ID: 1162694650

View in Genome Browser
Species Human (GRCh38)
Location 19:12464266-12464288
Sequence GTTCCATTCGAATACATGAA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 5, 3: 18, 4: 98}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162694650_1162694655 20 Left 1162694650 19:12464266-12464288 CCTTTCATGTATTCGAATGGAAC 0: 1
1: 0
2: 5
3: 18
4: 98
Right 1162694655 19:12464309-12464331 CCACACTGTTTACATTCATAGGG 0: 16
1: 50
2: 222
3: 492
4: 1078
1162694650_1162694653 19 Left 1162694650 19:12464266-12464288 CCTTTCATGTATTCGAATGGAAC 0: 1
1: 0
2: 5
3: 18
4: 98
Right 1162694653 19:12464308-12464330 ACCACACTGTTTACATTCATAGG 0: 6
1: 18
2: 39
3: 185
4: 493

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162694650 Original CRISPR GTTCCATTCGAATACATGAA AGG (reversed) Exonic
908590801 1:65631021-65631043 GTTTCATTCCTAAACATGAAAGG - Intronic
911177671 1:94833332-94833354 GATGCATTAGACTACATGAAAGG - Intronic
912024133 1:105145547-105145569 TTTCCCTTCGAATACTTGAAAGG - Intergenic
919092722 1:192993857-192993879 GTTCCCTTCGCAGACATGAAAGG - Intergenic
924766582 1:247037548-247037570 GTGCCCTTCGAAGCCATGAAAGG - Exonic
1064738107 10:18404180-18404202 GTCTCATTTGAATACATCAAAGG - Intronic
1065691527 10:28338882-28338904 GTTCCATTCAAAATCATAAAAGG - Intergenic
1065691578 10:28339460-28339482 GTTCCCTTGGAAGACATGAAAGG - Intergenic
1066949801 10:42105463-42105485 ATTCCATTCGAGTCCATTAAAGG - Intergenic
1071782449 10:88861373-88861395 GTTCCCTTCAAGTACATAAATGG + Intergenic
1076169314 10:128306576-128306598 GTTCCATTTTAAACCATGAATGG + Intergenic
1080192049 11:29562658-29562680 GTTTCATTCGAATACATTTTGGG + Intergenic
1085100840 11:73798443-73798465 ATTGCCTTCAAATACATGAAGGG + Intronic
1086662619 11:89439992-89440014 GTTCCTTTCCAATACATTGAGGG + Intronic
1089035926 11:115391393-115391415 GTTCCATTCTAAAATGTGAATGG + Intronic
1090580054 11:128149404-128149426 CTTCAATTCCAAAACATGAAGGG + Intergenic
1097282140 12:57851666-57851688 TTTCCATTCGCATGCATGACTGG + Intergenic
1100695307 12:97086278-97086300 GCTCCACTCCAATACATCAAAGG - Intergenic
1104803812 12:131572286-131572308 GTTCCATGCGAGTTCATAAATGG + Intergenic
1107998847 13:45888359-45888381 TTTCCAGTTGAAAACATGAAAGG + Intergenic
1120426367 14:84352696-84352718 GTTCCATTCGTCTACATGTCTGG - Intergenic
1121968013 14:98328395-98328417 GTACCATTCAGAAACATGAAGGG - Intergenic
1122327226 14:100890135-100890157 GTCCCATTCGAAGACCTCAAAGG - Intergenic
1123903905 15:24903567-24903589 TTTCCATTGGAAAGCATGAATGG - Intronic
1126753231 15:51898568-51898590 GTAATATTCGAATACATGTATGG + Intronic
1128408267 15:67366453-67366475 GTTCCATGAGAATGCATCAAAGG + Intronic
1134594686 16:15486353-15486375 GTTCCACTGGAATTCAGGAAGGG + Intronic
1136950007 16:34705239-34705261 ATTCCATTCGACTACATTCAAGG + Intergenic
1137842958 16:51656906-51656928 GTTCCATCTCAATACATCAAAGG + Intergenic
1140801640 16:78493867-78493889 TTTCCATTTGGATAGATGAATGG + Intronic
1146978516 17:37137414-37137436 TTTCCTTTAGAACACATGAAAGG + Intronic
1147589895 17:41675749-41675771 GTTCCATTGGAATTCAGGATTGG - Intergenic
