ID: 1162705522

View in Genome Browser
Species Human (GRCh38)
Location 19:12551916-12551938
Sequence CAGTGTAACAGGAGGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 536
Summary {0: 1, 1: 0, 2: 1, 3: 45, 4: 489}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162705506_1162705522 22 Left 1162705506 19:12551871-12551893 CCCCTGGCCTCGGAGTAGGAGGC 0: 1
1: 0
2: 2
3: 15
4: 149
Right 1162705522 19:12551916-12551938 CAGTGTAACAGGAGGGAGGAGGG 0: 1
1: 0
2: 1
3: 45
4: 489
1162705507_1162705522 21 Left 1162705507 19:12551872-12551894 CCCTGGCCTCGGAGTAGGAGGCG 0: 1
1: 1
2: 0
3: 11
4: 107
Right 1162705522 19:12551916-12551938 CAGTGTAACAGGAGGGAGGAGGG 0: 1
1: 0
2: 1
3: 45
4: 489
1162705514_1162705522 -10 Left 1162705514 19:12551903-12551925 CCAGGCCAGACCACAGTGTAACA 0: 1
1: 0
2: 0
3: 16
4: 285
Right 1162705522 19:12551916-12551938 CAGTGTAACAGGAGGGAGGAGGG 0: 1
1: 0
2: 1
3: 45
4: 489
1162705509_1162705522 15 Left 1162705509 19:12551878-12551900 CCTCGGAGTAGGAGGCGCGCCCA 0: 1
1: 0
2: 0
3: 2
4: 53
Right 1162705522 19:12551916-12551938 CAGTGTAACAGGAGGGAGGAGGG 0: 1
1: 0
2: 1
3: 45
4: 489
1162705503_1162705522 26 Left 1162705503 19:12551867-12551889 CCATCCCCTGGCCTCGGAGTAGG No data
Right 1162705522 19:12551916-12551938 CAGTGTAACAGGAGGGAGGAGGG 0: 1
1: 0
2: 1
3: 45
4: 489
1162705513_1162705522 -5 Left 1162705513 19:12551898-12551920 CCAGGCCAGGCCAGACCACAGTG 0: 1
1: 0
2: 2
3: 41
4: 343
Right 1162705522 19:12551916-12551938 CAGTGTAACAGGAGGGAGGAGGG 0: 1
1: 0
2: 1
3: 45
4: 489
1162705508_1162705522 20 Left 1162705508 19:12551873-12551895 CCTGGCCTCGGAGTAGGAGGCGC 0: 1
1: 0
2: 3
3: 13
4: 154
Right 1162705522 19:12551916-12551938 CAGTGTAACAGGAGGGAGGAGGG 0: 1
1: 0
2: 1
3: 45
4: 489
1162705512_1162705522 -4 Left 1162705512 19:12551897-12551919 CCCAGGCCAGGCCAGACCACAGT 0: 1
1: 0
2: 3
3: 37
4: 346
Right 1162705522 19:12551916-12551938 CAGTGTAACAGGAGGGAGGAGGG 0: 1
1: 0
2: 1
3: 45
4: 489

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162705522 Original CRISPR CAGTGTAACAGGAGGGAGGA GGG Intronic
900302665 1:1985848-1985870 GAGGGGAACAGGAGGGAGGGAGG - Intronic
902775424 1:18671505-18671527 CAGTGGGCCAGGTGGGAGGAGGG + Intronic
902839340 1:19065346-19065368 CAGGGTAACCGGGAGGAGGACGG + Intergenic
904895511 1:33814601-33814623 CATTGAAACAGGAGGGAAAAAGG - Intronic
905025930 1:34849432-34849454 CATTAGAACAGGAGGGAGCAGGG + Intronic
905182040 1:36173276-36173298 CATTGTCACAGGAGGAAGAAGGG + Intronic
908000145 1:59671522-59671544 CAGAGTAGGTGGAGGGAGGAAGG + Intronic
908777351 1:67653379-67653401 CACAGTAACAAGAGGGAAGAAGG - Intergenic
909289516 1:73864610-73864632 GAGGGTGACAGGAGGGTGGAGGG + Intergenic
909532928 1:76700848-76700870 CAGTGTAAGAAGGGAGAGGATGG - Intergenic
909609767 1:77539810-77539832 CAGTAAAACAACAGGGAGGAGGG - Intronic
910006993 1:82410003-82410025 AAGAGTAAAAGGAGGGAGAATGG + Intergenic
910552174 1:88487789-88487811 CAATGAAGAAGGAGGGAGGAAGG + Intergenic
910663911 1:89703785-89703807 CAGTGCAGCAGAAGGCAGGAAGG + Intronic
910726378 1:90344237-90344259 AAGTGTTGCAGGAGAGAGGATGG - Intergenic
912121261 1:106474348-106474370 CACTGGGACAGGAGGGAGGCTGG + Intergenic
912627374 1:111216652-111216674 CAGTGTAAGAGGAAGGATAATGG - Intronic
913462806 1:119105920-119105942 AAGTGTATTAGGAGGGAGGGTGG + Intronic
915584434 1:156836611-156836633 CCATGAAAGAGGAGGGAGGAGGG - Intronic
915649705 1:157300817-157300839 GAGTGTAAAGGGTGGGAGGAGGG + Intergenic
915724307 1:158006972-158006994 CAGTGTAAGCAGAGAGAGGAGGG + Intronic
915725501 1:158014208-158014230 GAGAGAAAAAGGAGGGAGGAGGG + Intronic
915795471 1:158728482-158728504 CAGTGAAATATGAGAGAGGAAGG + Intergenic
916472940 1:165141614-165141636 GGGTGGAACAGGAGGAAGGAAGG - Intergenic
916577990 1:166084017-166084039 CAAGGTAACAGGAGGGTAGATGG + Intronic
916839246 1:168583232-168583254 CAGTGTAATATGTGGGATGATGG + Intergenic
917166191 1:172115682-172115704 TGGTGTAACAGGATGGAGGAGGG - Intronic
918025857 1:180745309-180745331 CAGTGGAACAGGAGGGAGGGAGG + Intronic
918044444 1:180933283-180933305 GAGTGTAAGAGGAAGCAGGAAGG + Intronic
918242566 1:182633684-182633706 CAGTGTACCATGGGGGAGGGTGG - Intergenic
918294136 1:183139455-183139477 GAGTGTAAAAGGAGGGAGAAAGG - Intronic
