenic
1070008104 10:72444989-72445011 AAGCTGCTCCTGAACTTTCAAGG + Intronic
1070271633 10:74962098-74962120 AGGCTGGCACAGCACACTCAAGG - Intronic
1072953937 10:99872515-99872537 AGGCTCCCACAGAACTGACTAGG + Intergenic
1074494348 10:113966585-113966607 GGTCTGTCACAGAGCTTTCAAGG + Intergenic
1075078143 10:119365090-119365112 AGGCTGAGACAGAGCTTACAAGG + Intronic
1075546073 10:123355711-123355733 ATGCTGCTACAGAATTATCAGGG - Intergenic
1077309255 11:1881226-1881248 AGGCTGCCCCAGAACTGACGGGG + Intronic
1077712146 11:4548255-4548277 AGGTTGCCACAATAATTTCATGG - Intergenic
1084399380 11:68934833-68934855 AGGCTGACACAGTCCTTCCACGG + Intronic
1085252534 11:75153037-75153059 TGGCTGCCCCAGCACTTGCAGGG - Intronic
1086225056 11:84497851-84497873 AGGCAGCCACATAGGTTTCAAGG + Intronic
1088071469 11:105791058-105791080 AAGCTCCCTCAGCACTTTCAGGG - Intronic
1088547699 11:110976970-110976992 ATGCTTCAAAAGAACTTTCATGG - Intergenic
1091533128 12:1379365-1379387 AGGCTGCCACTGGATCTTCAAGG - Intronic
1097693277 12:62754118-62754140 AGGCTGTCACAGTACTGTTAGGG + Intronic
1099287054 12:80726265-80726287 AGGTTTCCACTGAACTTTCGTGG - Intergenic
1101326282 12:103718537-103718559 AGGCTGCCACCAACATTTCAAGG + Intronic
1101922566 12:108944672-108944694 AGGCTGCCTTAAAACTTTCGTGG - Intronic
1103260800 12:119586716-119586738 ATGATGCCACAGTACTTTCCTGG + Intergenic
1106118148 13:26834739-26834761 AGGCTGCTACAGAATTTCCAAGG - Intergenic
1107833704 13:44396954-44396976 AGGCAGCCCCAGAACTTTGCTGG + Intronic
1109153521 13:58874515-58874537 AGGTTTCCCCAGAACTGTCATGG + Intergenic
1109680401 13:65744992-65745014 AAGCTGCCAGAGAATTTTCTTGG - Intergenic
1110060701 13:71034338-71034360 CCTCTGCCACAGAACTTCCAAGG + Intergenic
1111812516 13:93108450-93108472 TGGCAGACACATAACTTTCAGGG - Intergenic
1114712054 14:24788545-24788567 AGGCTGCCCCAGAAATTCCTGGG - Intergenic
1116984337 14:51203650-51203672 AGTCTGCCACAGAAGTCTCAGGG - Intergenic
1117021244 14:51573134-51573156 AGCCTGTCACAGGACTATCAAGG - Intronic
1119427601 14:74545926-74545948 AGAATGCCACAGAACTTGCATGG - Intronic
1120040094 14:79743004-79743026 GGGTTGCCTCAAAACTTTCAGGG + Intronic
1120058322 14:79951698-79951720 AGTCTGACAAAGAACTCTCAGGG + Intergenic
1122972001 14:105156138-105156160 AGGCTGCTACAGAAAGCTCAGGG + Intronic
1122984211 14:105204864-105204886 ATGCAGCCACAGAGCTTTCCTGG - Intergenic
1129057761 15:72833956-72833978 AGGTTGCCACAGAAGTTCCCAGG - Intergenic
1131366300 15:91844970-91844992 AGGCTGCAGCAGAACTAACATGG + Intergenic
1132832019 16:1933087-1933109 AGGCTGCCACAGCACATGCTGGG + Intergenic
1133337320 16:5014638-5014660 AGCCTGCCACAGACCCATCAGGG - Intronic
1133519747 16:6545447-6545469 AGGCTGCAACAGAAATGACATGG - Intronic
