ID: 1162704826

View in Genome Browser
Species Human (GRCh38)
Location 19:12547650-12547672
Sequence CAGCCTTATCACTCCAACCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 157}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162704826_1162704834 16 Left 1162704826 19:12547650-12547672 CCCTGGTTGGAGTGATAAGGCTG 0: 1
1: 0
2: 1
3: 13
4: 157
Right 1162704834 19:12547689-12547711 CTACCCAGGAAGAACCAACTGGG 0: 1
1: 0
2: 3
3: 21
4: 132
1162704826_1162704830 2 Left 1162704826 19:12547650-12547672 CCCTGGTTGGAGTGATAAGGCTG 0: 1
1: 0
2: 1
3: 13
4: 157
Right 1162704830 19:12547675-12547697 ATGCCTGCCAAGTTCTACCCAGG 0: 1
1: 0
2: 1
3: 9
4: 180
1162704826_1162704833 15 Left 1162704826 19:12547650-12547672 CCCTGGTTGGAGTGATAAGGCTG 0: 1
1: 0
2: 1
3: 13
4: 157
Right 1162704833 19:12547688-12547710 TCTACCCAGGAAGAACCAACTGG 0: 1
1: 0
2: 2
3: 12
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162704826 Original CRISPR CAGCCTTATCACTCCAACCA GGG (reversed) Intronic
903808633 1:26022346-26022368 CAGCCTTTTCCCTCCCAGCAGGG - Exonic
904367576 1:30024557-30024579 CAGTCTTCACACCCCAACCATGG - Intergenic
906373052 1:45270594-45270616 AAACCTTATCATTCCAACCCTGG - Intronic
907007656 1:50932135-50932157 CAACCATATCATTCCACCCATGG + Intronic
908349424 1:63270181-63270203 CAGCCATTGCACTCCAACCTGGG - Intergenic
909268856 1:73597836-73597858 CAAGCTTCTCAGTCCAACCACGG - Intergenic
911009246 1:93262195-93262217 AAGCCATATCATTCCAACCCTGG + Intronic
912864888 1:113248137-113248159 GAGCCTCATCACTCCCTCCAGGG - Intergenic
915737712 1:158095222-158095244 CAGCCTTCTTCCTCCCACCATGG + Exonic
916821770 1:168405903-168405925 CATTCTTATCACACCAAACAGGG - Intergenic
918045045 1:180936386-180936408 CAGCCTGAGCAGTCCAGCCAGGG - Exonic
919684857 1:200474251-200474273 CAGGCTTGTCACTGCAGCCAGGG - Intergenic
922461546 1:225817469-225817491 CAGCCTCATCACTCCTCCCTGGG - Intronic
922615572 1:226959375-226959397 CAGCCTTGACACTCCAGCCCGGG + Intronic
1064262024 10:13793617-13793639 CAGCCTCCCCACTCCAGCCATGG - Intronic
1065141611 10:22723790-22723812 GCGCCTTTGCACTCCAACCAGGG - Intergenic
1067713234 10:48667053-48667075 CAGCTTTGTCACTGCATCCATGG - Intergenic
1068961167 10:62867984-62868006 CAGAGTTATAATTCCAACCAAGG - Intronic
1071765173 10:88655864-88655886 CACCCTTATCACTAGACCCAAGG + Intergenic
1073103721 10:101020577-101020599 CAGCCCTTTCCCTCCAACCTTGG + Intronic
1073370269 10:102981879-102981901 CACCCTAGTCATTCCAACCAAGG - Intronic
1074855007 10:117467014-117467036 CAGCCTTCTCAAGCCAACCTTGG - Intergenic
1075629281 10:123991512-123991534 CAGCCATTTCACTCCAGCCTGGG + Intergenic
1076870870 10:133193480-133193502 CAGCCATTGCACTCCAGCCAGGG + Intronic
1077624559 11:3758690-3758712 CAGGAAAATCACTCCAACCAGGG + Intronic
1080038616 11:27735512-27735534 CAGCCATGTCACTCCAGACAGGG + Intergenic
1086359064 11:86038276-86038298 CAGCCATAGCACTCCAACCTGGG + Intronic
1087857318 11:103108049-103108071 GAGCATTATCACTCTTACCAAGG - Intergenic
1089552299 11:119289783-119289805 GAGCCTTTGCACTCCAACCTGGG - Intronic
1089789345 11:120931365-120931387 CACCAATATCACTCCAGCCAAGG - Intronic
1091079534 11:132653734-132653756 CAGCTTTATCCCTCCTGCCATGG - Intronic
1092991279 12:13902765-13902787 CAGCCATTGCACTCCAACCTGGG + Intronic