1149654019 17:58300837-58300859 GTTCCATTTGAAAGCAAGAAAGG - Intergenic
1151634600 17:75337043-75337065 GTAACATTTGAGTACATGAATGG + Intronic
1154220860 18:12452625-12452647 GTTACATTCTAATAGAAGAAGGG - Intronic
1155801723 18:30113905-30113927 ATTCCATTTCAATACATGCAGGG + Intergenic
1159621218 18:70641040-70641062 TTTCCCTTCTAATACCTGAAGGG + Intronic
1161177352 19:2853123-2853145 AGTCCTTTCGAAGACATGAAAGG + Exonic
1161177363 19:2853207-2853229 AGTCCTTTCGAAGACATGAAAGG + Exonic
1162260355 19:9528557-9528579 GTTCATTTCAAATACATGAAAGG - Exonic
1162594523 19:11617210-11617232 GTTACATTAGAATACATGAAAGG + Exonic
1162594555 19:11617546-11617568 GTTCATTTCGAATCCATGAAAGG + Exonic
1162598999 19:11652841-11652863 GTTCCCTTCAAAGACATGAAAGG + Intergenic
1162603174 19:11685879-11685901 GTCCCCTTCAAAGACATGAAAGG + Intergenic
1162607598 19:11722646-11722668 ATTACACTCGACTACATGAAAGG - Exonic
1162614034 19:11781455-11781477 GTTACATTCAACTACATGAAAGG + Exonic
1162616634 19:11806552-11806574 GTTCCTTTCGCAGACATGAAAGG + Exonic
1162616679 19:11806972-11806994 AGTACATTCGAATACATGGAAGG + Exonic
1162619708 19:11832066-11832088 GTTATGTTCGTATACATGAAAGG + Exonic
1162619726 19:11832318-11832340 GTTCCCTTCGATATCATGAAAGG + Exonic
1162623960 19:11868253-11868275 GTTCCTTTCGATATCATGAAAGG + Exonic
1162628494 19:11905953-11905975 GTTCCTTTCGATACCATGAAAGG + Intronic
1162633678 19:11948980-11949002 GTTCTCTTCGTAGACATGAAAGG + Exonic
1162633699 19:11949232-11949254 GTTCCTTTCGATATCATGAAAGG + Exonic
1162633778 19:11950006-11950028 CTTCTTTTCAAATACATGAAAGG + Exonic
1162637223 19:11978982-11979004 GTTCCCTTCGTAGACATGAAAGG + Exonic
1162641714 19:12015457-12015479 CTTTCTTTCAAATACATGAAAGG - Exonic
1162649572 19:12077083-12077105 GTTCCTTTCGTAGACATAAAAGG + Exonic
1162649589 19:12077251-12077273 CTGCCATTCGTAGACATGAAAGG + Exonic
1162653740 19:12112509-12112531 GTTCCCTTCGGAGACATGAAAGG + Intronic
1162653812 19:12113343-12113365 GTTCCTTTCGTAGATATGAAAGG + Exonic
1162656245 19:12132773-12132795 GTTCCATTCGATATCATGAAAGG - Exonic
1162656261 19:12132941-12132963 CTTCCTTGCGTATACATGAAAGG - Exonic
1162663225 19:12187424-12187446 GTACCTTTCAAATACATGAAAGG + Exonic
1162663259 19:12187844-12187866 GTTCCTTTCGACTACATGAAAGG + Exonic
1162694643 19:12464182-12464204 GTTCTGTTCGAATGCATGAAAGG - Exonic
1162694650 19:12464266-12464288 GTTCCATTCGAATACATGAAAGG - Exonic
1162694660 19:12464350-12464372 GTTCCTTTCGAATGCATGAAAGG - Exonic
1162694668 19:12464434-12464456 GTTCCTTTCGGATGCATGAAAGG - Exonic
1162694682 19:12464602-12464624 GTTCTGTTCGAATACATGAAAGG - Exonic
1162715381 19:12628131-12628153 GTTCGCTTCGAGTTCATGAAAGG + Exonic
1162715426 19:12628635-12628657 GTTACTTTCGAATACATGAAAGG + Exonic
1163857039 19:19711460-19711482 GTTCTGTTCGAATTCATGAAAGG - Exonic
1163857073 19:19711880-19711902 GTTATTTTCGAATTCATGAAAGG - Exonic
1163857082 19:19711964-19711986 GTTCCCTTCAAAGACATGAAAGG - Exonic
925830721 2:7892286-7892308 GTGCCATTAGAATACTAGAAAGG - Intergenic
936605796 2:113951948-113951970 TTTCCATTAGAATACCTGACAGG - Intronic
941158005 2:162002213-162002235 GAGCCATTTGCATACATGAATGG - Intronic