919836146 1:201574818-201574840 CAGTGTCTCAGGTGGAAGGAAGG + Intergenic
920349298 1:205327350-205327372 CTGTGTTAAGGGAGGGAGGAAGG + Intergenic
921157793 1:212451918-212451940 CAGTGCAAGAGGTGGGAGGTGGG - Intergenic
921162513 1:212483260-212483282 GAGGGTCACAGGAGCGAGGAAGG - Intergenic
921446029 1:215248464-215248486 CCCTGTGAAAGGAGGGAGGAAGG + Intergenic
921621872 1:217334301-217334323 CAGTGTATGAGGGGAGAGGAAGG - Intergenic
922018371 1:221676177-221676199 CAGGGTAACAGGTGGTAGGAAGG + Intergenic
922063658 1:222115458-222115480 CATTAGAAAAGGAGGGAGGAAGG - Intergenic
922505994 1:226126008-226126030 GAGAGTAACAGGAGGGAAGGAGG - Intergenic
923274030 1:232381108-232381130 CAGTGGAAGACGAGGGAGTAGGG + Intergenic
924290484 1:242531219-242531241 CACTGAATCAGGAGGGAGGAGGG - Intergenic
924380560 1:243460065-243460087 CATGGTAACAGAAGGGAGAAAGG - Intronic
1063194198 10:3725765-3725787 CAATCTAAAAGGAGGCAGGAAGG - Intergenic
1064755917 10:18571791-18571813 CAGTGTAATGGAATGGAGGATGG - Intronic
1066618551 10:37321017-37321039 CATGGTAACAAAAGGGAGGATGG - Intronic
1067051814 10:43025994-43026016 CAGCCTACCAGGAGGGAGGAAGG + Intergenic
1067051892 10:43026395-43026417 CTGTGTCACTGGAAGGAGGAAGG + Intergenic
1067293495 10:44960945-44960967 CAGAGGAACAGAAGGCAGGATGG - Intronic
1067856601 10:49799057-49799079 CAGTGACAGAAGAGGGAGGAGGG - Intergenic
1068606064 10:59006270-59006292 CTGTGAAGCTGGAGGGAGGAAGG + Intergenic
1068711726 10:60142176-60142198 CTGTATAACAGGAGGGAAGGTGG - Intronic
1068905331 10:62315785-62315807 CAGCGATAGAGGAGGGAGGAGGG + Intergenic
1069333478 10:67321000-67321022 GGGTGGAGCAGGAGGGAGGATGG - Intronic
1069374619 10:67781439-67781461 CAGTGTAAGAGCAGTAAGGAAGG + Intergenic
1069523466 10:69145605-69145627 CAGTGCAGCAGGAGAAAGGATGG - Intronic
1070100513 10:73381778-73381800 CAGAGTAACAGGAGGGCAGTAGG - Intronic
1070756409 10:78996163-78996185 CTGTGTAGCAGGAGGGGGGAGGG - Intergenic
1070854178 10:79593472-79593494 CAGTGTTACAGGAGAGAAGTGGG + Intergenic
1070980844 10:80645678-80645700 CAGAGCAACAGGAGAGAGCAGGG - Exonic
1071895045 10:90057109-90057131 CAGGGGAAAAGGTGGGAGGAAGG + Intergenic
1072277389 10:93836451-93836473 CAGTGTTCCAGAAGGGAGCAAGG - Intergenic
1072528643 10:96297509-96297531 CATTGTAAAAGGAGAGAGGATGG - Intergenic
1072976871 10:100066447-100066469 CAATATTACAGCAGGGAGGAAGG - Intronic
1073771300 10:106738543-106738565 CAGTGTGAGAGGAAGGAGGCTGG + Intronic
1073803719 10:107072127-107072149 CAGGGTAACAGGAAGGAGACAGG + Intronic
1073911221 10:108347054-108347076 GAGGGAAAGAGGAGGGAGGAAGG + Intergenic
1074490183 10:113932969-113932991 CATTGTAACAGGAGACTGGATGG + Intergenic
1075053267 10:119199035-119199057 CTGCATCACAGGAGGGAGGAAGG - Intergenic
1076027774 10:127130443-127130465 CAGTTAAACTGGAGGGAAGAGGG + Intronic
1077031237 11:468896-468918 CTGGGTAATCGGAGGGAGGAGGG + Intronic
1077517505 11:3010715-3010737 CAGTGGAGCAGGAGGCAGGAGGG - Intronic
1077743922 11:4879781-4879803 CTGTGTAAGAGGAGGGATGTAGG + Intronic
1078252262 11:9625947-9625969 CACTGTAACAAGAGGGAAGAAGG - Intergenic
1078662239 11:13296916-13296938 CACTGTCACAGGCAGGAGGACGG - Intronic
1079035361 11:17015070-17015092 ATGTGAAACAGGAGGGAGCAGGG + Intergenic
1079288819 11:19167212-19167234 GAATGTAACAAGAGGGTGGATGG - Intronic
1079310219 11:19358740-19358762 CTGTGTAAGAGGTGGGAAGAGGG - Intronic
1081220567 11:40455319-40455341 CAGGGACACAGGAGTGAGGATGG - Intronic
1081509039 11:43749508-43749530 CAGTGTGAGAGGAAGCAGGAGGG + Intronic
1081773938 11:45665327-45665349 CGGAGGAAGAGGAGGGAGGAGGG - Exonic
1081881379 11:46455826-46455848 CAGTGTCATGGGAGGAAGGAAGG - Intronic
1082196180 11:49308966-49308988 CAGTGTAATGGGAGAGAGAATGG + Intergenic
1082210845 11:49499070-49499092 CAGTGAAACAGGTTGGAGCAGGG - Intergenic
1082868914 11:57925493-57925515 CAGGGCAACAGGTGGAAGGAGGG - Intergenic
1083328812 11:61887365-61887387 AAGGGTAAGAGAAGGGAGGATGG - Intronic
1083764641 11:64836050-64836072 CAGTGTGCCTGGAGGGAGCATGG - Intronic
1083883424 11:65559097-65559119 CAGGCTAACAGCCGGGAGGACGG + Intergenic
1084208855 11:67611691-67611713 AGGTGGAAGAGGAGGGAGGAAGG + Intronic
1084611916 11:70208712-70208734 CTGTGTAACAGAAGGCAGAAGGG - Intergenic
1084951835 11:72670745-72670767 CAGTGACACAGGACGGAGAAAGG + Intronic