1096916769 12:55041389-55041411 CAGCCTTCACACCCCAATCAAGG - Intergenic
1099856288 12:88171362-88171384 CAACCTTCTCCCTCCAACCCTGG + Intronic
1101725636 12:107385962-107385984 CAGACTTCTCACTCAAACCCAGG - Intronic
1102712688 12:114941898-114941920 CAGACTTCTCACTCCAACTTGGG - Intergenic
1104516448 12:129431554-129431576 CAGCGTTATCACTCCTGCCCTGG + Intronic
1105336692 13:19477483-19477505 CAGCCTTAACTCTCCAAGCCTGG - Intronic
1105474010 13:20715650-20715672 CAGACTTAACACTACATCCAAGG - Intronic
1106132499 13:26951870-26951892 CAGCCTGCTAATTCCAACCAAGG + Intergenic
1106487586 13:30185881-30185903 CAGACTTTTGATTCCAACCAAGG - Intergenic
1107298184 13:38936839-38936861 CAGCTTCATCACTCCAACTCAGG - Intergenic
1107915979 13:45151401-45151423 CAGCCATTGCACTCCAACCTTGG - Intronic
1109334198 13:60971659-60971681 CAGCCATATCATTCCATCCCTGG - Intergenic
1110257623 13:73449498-73449520 GGGCCTTATCTCTCCAAACAAGG + Intergenic
1110394167 13:75010778-75010800 CAGCTTTATCACTCTGACCTTGG - Intergenic
1112348494 13:98612912-98612934 CAGCAGAATCACTTCAACCAGGG - Intergenic
1112755288 13:102625503-102625525 TACCCTTTTCACTCCCACCATGG + Intronic
1115889185 14:38008076-38008098 CAGTCCTATGCCTCCAACCATGG + Intronic
1116873309 14:50088302-50088324 CAGCCTTTTGACTCCCAGCAGGG - Intronic
1119178415 14:72587064-72587086 CAGCCTTTTGTCTCCAAGCATGG + Intergenic
1127326990 15:57905636-57905658 CAGCCTTAGCACTCCAACCTGGG - Intergenic
1127830180 15:62743636-62743658 CAGCCTTTTTCCCCCAACCAGGG + Intronic
1131974664 15:97932886-97932908 AAACCTTATCATTCCACCCATGG + Intergenic
1136673292 16:31876892-31876914 CAGCCTGCTCACCCCATCCATGG + Intronic
1137458703 16:48638320-48638342 CAGCCTGATTCTTCCAACCATGG + Intergenic
1137956357 16:52834712-52834734 CAGCCTGATCACTGGAAACATGG + Intergenic
1138297591 16:55900146-55900168 CAGGCTCATTTCTCCAACCACGG + Intronic
1138787186 16:59861209-59861231 CATCCTTACCCATCCAACCAGGG - Intergenic
1139161298 16:64513944-64513966 CATCCTCATCCCTCAAACCAGGG - Intergenic
1139513881 16:67442225-67442247 CAGCCAGCTCGCTCCAACCAGGG + Intronic
1141004488 16:80339581-80339603 GAGCCCTGTCACCCCAACCATGG - Intergenic
1144522992 17:15966789-15966811 CAGCTTTATTATTCCAAACAAGG - Intronic
1154063907 18:11088824-11088846 CAGCCTCATAACTCACACCAAGG + Intronic
1157080528 18:44520173-44520195 CAGGCTTATCACCTCAATCAGGG - Intergenic
1157111817 18:44827610-44827632 TAGCCTTATCAATCAAACCATGG + Intronic
1158825683 18:61216185-61216207 CAGCCTTCTCTTTCCCACCACGG + Intergenic
1159208477 18:65284418-65284440 CAGCCATTGCACTCCAGCCAGGG + Intergenic
1160426205 18:78780959-78780981 GATCCTTATCACAGCAACCACGG + Intergenic
1160486162 18:79294771-79294793 GAGCCATATCATTTCAACCATGG - Intronic
1162674776 19:12290757-12290779 CAGCCTAATCACTCCAGCAATGG - Intronic
1162704826 19:12547650-12547672 CAGCCTTATCACTCCAACCAGGG - Intronic
1163884536 19:19954162-19954184 CAGCCTGCTCACCCCAGCCATGG - Intergenic
1163908672 19:20169469-20169491 CAGCCTGCTCACCCCACCCATGG + Intronic
1163983839 19:20926648-20926670 CAGCCTGCTCACCCCAGCCATGG + Intronic
1164030644 19:21400644-21400666 CAGCCTGCTCACTCCAGCCATGG + Intronic
1164070537 19:21764093-21764115 CAGCCTTCTCACTGCAGCCATGG - Intronic
1164123617 19:22290194-22290216 CAGCCTGCTCACCCCAGCCATGG + Intronic