948249768 2:236517199-236517221 GTTCAATTCGAATACATACCTGG + Intergenic
1169554300 20:6733315-6733337 GTTGCATGTGTATACATGAAAGG - Intergenic
1169968360 20:11242155-11242177 ATTGCATTCCAATACATGCAGGG + Intergenic
1173246983 20:41343713-41343735 GTTCCTTTCAAACACATGAAAGG + Intronic
1174106129 20:48163661-48163683 CTTCCATGAGAATTCATGAAGGG - Intergenic
949123666 3:419314-419336 GATCTATTCCTATACATGAAAGG + Intergenic
955698818 3:61663209-61663231 ATTCCATTCCCAAACATGAATGG - Intronic
962459483 3:135596166-135596188 GTTCCATTTTTAAACATGAATGG - Intergenic
963871732 3:150423076-150423098 GTTCCATTTGAACACGTTAAAGG + Exonic
964603936 3:158538450-158538472 ATTCCATTAGGATATATGAATGG - Intronic
967441073 3:189509698-189509720 GTTCCTTTTGAATACAAGCAGGG - Intergenic
967581990 3:191169568-191169590 TTTACATTTTAATACATGAAAGG - Intergenic
972779377 4:42272999-42273021 GTTCCACTGGAATACACCAATGG - Intergenic
972809709 4:42569895-42569917 CTTCCAATTGAATACATGACTGG - Intronic
988255706 5:28817920-28817942 GTTGCATTAGAATACCTGACTGG + Intergenic
991963455 5:72068116-72068138 GTTCCAAGGGAATACAGGAAGGG + Intergenic
992270804 5:75061068-75061090 GCTCCCTTCGAATGAATGAAAGG - Intergenic
993574257 5:89581813-89581835 TTTACATTTGAATAAATGAAAGG - Intergenic
995775625 5:115722303-115722325 GTTACATTTGAAAACATTAAAGG - Intergenic
996973445 5:129401059-129401081 GATCCATTCAAATTCAAGAAAGG + Intergenic
997536512 5:134626697-134626719 GTTCCATTAAACTACATGGATGG + Intronic
998338105 5:141391926-141391948 TTTCTATTTGAATACTTGAAAGG - Intronic
1000654152 5:163855552-163855574 GTTTCCTTCAAAGACATGAAAGG - Intergenic
1001706172 5:173742543-173742565 GTTCCCTACTAATAAATGAATGG - Intergenic
1008196300 6:48525649-48525671 ATTCCATACGAAAACATCAAAGG - Intergenic
1010660435 6:78564291-78564313 GTTCCATTTAAAAACAAGAAAGG - Intergenic
1018461557 6:164004078-164004100 GTTCCATGGGAATCCATGCATGG - Intergenic
1019067893 6:169317889-169317911 CTTCCACTTGAATAAATGAAAGG - Intergenic
1021042481 7:15879832-15879854 GTTCCAATGGAATATAAGAAAGG + Intergenic
1024691520 7:51807942-51807964 TTTCTATTCTAAAACATGAAAGG - Intergenic
1025475817 7:60919562-60919584 ATTCCATTCGAATTCATTTAGGG + Intergenic
1028592962 7:92517561-92517583 GTCCCATGGAAATACATGAATGG + Exonic
1028910229 7:96199610-96199632 GTTCCACTCAAGTACATGAAAGG + Intronic
1030389521 7:108908862-108908884 ATTACATTCTAATACATCAATGG + Intergenic
1032618500 7:133501400-133501422 GTTCCATTTGAATTAATCAAAGG + Intronic
1032942398 7:136810188-136810210 GTTCCACTTGAATATATGACAGG + Intergenic
1033134276 7:138771981-138772003 GTGACATTCGAGTGCATGAAAGG - Intronic
1035850048 8:2909665-2909687 GTCCCATTCTAAAATATGAATGG + Intergenic
1037457858 8:19082048-19082070 GCTACATTCTAAAACATGAAAGG + Intronic
1046029159 8:108762674-108762696 GTACCATTCGAATTAATGATAGG - Intronic
1051410649 9:16786609-16786631 GTTCCATGAGAATGCATGCATGG + Intronic
1051910471 9:22149291-22149313 ATTTCTTTCAAATACATGAAGGG + Intergenic
1203729161 Un_GL000216v2:75399-75421 ATTCCATTCGATTACATTACAGG + Intergenic
1187269886 X:17770070-17770092 GGTCCATACTCATACATGAAGGG + Intergenic