1085554207 11:77404667-77404689 CATTGTAACTGGAAGGAAGAAGG - Intronic
1086080825 11:82900909-82900931 CAGTGTATCACGAGGCAGGGAGG + Intronic
1086659645 11:89399241-89399263 CAGTGTAATGGGAGAGAGAATGG - Intronic
1087879371 11:103396965-103396987 CACTGTAAAAGGTGGGAGGTGGG + Intronic
1087963944 11:104389344-104389366 CAGTGGAACAGGATGAAGCAGGG + Intergenic
1088735329 11:112723738-112723760 AAGGGTAAGGGGAGGGAGGATGG + Intergenic
1089027685 11:115288936-115288958 TACAGGAACAGGAGGGAGGAGGG - Intronic
1089288916 11:117425980-117426002 CAGTGGAACAGCAGGTAGTATGG + Intergenic
1089708035 11:120294734-120294756 GAGTTCAACAGGAAGGAGGAAGG - Intronic
1089974880 11:122723811-122723833 CATTGTAATAGGAAGGAGGCAGG + Intronic
1090458009 11:126866480-126866502 CAGTGAAATAGGAGGGGGGCCGG + Intronic
1090719488 11:129458812-129458834 GAGTGGAAAAGGAGGCAGGAAGG - Intergenic
1090937257 11:131354169-131354191 CAGTGTTACGGGAGAGAAGAGGG - Intergenic
1091075180 11:132608857-132608879 CAGTGGAGCAGGAGGAAGCAAGG - Intronic
1091847805 12:3670764-3670786 CACTGAAATAGGAGGCAGGAAGG - Intronic
1092285638 12:7127945-7127967 CAGTGTCACAGGCTGGAGGGTGG + Intronic
1092596911 12:10016946-10016968 GAGTGAAACAGGAGGGAGGGGGG - Intronic
1095292612 12:40492814-40492836 CACTGCCATAGGAGGGAGGATGG - Intronic
1095797665 12:46237967-46237989 CATTATAACCAGAGGGAGGAGGG + Intronic
1095968139 12:47883091-47883113 CAGGGTGTCAGGAGGGAGGAAGG + Intronic
1096586531 12:52625999-52626021 CAGTGTCACAGGAGAGAAGTGGG + Intergenic
1096647868 12:53048052-53048074 GAATGTTACAGGCGGGAGGAGGG + Intronic
1096789695 12:54037091-54037113 GATTGTGACAGGAAGGAGGAGGG - Intronic
1096859971 12:54518729-54518751 CAAGGTAACTGGAGGGAGGTGGG + Exonic
1097009337 12:55941125-55941147 GAGGGAAACAGGAGGGAGGGGGG + Intronic
1097194423 12:57235810-57235832 CTGTGGAGCAGGAGGGGGGAGGG + Intronic
1097298188 12:57989753-57989775 CAGTGTAACAGGCAGGAAGATGG + Intergenic
1097625425 12:61994294-61994316 CAGTGTATCAAGAGAGAAGAAGG - Intronic
1098050642 12:66448948-66448970 CAGAGAAACAGGAGAGTGGATGG - Intronic
1098095051 12:66946001-66946023 CTGTGTAGCAGGAAGAAGGAAGG - Intergenic
1100337941 12:93650168-93650190 CAGGGTAGCGGGAGGGAGGGAGG - Intergenic
1100682887 12:96948219-96948241 AAGTGTAACAGGAGGGCTGAGGG - Intronic
1101816589 12:108150627-108150649 CAGTGACACAGGAGAGAGGCAGG + Intronic
1102190036 12:110980842-110980864 TAGAGAGACAGGAGGGAGGACGG + Intergenic
1102599207 12:114016239-114016261 CAGGAGAACAGGAGGGAAGAGGG + Intergenic
1102677740 12:114669520-114669542 CTGTGTCACGCGAGGGAGGAGGG - Intergenic
1103339163 12:120212097-120212119 GAGAGCTACAGGAGGGAGGAGGG + Exonic
1104537084 12:129628353-129628375 CAATGTCACAGGAGGCAGGAGGG + Intronic
1104603458 12:130169461-130169483 CAGGGACAGAGGAGGGAGGAGGG + Intergenic
1104659054 12:130596059-130596081 CTGTGTAACATCAGGGACGATGG - Intronic
1104984097 12:132587010-132587032 CAGTGCGGCTGGAGGGAGGACGG + Intergenic
1104984121 12:132587097-132587119 CAGTGCAGCTGGAGGGAGGGCGG + Intergenic
1104984126 12:132587120-132587142 CAGTGCAGCTGGAGGGTGGACGG + Intergenic
1104984147 12:132587208-132587230 CAGTGCAGCTGGAGGGAGGGTGG + Intergenic
1104984177 12:132587341-132587363 CAGTGCAGCTGGAGGGAGGACGG + Intergenic
1104984183 12:132587364-132587386 CAGTGCAGCTGGAGGGAGGGTGG + Intergenic
1104984188 12:132587387-132587409 CAGTGCAGCTGGAGGGAGGACGG + Intergenic
1104984192 12:132587410-132587432 CAGTGCAGCTGAAGGGAGGACGG + Intergenic
1104984198 12:132587433-132587455 CAGTGCGGCTGGAGGGAGGACGG + Intergenic
1104984204 12:132587456-132587478 CAGTGCGGCTGGAGGGAGGACGG + Intergenic
1105663042 13:22520619-22520641 CAATATAACAGAAGGCAGGAGGG + Intergenic
1105785763 13:23747517-23747539 CACCGTGACAGGAAGGAGGAAGG + Intronic
1106121770 13:26865666-26865688 CACTGGAGCAGGAGGGAGCAAGG - Intergenic
1106232038 13:27827967-27827989 TGGTGTGACAGGAGGGAGGCAGG - Intergenic
1106306293 13:28514210-28514232 CACTGTAACAGAAGTGAAGAAGG - Intergenic
1106320614 13:28634442-28634464 TAGTGGAAAAGGAGGAAGGAAGG + Intergenic
1106495768 13:30272980-30273002 CAGAGTCACAGTAGGGAGGCAGG - Intronic
1107471644 13:40696715-40696737 CAGTGTAAAAGGGGAGAGGGGGG - Intergenic
1107584911 13:41835081-41835103 GAGGGTGAGAGGAGGGAGGAGGG + Intronic