1164225934 19:23245978-23246000 TAGCCTGCTCACTCCAGCCATGG - Intronic
1164272147 19:23682583-23682605 CAGCCTGCTCACCCCAGCCATGG - Intronic
1165778418 19:38418236-38418258 CAGCCTGGGCATTCCAACCAAGG - Intronic
929001693 2:37353344-37353366 CAGCCTTAACTCTCCCTCCAGGG - Intronic
931216837 2:60253069-60253091 CAGCCTTCTCACTTCAAGAAAGG + Intergenic
935191019 2:100778990-100779012 GATCCTCAACACTCCAACCATGG + Intergenic
935887094 2:107633984-107634006 CAGACTTATGACTCATACCAAGG - Intergenic
940743828 2:157544503-157544525 CAGCTTGATCATTCCAGCCACGG + Exonic
941227111 2:162864383-162864405 AAGCCTTATCATTCCATCCTTGG + Intergenic
945044390 2:205769131-205769153 CAGCCTTTTCACTCAAAAAATGG + Intronic
947812106 2:233011077-233011099 CAGCCCTCTCACCCCAACAACGG - Intronic
947971147 2:234326558-234326580 CTGCCCCATCACTCCAACCATGG + Intergenic
1170697207 20:18669722-18669744 AGGCCTTATCACTCCAAACTGGG + Intronic
1172315402 20:33950139-33950161 CAGCCTCAACTCTCCTACCATGG - Intergenic
1173799486 20:45886261-45886283 CAGCCTTAACTCTCCAAGCAGGG + Intergenic
1176334679 21:5584971-5584993 AAGCCTACTCACACCAACCATGG - Intergenic
1176393078 21:6235977-6235999 AAGCCTACTCACACCAACCATGG + Intergenic
1176468341 21:7080197-7080219 AAGCCTACTCACACCAACCATGG - Intronic
1176491902 21:7461975-7461997 AAGCCTACTCACACCAACCATGG - Intergenic
1176508740 21:7676408-7676430 AAGCCTACTCACACCAACCATGG + Intergenic
1176736861 21:10557618-10557640 CAGCCTTAACTCTCCAAGCCTGG + Intronic
1180030914 21:45206978-45207000 CAGCCTCATGGCTCCAACCCAGG - Intronic
1183532267 22:38364967-38364989 CAGCCTTAACTCTCCAAGCCTGG - Intronic
1184018660 22:41805201-41805223 CAGCCTGATCACTTGAACCCAGG + Intronic
949208521 3:1470139-1470161 CAGCCTTATCTTTTCCACCAAGG + Intergenic
949742654 3:7254000-7254022 CAGCTTTCTCCCTCCAACCCTGG + Intronic
951339140 3:21462887-21462909 CAGCAGAATCACTCGAACCAGGG + Intronic
951533508 3:23720902-23720924 CAGCCTTGTCACTCCAGCTGAGG + Intergenic
952606209 3:35149884-35149906 CAACCTTAGCACCACAACCACGG + Intergenic
954186680 3:48922394-48922416 CAGGAGAATCACTCCAACCAGGG - Intronic
955755010 3:62217715-62217737 CAGCCCCAGCACCCCAACCAGGG + Intronic
956323851 3:68028657-68028679 CTGCCATATCACTCCAATCTTGG + Intronic
957769635 3:84674133-84674155 TAGCATTATCATTTCAACCATGG - Intergenic
961119898 3:124365001-124365023 CAGCCTTATCCCTCCTGCCCTGG + Intronic
961822562 3:129582597-129582619 AGGCCTTATCACCCCAGCCAAGG + Intronic
962731276 3:138285806-138285828 AAACCTTACCACTTCAACCAGGG + Intronic
964661568 3:159125776-159125798 CAGCCTAATCAATCCAAATATGG + Intronic
964746140 3:160014381-160014403 GAGCCACATCACTCCAGCCAAGG - Intergenic
967497558 3:190158848-190158870 CTGCATTATTACTCCAGCCAAGG - Intergenic
970267937 4:14310219-14310241 CTCCCTTTTCATTCCAACCATGG + Intergenic
973777917 4:54260451-54260473 CAGCCTCTGCACTCCAACCTGGG - Intronic
974368946 4:60988913-60988935 CAGCCTTACTACTCAAACCAGGG + Intergenic
975241806 4:72067986-72068008 CACCCTTAACACTCCATTCATGG + Intronic
977131402 4:93243531-93243553 CAGCCTTATCACCTCAAGCAGGG + Intronic
977133582 4:93272712-93272734 CAGTCTTCTCACTCCTGCCATGG - Intronic
980093810 4:128468976-128468998 CAGCCTTCCCAGTACAACCATGG + Intergenic
981881132 4:149614126-149614148 CACCCTCAACACTCCCACCAAGG - Intergenic
984907832 4:184646666-184646688 AAGCCTCAGCACTCCCACCAAGG + Intronic