1133624246 16:7555639-7555661 AGGCTGGTACAGAACGTTCAAGG - Intronic
1134516088 16:14888370-14888392 AGGCTGCCACACATCTATGAAGG - Intronic
1134703760 16:16287017-16287039 AGGCTGCCACACATCTATGAAGG - Intronic
1134963783 16:18425097-18425119 AGGCTGCCACACATCTATGAAGG + Intronic
1134968070 16:18507633-18507655 AGGCTGCCACACATCTATGAAGG + Intronic
1135510044 16:23074665-23074687 AGTCTGCCAGGGAACTTCCATGG - Intronic
1137912069 16:52387787-52387809 CGGCTTTCACAGACCTTTCATGG - Intergenic
1139158974 16:64479893-64479915 GGGCTGCCCCAGAAATTTGAAGG + Intergenic
1140784281 16:78325111-78325133 AGGCTGCCACAGCCCTGTGACGG - Intronic
1141314197 16:82945206-82945228 TGACTGCCACAGAAACTTCATGG - Intronic
1142395781 16:89830446-89830468 AGGATGGCACAGAAAGTTCAGGG - Intronic
1143970907 17:10794966-10794988 AAGCTGCCTCCGATCTTTCATGG - Intergenic
1145305674 17:21673824-21673846 AGGCAGCCCCTGAATTTTCAGGG + Intergenic
1146074531 17:29715796-29715818 TGGATGCCACAGCACATTCACGG + Intronic
1151954555 17:77373884-77373906 AGGCTGCCTCGGAACTCTCCAGG + Intronic
1152883823 17:82836004-82836026 GGGCTGCCACAGAAGCTACAAGG + Intronic
1158247794 18:55451617-55451639 AGGTGGACACAGAAGTTTCAAGG + Intronic
1158514546 18:58120123-58120145 AGGCAGCCAGAGAGGTTTCATGG - Intronic
1159632436 18:70764439-70764461 AGGCTGCCCCCTAACATTCATGG + Intergenic
1160293232 18:77614607-77614629 AAGCTTCAGCAGAACTTTCAGGG + Intergenic
1162612437 19:11767103-11767125 AAGCTGCCACAGACGTTCCAGGG - Exonic
1162680023 19:12333554-12333576 AGGCTGCCACAGACGTTCCAGGG + Exonic
1162689096 19:12414033-12414055 AGGCTGCCACAGAACTTTCAGGG + Intronic
1164050773 19:21584608-21584630 AGGCTTTCACAGGACTTTCCAGG - Intergenic
1165299795 19:34961514-34961536 AGCCTGCCCCAGACCTTTGATGG + Intronic
1168307783 19:55444812-55444834 AGGCTGCCATAGAGCTTCCCAGG + Intergenic
1168361893 19:55748227-55748249 AGGCAGTCCCAGAAATTTCATGG - Intergenic
1168404224 19:56102631-56102653 AGGCTGACGCAGACTTTTCAGGG - Intronic
925323710 2:2998600-2998622 AGGCTGAGACAGAATTTTCAGGG - Intergenic
925351574 2:3204580-3204602 AGGCGCCCACAAAACTTTCAAGG + Intronic
925738672 2:6986181-6986203 AGGCTGTCACTGTACCTTCATGG - Intronic
926038493 2:9654252-9654274 AAGCTTCCACAGCACTTTCTAGG - Intergenic
927373368 2:22383627-22383649 AAGCTGACACAGAACTTGGATGG + Intergenic
928169324 2:28993354-28993376 AGGCTGGCACAGACCTTCCATGG - Intronic
928261185 2:29768093-29768115 AGGCTCCCAGGGAATTTTCATGG + Intronic
929853781 2:45618034-45618056 AGGATGCCACAGGAGTTTCTTGG - Intergenic
933522633 2:83392474-83392496 ATGTTGCCACAAAACTTTCTGGG - Intergenic
934520167 2:95015123-95015145 AGGCTGCCAAAGAATCTTCAGGG - Intergenic
934652141 2:96098834-96098856 AGGCTGCCACCAAGCCTTCAGGG + Intergenic