1108791442 13:53973274-53973296 CACTGGAACAGGAGTGAGGATGG + Intergenic
1109374818 13:61478603-61478625 GAGGGTAAAGGGAGGGAGGAAGG - Intergenic
1112401679 13:99084204-99084226 CAGAGTACCAGGAAGGAGGTGGG + Intronic
1113924334 13:113931950-113931972 CAGAGGAGCAGGAGGGTGGAGGG - Intergenic
1114586935 14:23824216-23824238 CAGTGTAAGAGGAAGTGGGAGGG - Intergenic
1114673324 14:24425441-24425463 CAGCCTAACAGGAAGGAGGAAGG - Intergenic
1115682137 14:35752612-35752634 CAGTCTGAGAGGAGTGAGGAGGG + Intronic
1115730374 14:36262266-36262288 CAAGGCAACAGGAAGGAGGAGGG + Intergenic
1115915416 14:38307130-38307152 CAGGGTGAAGGGAGGGAGGAGGG + Intergenic
1115946217 14:38664192-38664214 CAGTGAAATAGAAGGAAGGAGGG + Intergenic
1115968479 14:38918325-38918347 CAGAGGAAAAGGAGGAAGGAAGG + Intergenic
1117448438 14:55827448-55827470 CAGTGTAACGGGTGGATGGAAGG - Intergenic
1117722732 14:58643279-58643301 CAATGTAACAGGACTAAGGAAGG - Intronic
1118338642 14:64877067-64877089 CAGTGTGATAGGACAGAGGATGG - Intronic
1120452203 14:84682693-84682715 CAGTGTGGAAGGTGGGAGGAGGG - Intergenic
1122775794 14:104116585-104116607 AAGTGAAACTGGAGGGAGGGAGG - Intergenic
1123033270 14:105461117-105461139 CAGTGTGACAGGAAGGACTATGG - Intronic
1123036081 14:105472522-105472544 CAGTGTCACAGGATGGCGGAAGG + Intergenic
1124012806 15:25852261-25852283 GCATTTAACAGGAGGGAGGATGG - Intronic
1124201402 15:27681461-27681483 CAGTGCAGCGGGTGGGAGGAGGG - Intergenic
1124781830 15:32643140-32643162 AAGTCTAACAGGAGGGAGTCAGG - Intronic
1124866710 15:33499305-33499327 AAGAGTGGCAGGAGGGAGGAGGG - Intronic
1125103488 15:35943197-35943219 CAGTTTATCAGCAGGAAGGACGG + Intergenic
1125637979 15:41205259-41205281 CATTGGAACAGGAGGGTAGAGGG + Intronic
1126725610 15:51628606-51628628 TAGGGAAACAGGATGGAGGAAGG - Intergenic
1127404385 15:58625974-58625996 CAGGGTAGCAGGGGGGAGGAAGG + Intronic
1127588878 15:60402854-60402876 CAGGAAAACAGGATGGAGGAAGG - Intronic
1128106795 15:65051335-65051357 CAGTCTAACAGGTGGGAGGGTGG - Intronic
1128593741 15:68926266-68926288 CATTCTAACTGGAGGGATGATGG + Intronic
1128846424 15:70901105-70901127 CTGGGGAACAGGAGGAAGGAGGG - Intronic
1129332938 15:74837058-74837080 CAGAGTAACCTGAGGGAGGCTGG + Exonic
1131432769 15:92400100-92400122 CAGGGCAACAGCAGGAAGGATGG - Intronic
1132010445 15:98270999-98271021 CAGAATAGCAGGAGGGAGGCAGG + Intergenic
1132233444 15:100201334-100201356 CAGTGCAGCAGGAGAGAGGGGGG - Intronic
1133656661 16:7871557-7871579 CACTTTAACAGGCAGGAGGACGG + Intergenic
1133684726 16:8155264-8155286 CACTGTCAGAGGTGGGAGGAAGG - Intergenic
1133957773 16:10460521-10460543 CAGTGTAACAGTAGAGAGTCCGG + Intronic
1136471065 16:30480583-30480605 CAGTGTTACATGAGGGAGCAAGG + Intronic
1138976899 16:62218639-62218661 AAGTGGAAAATGAGGGAGGAAGG - Intergenic
1139154490 16:64424035-64424057 AAGTGAAACAGGGAGGAGGAAGG - Intergenic
1139397794 16:66654361-66654383 CCATGTGACAGGAGGCAGGATGG - Intronic
1139595931 16:67958302-67958324 AAGTTTAACAGAAGAGAGGAAGG - Intronic
1140107379 16:71973176-71973198 CTGGGCAAAAGGAGGGAGGAGGG - Intronic
1140514732 16:75533712-75533734 CTGTGTAAAAGGAGAGAGAAAGG + Intronic
1140953962 16:79845311-79845333 CAGTGCAGCAGGAAGGAGGTCGG + Intergenic
1141552264 16:84813916-84813938 CAGAGTAACAGGAGGGAATATGG + Intergenic
1141564322 16:84891270-84891292 CCGTGTCCCAGGAGGCAGGAAGG - Intronic
1142229979 16:88895565-88895587 CAGTGGCACAGGGGGGAGGCCGG + Intronic
1142284373 16:89165743-89165765 CACTGTGACAGGAGGGAGGGAGG - Intergenic
1203141176 16_KI270728v1_random:1767805-1767827 CTGTGTTACTGGTGGGAGGAGGG + Intergenic
1143267682 17:5652718-5652740 CAGTATATGGGGAGGGAGGAAGG + Intergenic
1144182028 17:12761491-12761513 CATTGTAGCAAGAGGGAAGAAGG + Intronic
1144206126 17:12980638-12980660 CAGGGTGACAGGAGGGAGTCAGG + Intronic
1145924938 17:28639787-28639809 CAGTGTAACTGGGGAGTGGAAGG - Intronic
1146411501 17:32589526-32589548 AAGTGTGACAGGGGAGAGGAAGG + Intronic
1146426122 17:32740952-32740974 CTGTGTAAATGAAGGGAGGAAGG - Intronic
1146954736 17:36930953-36930975 GAGAGAAAAAGGAGGGAGGAAGG - Intergenic
1147627292 17:41908354-41908376 GAGTGTACCAGGAGGAATGAAGG + Intronic
1147721009 17:42539361-42539383 CAGAGGAACAGGAGGGACAAGGG - Intronic
1147766802 17:42842362-42842384 TACAGTATCAGGAGGGAGGACGG - Exonic