986030507 5:3888887-3888909 CAGCCTTATTTCTCCACCTAAGG - Intergenic
988807276 5:34752096-34752118 CAGCCTTATAAATTCAATCAGGG - Intronic
992881957 5:81119079-81119101 CATCCTTAACGCTCCATCCATGG + Intronic
994546837 5:101177434-101177456 AAACCATATCACTCCAACCTTGG - Intergenic
998294312 5:140952293-140952315 CAGCCATTTCACTCCAGCCTGGG + Intronic
1002322222 5:178382823-178382845 CAGCCTTCTGACTCCTGCCAAGG - Intronic
1002869951 6:1157594-1157616 AAACCATATCATTCCAACCAGGG - Intergenic
1006303379 6:33205674-33205696 CAGCCCAATCACTCCAGCCTTGG - Exonic
1010242879 6:73633027-73633049 CAGCCATTGCACTCCAACCTGGG - Intronic
1011354390 6:86458944-86458966 CAACCTTATCACTTCCCCCAAGG + Intergenic
1013104977 6:107019493-107019515 CAGGATAATCACTTCAACCAGGG - Intergenic
1014714792 6:124850738-124850760 CAGCTTTAGCACTCCCACTAGGG + Intergenic
1014965906 6:127750145-127750167 CAGCCTTCTCATTACAACCTAGG - Intronic
1017945431 6:159093287-159093309 CAGCCATAGCACTCCAACCTGGG - Intergenic
1021693817 7:23256425-23256447 CACCATTATCACCCCAATCAAGG - Intronic
1022948718 7:35315427-35315449 CACCATTATCACTACTACCAAGG - Intergenic
1023248829 7:38235697-38235719 CTGCCTTATCCATCCTACCAGGG - Intergenic
1024783250 7:52876146-52876168 CAGCCTGTTCACTCCAGACAAGG - Intergenic
1025265624 7:57454528-57454550 CAGCCTGCTCACTCCAGCCATGG + Intronic
1025824935 7:65003122-65003144 CAGCCTGCTCACTCTAGCCATGG - Intronic
1026582214 7:71627896-71627918 CAGCCGTATCACTCCTAATAAGG - Intronic
1028923496 7:96331894-96331916 CTGGCTTATGAGTCCAACCAGGG - Intergenic
1029515301 7:101019857-101019879 CAGCTTTATCACCCCAACAGAGG - Intergenic
1033721526 7:144064025-144064047 CAGCCTCATCACTCCCAACCTGG + Intergenic
1033946485 7:146725100-146725122 CAGGCTTATCACTCCAGTCTCGG + Intronic
1036937272 8:13015410-13015432 CTGCCATTGCACTCCAACCAGGG - Intronic
1037018844 8:13943170-13943192 CAGGATAATCACTCCAACCCAGG - Intergenic
1039508294 8:38068298-38068320 CAGCCTCTTCACTCCAATGAGGG + Intergenic
1040518398 8:48153474-48153496 AAGCCTGCTCTCTCCAACCAAGG + Intergenic
1045054476 8:98357508-98357530 CAGCCTTACACCTCCAACCATGG - Intergenic
1046827025 8:118702666-118702688 CAGCCCTTTCATTCCAACTAGGG - Intergenic
1048879036 8:138858169-138858191 CAGCCTTTTCACACCCTCCAAGG + Intronic
1055720293 9:79165682-79165704 TAGCCTCCTAACTCCAACCAAGG + Intergenic
1057794709 9:98146857-98146879 CAGCATAATCACTCCAACCCTGG + Intronic
1058179541 9:101779874-101779896 CAGCCTTTTCCCTTCCACCATGG + Intergenic
1058386408 9:104441590-104441612 CATCCATCTCACTCCATCCAGGG - Intergenic
1059435287 9:114272257-114272279 CAGCCTTCTCACTCCACTCTGGG + Intronic
1059695503 9:116726518-116726540 CAGCCTTAGGATTCCAGCCATGG - Intronic
1061808146 9:133147909-133147931 AGGCCTCCTCACTCCAACCAGGG + Intronic
1062413888 9:136438550-136438572 CAGCCTGAACACTACAACGAAGG + Intronic
1062657427 9:137611605-137611627 CAGCCTTGCCACCCCAACCTCGG - Intronic
1189655804 X:43244161-43244183 CAGCCTCATCACTTCAACTGGGG - Intergenic
1191117077 X:56863650-56863672 CTGCCTTATAATTCCTACCAGGG - Intergenic
1191842767 X:65524867-65524889 CAGCCTTCACACCCCAACCCAGG + Intronic
1193439092 X:81516324-81516346 AAACCTTATCATTCCACCCATGG - Intergenic
1202595126 Y:26530905-26530927 CAGCCTTAACTCTCCAAGCCTGG + Intergenic