934927031 2:98389205-98389227 GGGCTGCCTCAGAACTATCCAGG + Intronic
935712598 2:105912599-105912621 AGGCTGCCACAGGCCTTTTCTGG - Intergenic
936348967 2:111698226-111698248 TGGCTGCCACAGGAGTTTCTTGG - Intergenic
936528916 2:113261490-113261512 GGGCTGCCACATGACTTGCATGG + Intronic
943751601 2:191515060-191515082 AGACAGCCACAGAACTTCCTGGG + Intergenic
944308835 2:198209116-198209138 ATGCTGCCAAAGAATTTGCATGG + Intronic
1170860737 20:20101045-20101067 AGACTTCCACATAACTTCCAGGG + Intronic
1171523187 20:25791312-25791334 AGGCAGCCCCTGAATTTTCAGGG + Intronic
1171530930 20:25853292-25853314 AGGCAGCCCCTGAATTTTCAGGG + Intronic
1171553639 20:26064571-26064593 AGGCAGCCCCTGAATTTTCAGGG - Intergenic
1172407346 20:34699657-34699679 AGGCTGACACATCACTTTAAGGG + Intronic
1175703757 20:61160267-61160289 AGGGGGCCAGAGAACATTCAGGG - Intergenic
1176136963 20:63527763-63527785 ATCCTGGGACAGAACTTTCATGG + Intergenic
1177297712 21:19198767-19198789 AGGCTGCCATAGAATTTACCAGG + Intergenic
1184072665 22:42155473-42155495 AGGCTGGAACAGGACTTTCTGGG + Intergenic
950062235 3:10081430-10081452 AGGCTGCTGCAGATTTTTCATGG + Exonic
950877786 3:16292788-16292810 AGGCTGCCAAAGCAATTTAATGG - Intronic
951083596 3:18482839-18482861 ATGCTGCTACCAAACTTTCAAGG - Intergenic
952814915 3:37438765-37438787 AGGCTGCCTCAGGACAGTCAAGG + Intergenic
953201852 3:40784843-40784865 AAGCTGAGACAGAAATTTCAAGG - Intergenic
953255456 3:41286510-41286532 ACGGTGCCAGAGAACTTTCTAGG + Intronic
956647018 3:71466161-71466183 AGCCTGCCCCAGACCTTTCAAGG + Intronic
957736562 3:84211245-84211267 ATGCTGCCACTGATCTTTCAGGG + Intergenic
958983925 3:100758473-100758495 ACACTGCCATAGAACTCTCAAGG + Intronic
959736705 3:109667267-109667289 AGACTCCCACAGAAATATCATGG + Intergenic
962067321 3:131995383-131995405 AGGCCTCCACAGAACCTTGAAGG - Intronic
964624926 3:158749681-158749703 AGGCTCCCAAGGAGCTTTCATGG - Intronic
965374884 3:167910772-167910794 AGGTTTGCACACAACTTTCAGGG - Intergenic
972300815 4:37784231-37784253 AGGCTGCAAAATCACTTTCATGG - Intergenic
972663407 4:41140727-41140749 ATGCTGCCACTGATCTGTCAGGG - Intronic
975785568 4:77884393-77884415 AGGCTGCAACAAAACTTTGGAGG + Intronic
983494292 4:168425993-168426015 AGGGAGCCACAGAAATTTGAGGG + Intronic
985771595 5:1815228-1815250 AGGCTGCCACAGATCACTCAGGG + Intronic
987494426 5:18625007-18625029 AGGGTGCCACATAATTTCCAAGG - Intergenic
993508361 5:88739785-88739807 AGGCAACCACAAAACATTCAGGG + Intronic
995216350 5:109599666-109599688 AGGCTTCCAGAGAAGCTTCAGGG + Intergenic
995847396 5:116508849-116508871 AGGTTCCCTCAGAACCTTCAAGG - Intronic
996896650 5:128492420-128492442 AGGCAGCTACATAACTATCATGG + Intronic
997191410 5:131940125-131940147 AGAGTGCCACAGAACTACCAGGG + Intronic