1148083604 17:44980858-44980880 CAGTGTCACAGTAGAGAGCAGGG + Intergenic
1148571982 17:48677685-48677707 CTGTGAAAAAGGAGGGAGGGAGG - Intergenic
1148887822 17:50786463-50786485 CAGGGTAGGAGGAGGGAGGATGG + Intergenic
1149865214 17:60147835-60147857 CAGAGTAAGAGGAAGGAGGCTGG + Intergenic
1150130468 17:62666299-62666321 CAGTGTTCCTGGAGGGAGGCTGG + Intronic
1150781623 17:68127615-68127637 CAGAGTATCAGGAGGGAACAGGG - Intergenic
1150888425 17:69114753-69114775 AAGTGGAACAAGAGGTAGGAGGG - Exonic
1151118734 17:71768243-71768265 TAGTGTAACAGTTGGGAAGAGGG - Intergenic
1151360579 17:73586269-73586291 AAGAGCAACAGGAGGGAGGGAGG - Intronic
1151366742 17:73622528-73622550 CAGTGTTTGAGGAGGGAGGGAGG + Intronic
1151471158 17:74318700-74318722 CAGTGTGACCGGAGTGAGTAAGG + Intergenic
1152095374 17:78269089-78269111 AGATGTTACAGGAGGGAGGACGG + Intergenic
1152126412 17:78450017-78450039 CAGGGGAAGAGCAGGGAGGAGGG + Intronic
1152790040 17:82273810-82273832 CGGGGTAACAGGAGGGCAGAGGG - Intergenic
1153250643 18:3118262-3118284 CAGGGTGTCAGGAGGGTGGAGGG + Intronic
1154158572 18:11962793-11962815 CAGTGCAAGAGGAGGGATAAAGG - Intergenic
1154958714 18:21286371-21286393 GATTCTAACAGGAAGGAGGAGGG + Intronic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1156482409 18:37444664-37444686 CAGTTTCAGAGGAGGAAGGAGGG + Intronic
1156918566 18:42490584-42490606 CAGGGCAACAGGAGGTAGAAAGG - Intergenic
1157172283 18:45418885-45418907 CAGTGTCAGAGGAGGGGAGAGGG + Intronic
1157294008 18:46428994-46429016 CAGTGTGACAGAGGGAAGGAGGG - Intronic
1157784698 18:50471057-50471079 CAGGGTAGCTGGAGTGAGGATGG - Intergenic
1158530886 18:58259701-58259723 TAATGTAAACGGAGGGAGGAGGG + Intronic
1158748932 18:60236173-60236195 CAGGGTAACAACAGTGAGGATGG - Intergenic
1158886135 18:61829210-61829232 CACTGTAAGGGGAGGCAGGAAGG + Intronic
1159014198 18:63088408-63088430 CTGGGTAACAGGAGGCTGGAGGG - Intergenic
1159594944 18:70373913-70373935 CAGTGAATCAGGAAGAAGGAAGG - Intergenic
1159804706 18:72941904-72941926 CAGTGTGACGGGAAGGAGGCAGG + Intergenic
1160115751 18:76077860-76077882 CAGTGTAACAGGAGGAAGAGTGG + Intergenic
1160625322 18:80200576-80200598 CACTGTAACATGACAGAGGAAGG + Intronic
1162512911 19:11130547-11130569 CAGAGGGCCAGGAGGGAGGAAGG + Intronic
1162705522 19:12551916-12551938 CAGTGTAACAGGAGGGAGGAGGG + Intronic
1163779710 19:19239922-19239944 CAGAGGAATGGGAGGGAGGAAGG - Intronic
1164520190 19:28973187-28973209 CAGTGACACCAGAGGGAGGAGGG + Intergenic
1164631734 19:29766269-29766291 GAGTGTCACTGCAGGGAGGAGGG - Intergenic
1165349832 19:35269419-35269441 CAGGGGCACAGGAGGGAGCAGGG - Intronic
1166423637 19:42656986-42657008 CAGAGTCACAGGAGGTGGGATGG - Intronic
1166990536 19:46690078-46690100 CAGGGTTGCAGGAGGGAGGAGGG + Intronic
1167253006 19:48410852-48410874 CTGGGTAGCGGGAGGGAGGAAGG + Intronic
1167696904 19:51020094-51020116 CTGTGGAAGAGGAAGGAGGAAGG + Intronic
1168266287 19:55225407-55225429 AAGTGTAGCAGGAGGGACGGGGG - Intergenic
1168701197 19:58440560-58440582 CATGGAAACAGGAGCGAGGAAGG + Intergenic
926197600 2:10773139-10773161 CTGTGTGTCAGGAGGGATGAAGG + Intronic
926212384 2:10880462-10880484 CGGGGACACAGGAGGGAGGAGGG + Intergenic
926285078 2:11482274-11482296 CCCCGTAAGAGGAGGGAGGACGG + Intergenic
926429152 2:12768089-12768111 GAGAGCAAAAGGAGGGAGGAAGG + Intergenic
926447810 2:12965556-12965578 CAGGGTAGCTGGAGGGAAGATGG - Intergenic
926580608 2:14630135-14630157 CATTGTAAAAGCAGGCAGGATGG + Intergenic
926938628 2:18112764-18112786 CAAGGTATCAGGAGAGAGGAGGG + Intronic
927338490 2:21952845-21952867 CAGTGTAACATGAGCTGGGAGGG + Intergenic
927464746 2:23328747-23328769 CAGTGAAACCAGAGGGAGGCAGG - Intergenic
928373010 2:30754794-30754816 TAGGGTAACAGCAGGAAGGATGG - Intronic
928623971 2:33120322-33120344 GAGGGTAAAAGGAGGGAGAAGGG - Intronic
929399466 2:41563282-41563304 CAGAGTAAAGGGAGAGAGGATGG - Intergenic
929961085 2:46496798-46496820 CAGTGTGACAGGAGGAGGGCAGG + Intronic
931216288 2:60248023-60248045 AAGTGTTAGAGGAGGAAGGAAGG + Intergenic
931700917 2:64908364-64908386 TAATGTACCAGGAGGGAGAATGG + Intergenic
931748095 2:65308134-65308156 CAGGGCAGCAGCAGGGAGGAAGG + Intergenic
932807048 2:74793295-74793317 CTGTCTAACAGGAGGGTGGGTGG + Intergenic
933242282 2:79935475-79935497 CAGTGTAACAGGAGAGTGTGGGG - Intronic
934946048 2:98542813-98542835 CAGGGTAACAGAAGGGGGAAGGG - Intronic
936241321 2:110790830-110790852 CAGTGGAACAGCTTGGAGGAGGG - Intronic
936488323 2:112946579-112946601 CAGTGTAGCAAGAGGGAGGGAGG - Intergenic
937290754 2:120780402-120780424 CAGTGTGAAAGGAGGAAGGGAGG + Intronic
937539507 2:122931259-122931281 CAGTGAAAAAGGAGGGCAGAAGG + Intergenic
938643884 2:133311379-133311401 CAGTGTGCCAGGAGAGAGCATGG - Intronic
938764373 2:134450584-134450606 CAGTCTAAGAGGAGGGTGGGGGG + Exonic
940596040 2:155794803-155794825 CAGGGAAGCAGGAGAGAGGATGG + Intergenic
940834066 2:158500912-158500934 CAGAGTAAAAGCAGGGAGGCTGG - Intronic
941336041 2:164245073-164245095 AAGGGAAACAGGAGGAAGGAAGG - Intergenic
941615722 2:167716266-167716288 AAGTGTAACAGGGGGGCCGAGGG - Intergenic
942455587 2:176136284-176136306 CAGAGAAAGAGAAGGGAGGAAGG + Intergenic
942571867 2:177323175-177323197 CAGTGGAGGAGGAGGGAGCAGGG - Intronic
943297730 2:186159970-186159992 CATGGTAACAGGAGGGTGGGGGG - Intergenic
943430589 2:187796200-187796222 AAGTGTACCAAGAGGGATGATGG + Intergenic
944323131 2:198372148-198372170 CAGTGCAACATGAGGCAGAAGGG - Intronic
944503311 2:200383965-200383987 CAATCAAACAGGAGGGAGAAAGG + Intronic
945653298 2:212591842-212591864 CAGGGTACCTTGAGGGAGGAGGG - Intergenic
946391543 2:219419408-219419430 CAGTGTAGCCAGAGGGAGAAGGG + Intronic
946426644 2:219601959-219601981 CAAGGAAAGAGGAGGGAGGAAGG - Intronic
947093264 2:226537514-226537536 AAGTGGAACAGAATGGAGGAGGG - Intergenic
947634636 2:231673730-231673752 CAGGGAAGCAGGAGGGAGGTGGG - Intergenic
948684518 2:239661929-239661951 CAGTGTATCAGGAAGGAGGGCGG - Intergenic
948685287 2:239666099-239666121 TAATGTGACAGGATGGAGGATGG - Intergenic
948770741 2:240250254-240250276 CAGTGTCTCAGGAGGTGGGAAGG - Intergenic
1168792708 20:590622-590644 CAGTGTGATTGGAGAGAGGATGG + Intergenic
1169071978 20:2738381-2738403 TAGAGAAAAAGGAGGGAGGAGGG - Intronic
1169948599 20:11016166-11016188 TAGTATAACAGAAGGGAAGAAGG - Intergenic
1170148837 20:13206562-13206584 TGGTGAGACAGGAGGGAGGAAGG + Intergenic
1170407362 20:16052435-16052457 AAGAGTTACAGGAGGGAGGGAGG + Exonic
1170587528 20:17745944-17745966 CAGTGCAACAGGAAGCAAGATGG + Intergenic
1171256635 20:23693566-23693588 CAGGGCCACAGGAGGGAGCAGGG - Intergenic
1171263987 20:23755497-23755519 CAGGGCCACAGGAGGGAGCAGGG - Intergenic
1171273179 20:23832341-23832363 CAGGGCGACAGGAGGGAGCAGGG - Intergenic
1171396223 20:24835464-24835486 CAGTGAGACAGGAGAGAGGTTGG + Intergenic
1172626338 20:36349602-36349624 CAGAGAAACAGGAAGGAGGCCGG + Intronic
1172643366 20:36455147-36455169 CAGAGTAAGAGGAGGGAGGGAGG - Intronic
1172747351 20:37222238-37222260 CAGTGGAGGAGGAGGGACGATGG - Intronic
1173001995 20:39111497-39111519 CAGTGGAGCAGGAGGAAGAAGGG + Intergenic
1173003610 20:39123199-39123221 GAGTGTAAGGGGAGGGAGGCAGG + Intergenic
1173349753 20:42233927-42233949 CAGTGTGAAAGGACAGAGGATGG - Intronic
1173650915 20:44663511-44663533 CAGTCTTCCAGGATGGAGGATGG + Intergenic
1173915502 20:46705376-46705398 AAGTTTAGCAGGAGTGAGGAGGG - Intergenic
1174103101 20:48142201-48142223 CTGTGTATGAGGAGGGAGGAGGG - Intergenic
1174276577 20:49408700-49408722 CAATGTCACACGAGGGAGGATGG + Intronic
1175211084 20:57355771-57355793 TAGGAGAACAGGAGGGAGGATGG + Intronic
1175315200 20:58042411-58042433 GAGTGAAGCAGGAGAGAGGAGGG - Intergenic
1175555219 20:59848108-59848130 CAGTATACCAGGAGGGAAGGAGG - Intergenic
1175604151 20:60298781-60298803 CAGTGCAACAGGTGGGGGAAAGG + Intergenic
1175757400 20:61538488-61538510 CAGAGTAGGAGGAGAGAGGAGGG - Intronic
1176871252 21:14084556-14084578 GGGGGCAACAGGAGGGAGGAAGG + Intergenic
1177844115 21:26268475-26268497 CAGTGATACAGGAGGGAGATAGG - Intergenic
1178417462 21:32415367-32415389 CTGTGAAGGAGGAGGGAGGATGG + Intronic
1178717222 21:34976609-34976631 CTGCGTCACAGAAGGGAGGACGG + Intronic
1179242583 21:39605182-39605204 AAGTCTAACAGGCAGGAGGAGGG + Exonic
1181382868 22:22520856-22520878 TAGTGAAGGAGGAGGGAGGAGGG - Intergenic
1181890963 22:26063076-26063098 CGGTGTAACAGCAGAGAAGATGG - Intergenic
1183467670 22:37987819-37987841 CAGGGAAACTGGAGGTAGGAGGG - Intronic
1183687468 22:39369477-39369499 CAGAGGACCAGCAGGGAGGAAGG - Intronic
1184839391 22:47043668-47043690 CAGCTGAACAGGAGGGTGGAAGG + Intronic