997261206 5:132466687-132466709 AGGCGGCCCCAGGACCTTCAAGG - Intronic
1001469635 5:172002097-172002119 AGGATCCCACAGATCTTACAGGG + Intronic
1002458320 5:179358774-179358796 GGGCTGCCACTGAAATGTCATGG - Intergenic
1003249813 6:4416408-4416430 AGATTGCCACAGATCTTTGAAGG - Intergenic
1007811616 6:44490370-44490392 AGACTGCCAAAAAGCTTTCAGGG + Intergenic
1009873050 6:69472574-69472596 TGGCTGCCACAGAACTAGAAAGG - Intergenic
1010374093 6:75146174-75146196 AGGCTGCCACTGCACATGCATGG + Exonic
1020467961 7:8502661-8502683 AGGCTGAGATAGAGCTTTCAAGG + Intronic
1021058429 7:16079870-16079892 AGACAGCCACAGCACATTCAAGG + Intergenic
1022250834 7:28606598-28606620 ATGCTGCAACAGAATTTGCAGGG - Intronic
1023910114 7:44547983-44548005 AGCCTGCGACAAAAGTTTCAGGG - Intergenic
1027591640 7:80126250-80126272 AGGCTGGCAGAGCACTTTCCAGG - Intergenic
1027908229 7:84213866-84213888 AGGTTGCCCCAGCACTATCATGG + Intronic
1031540490 7:122989233-122989255 AGGATGGCACATGACTTTCAGGG - Intergenic
1031893897 7:127325774-127325796 AGGCTGGCACAGAAGTTCCTTGG - Intergenic
1032736394 7:134696361-134696383 AGGCGGCTACAGTAATTTCAAGG + Intergenic
1037565252 8:20112514-20112536 TGGCTTCCACAGCACTTTCCTGG + Intergenic
1037703802 8:21298193-21298215 AGGGAGCAACAGAACTTTAACGG - Intergenic
1038076546 8:24081908-24081930 AGGATGTCTCAAAACTTTCAAGG - Intergenic
1040873664 8:52127621-52127643 AACATGCCAGAGAACTTTCAGGG + Intronic
1041519824 8:58743147-58743169 ATGTTGCCACAATACTTTCAAGG - Intergenic
1045806423 8:106167761-106167783 GGGCTGCCACAGAAAACTCACGG + Intergenic
1048253350 8:132885804-132885826 ATTCTGCCATAGAACCTTCAGGG - Intronic
1048809934 8:138276607-138276629 AGGGTGCCTCAGAACTTGGAGGG - Intronic
1048821244 8:138382521-138382543 AGTCTGGCACCAAACTTTCATGG + Intronic
1055097696 9:72430832-72430854 AGCCTGCATCAGAAATTTCAGGG - Intergenic
1057725792 9:97567407-97567429 AGGCTGCCAGAGCTCTGTCAGGG + Intronic
1061118339 9:128628426-128628448 AGGCTGCCACTTTACTTTCCTGG + Intronic
1061784065 9:133014566-133014588 AGGATGCTGCAGAACTTTCAAGG - Intergenic
1062288636 9:135784882-135784904 AGGCTGCCCCAGAACCTCCGAGG - Exonic
1186460570 X:9745424-9745446 AGGCTGCCAGAGATCTCTCAAGG - Intronic
1186552902 X:10525737-10525759 AGCCAGACACAGAACTCTCATGG - Intronic
1186720435 X:12297878-12297900 AGGCTGCCAGAAATCATTCATGG - Intronic
1188201211 X:27294320-27294342 AGGCTGGCACAGAAATTGAAAGG + Intergenic
1188409717 X:29856436-29856458 ATGCTGCCACTGAACTCTCTTGG - Intronic
1196596559 X:117552676-117552698 AGGCTGGCACATAAAGTTCAAGG + Intergenic
1199620785 X:149698702-149698724 AGGCTGCCACCCAGCTTTCTGGG + Intronic
1201020101 Y:9647375-9647397 AGGCTCCCACATAGCTTTCTGGG + Intergenic