1185093039 22:48786529-48786551 CAAGGTCCCAGGAGGGAGGAGGG + Intronic
949880049 3:8654495-8654517 CAGTGTAACTGCAGGGAAGTAGG - Intronic
950114379 3:10441155-10441177 CAGTGTAGCCAGGGGGAGGAAGG - Intronic
950406105 3:12805967-12805989 CAGTGCTATAGGAGGTAGGATGG + Intronic
950989860 3:17421968-17421990 AAGTAGAAGAGGAGGGAGGAAGG - Intronic
951508655 3:23477927-23477949 CAGAGTGACAGGAGAGAGAAGGG - Intronic
951786039 3:26420245-26420267 CAGTGTACCAGTTGAGAGGATGG + Intergenic
952190985 3:31023474-31023496 CAGTGGAACAGGAGGAAGGGAGG - Intergenic
952486644 3:33818424-33818446 CAGTGTGGCAGGAGAGAGCAAGG - Intronic
953203356 3:40797843-40797865 CTGAGTAGCAGGAGGGTGGATGG + Intergenic
953354751 3:42246234-42246256 GCTTCTAACAGGAGGGAGGAAGG - Intergenic
953616806 3:44497964-44497986 CAGTGTAATGGGAGGGAGACGGG + Intergenic
953767748 3:45756948-45756970 CAGGGCAACAGGTGGGAAGAAGG + Exonic
954671093 3:52291771-52291793 CAGTGTGACAGGTGGGATGGGGG - Exonic
958755748 3:98247706-98247728 CTGTGTAACAGCAGGAAGAAAGG - Intergenic
959133185 3:102383805-102383827 CACTGTAACAGGAGTCAAGAAGG + Intronic
960884729 3:122382977-122382999 CTCTGTAGGAGGAGGGAGGAGGG - Intronic
960934392 3:122888615-122888637 CAGTGTATTAGGATGGAGGCGGG - Intergenic
961601251 3:128063902-128063924 CAGAGTAACAAGTGAGAGGAAGG - Intronic
961649634 3:128410926-128410948 CAGAGGCACAGAAGGGAGGAGGG + Intergenic
961721130 3:128896968-128896990 AAGTGAAGCAGGATGGAGGATGG - Intronic
962318970 3:134375521-134375543 CAGGGTAAGTGGAGAGAGGAGGG - Intergenic
962344640 3:134610260-134610282 CTGTGTACCTGGAGGGAAGATGG - Exonic
964979680 3:162664521-162664543 GAGTGTAGGAGGTGGGAGGAGGG + Intergenic
966242166 3:177766738-177766760 CAGAGGAACAGGAGAGAGTATGG - Intergenic
966997292 3:185295546-185295568 AAGAGGAACAGGAGAGAGGAGGG - Intronic
967090610 3:186131738-186131760 CAGTGTAACGGAAAGTAGGAAGG + Intronic
967566399 3:190978749-190978771 CAGGGCAACAGGAGAGAGGTTGG - Intergenic
967972999 3:195012875-195012897 CAGTGGGAGAGGATGGAGGAGGG + Intergenic
969519289 4:7666450-7666472 CAGGGTGGGAGGAGGGAGGAAGG - Intronic
970683811 4:18542500-18542522 CAGTGTAGCAGGGGAGCGGAGGG - Intergenic
970822881 4:20239433-20239455 CATTGTACCAGGAGGGAAGAGGG + Intergenic
971833956 4:31737434-31737456 GAATGTAGCATGAGGGAGGAGGG - Intergenic
972489356 4:39572384-39572406 CACTGAGACAGGAGGAAGGATGG - Intronic
973375541 4:49284297-49284319 GAGAGTAATAGGAGGAAGGAAGG + Intergenic
973381870 4:49325944-49325966 GAGAGTAATAGGAGGAAGGAAGG - Intergenic
974165384 4:58195270-58195292 CAGTGTTACAGGAAGATGGATGG + Intergenic
974557886 4:63475440-63475462 CAGTGATGCAGGAGGGAGAAAGG - Intergenic
974660973 4:64888406-64888428 CAGTGGGACTGGAGGCAGGAGGG + Intergenic
977658207 4:99549209-99549231 CAGTCTGTCAGGATGGAGGAAGG - Exonic
978384516 4:108167056-108167078 CAGAGCCACAGGCGGGAGGAAGG - Intronic
978829537 4:113067509-113067531 AAGTGTAACACTTGGGAGGAAGG + Intronic
980762735 4:137256941-137256963 CAGTATATCAGGAAGGAAGATGG + Intergenic
981027140 4:140088201-140088223 AAGTGTGATGGGAGGGAGGAAGG + Intronic
981674062 4:147320678-147320700 CACTGTCACAGGAAGGAAGAAGG - Intergenic
981809484 4:148757636-148757658 CCCTGTCACAGGAGGGAGCATGG + Intergenic
982455123 4:155600487-155600509 CTGAGTAACAGGAGAGATGATGG + Intergenic
984595118 4:181657978-181658000 GACTCTAAAAGGAGGGAGGAAGG + Intergenic
984935180 4:184883474-184883496 TAAAGGAACAGGAGGGAGGAGGG + Intergenic
985054621 4:186025590-186025612 GAGTGTGAGAGGAGGGTGGATGG + Intergenic
985659136 5:1147200-1147222 CACGGTGACAGAAGGGAGGAGGG + Intergenic
985955434 5:3262166-3262188 CAGGGCAACAGGAGGGAGAAGGG - Intergenic
987946371 5:24614398-24614420 CATTGGATCAGGAGGGAGCATGG - Intronic
988934299 5:36066953-36066975 CAATGGAGCACGAGGGAGGAGGG - Intronic
989063987 5:37441136-37441158 AATTGTAACAGGAGGGAAGAAGG + Intronic
989225542 5:39023766-39023788 CAGTATAACAGAATGGAGTAAGG - Intronic
990303252 5:54470238-54470260 CATTGGAAAATGAGGGAGGAAGG - Intergenic
990786031 5:59420883-59420905 CAGGGTAGCAGGGGGCAGGAGGG + Intronic
991257352 5:64629742-64629764 GAGCCTGACAGGAGGGAGGAGGG + Intergenic
991693157 5:69245270-69245292 GAGGGGAAAAGGAGGGAGGACGG - Intronic
992868009 5:80977166-80977188 CAGGTAAACAGGAAGGAGGATGG - Intronic
994417797 5:99496966-99496988 AATTGTAACAGGAGGGAAGAAGG + Intergenic
994462168 5:100078190-100078212 AATTGTAACAGGAGGGAAGAAGG - Intergenic
995508800 5:112887205-112887227 ATGGGTAACAGGAGGGTGGAGGG + Intronic
995782962 5:115797358-115797380 CCGTGTAACAGGAGACAGGTGGG - Intergenic
995974234 5:118011630-118011652 GAATGTAACAGGAGGCAGGCAGG + Intergenic
996318249 5:122185552-122185574 GAGTGTGAAAGGAGGCAGGAGGG - Intergenic
998494462 5:142575498-142575520 CAGAGGAAGAGGAGAGAGGAGGG - Intergenic
999361337 5:150989024-150989046 CTGTCTAACCGGATGGAGGAGGG + Intergenic
1000537309 5:162494454-162494476 CACTGTAAATGGAGGGAGGGAGG + Intergenic
1001027307 5:168235010-168235032 CAGTGACAGAGGAGGGAGGTGGG + Intronic
1001854119 5:174995866-174995888 CACTGTCACAGGAGGGAGGGAGG + Intergenic
1002863048 6:1096916-1096938 TAATGTAAAGGGAGGGAGGAAGG + Intergenic
1003025728 6:2553982-2554004 CCGTGTAGCAGTAGGGATGAGGG - Intergenic
1004880477 6:20002546-20002568 AAGTGTAACTGAAAGGAGGATGG + Intergenic
1005440682 6:25864527-25864549 CAGTTTTACAGGTGGGTGGAAGG + Intronic
1006527376 6:34618561-34618583 CCATGGAACAGGAAGGAGGAGGG - Intronic
1006806446 6:36792538-36792560 ATGTGTCACGGGAGGGAGGAAGG + Intronic
1008824785 6:55680731-55680753 CAGTTTCACAGGAGGAAGGCAGG + Intergenic
1008870350 6:56265454-56265476 AAGTGGAATAGGAGGAAGGACGG - Intronic
1009006287 6:57792651-57792673 GAGTGGAAAAGAAGGGAGGATGG + Intergenic
1011525815 6:88263767-88263789 CAGGGCAGAAGGAGGGAGGAGGG + Intergenic
1012305903 6:97656823-97656845 CTATGTAACAGGAGGGAAGGAGG + Intergenic
1013813238 6:114067741-114067763 CAGTGTCACAGTAGATAGGAAGG - Intronic
1014848727 6:126313507-126313529 CAGTGTCAGAGGAGGGAAGAGGG - Intergenic
1016045843 6:139479635-139479657 CAGAGTGTCAGGATGGAGGAGGG + Intergenic
1016070234 6:139730078-139730100 GATTCCAACAGGAGGGAGGATGG - Intergenic
1016154188 6:140783278-140783300 GAGTGTAACAAGAGGGAAGGAGG + Intergenic
1016751420 6:147634447-147634469 CAGTGTTGGAGGAGGGAGGAGGG - Intronic
1017097543 6:150817926-150817948 CTGTGAAAGAGGAGGGAGGGAGG - Intronic
1017484012 6:154886088-154886110 CAGTGGTCCAGGAGGCAGGAAGG + Intronic
1017729861 6:157305734-157305756 CAGTGTTTCAGGATGGAGGGGGG + Intronic
1017834491 6:158164915-158164937 CATTCTAGCAAGAGGGAGGAGGG - Intronic
1017929302 6:158938494-158938516 CAGGTGAAAAGGAGGGAGGAAGG + Intergenic
1019142899 6:169959503-169959525 CAGGGGGAGAGGAGGGAGGAGGG - Intergenic
1019664788 7:2246403-2246425 GAGTGTGGAAGGAGGGAGGAAGG + Intronic
1020334371 7:7051342-7051364 AAGTGTGGCAAGAGGGAGGAGGG + Intergenic
1020739487 7:11995939-11995961 CAATACAAGAGGAGGGAGGAAGG - Intergenic
1022120751 7:27305844-27305866 CAGGGTAACTGTTGGGAGGAGGG - Intergenic
1022344782 7:29503614-29503636 CATGGTCACAGGAGGGATGAGGG + Intronic
1022533111 7:31079262-31079284 GAGTGTCACAGGAGGCAGGGTGG + Intronic
1023121800 7:36916715-36916737 CAGTGTAAGAGGAATGAGGGTGG - Intronic
1023856305 7:44186174-44186196 CAGGGCAGCTGGAGGGAGGAAGG + Intronic
1023869531 7:44255585-44255607 CAGTGGAGCAGGCGGGGGGATGG - Intronic
1024777323 7:52802649-52802671 CAGTGGAATAGGAGAGAAGATGG - Intergenic
1026154443 7:67814874-67814896 CAGTGCACCAGGAGGGAGACTGG - Intergenic
1026209591 7:68292095-68292117 GAGGGTAGCAGGTGGGAGGAGGG + Intergenic
1027176566 7:75907674-75907696 CAGAGAAACAGGAGGGGGGGTGG - Intronic
1029652532 7:101903270-101903292 CACTTTAACAGGAGGCAAGATGG + Intronic
1031359926 7:120836984-120837006 CAGAGTAAAAGTTGGGAGGAGGG + Intronic
1031464941 7:122097514-122097536 AAGGGTAAAAGGTGGGAGGAGGG - Intronic
1031924602 7:127627567-127627589 CAGAGTTACAGCAGGGAGGATGG - Intergenic
1032108799 7:129057082-129057104 CAGTGTAAGAAGGGAGAGGATGG - Intergenic
1032189031 7:129752265-129752287 CAGTGTAAAAGGAAGGAGTGGGG + Intronic
1032495161 7:132355861-132355883 AAGTGTACGAGGAGGTAGGAAGG + Intronic
1033150854 7:138913926-138913948 GAGGGAGACAGGAGGGAGGAGGG + Intronic
1034228704 7:149502146-149502168 GAGTGATACAGGAGGGAGGCAGG - Intergenic
1034333368 7:150303255-150303277 CTGTGTTCCAGGAAGGAGGAGGG - Intronic
1034664675 7:152806632-152806654 CTGTGTTCCAGGAAGGAGGAGGG + Intronic
1035651537 8:1269420-1269442 AAGTGTTACAGGAAGGTGGATGG - Intergenic
1036074110 8:5475673-5475695 CAGTGTAACAGGAGGTGGGTAGG - Intergenic
1036630533 8:10511147-10511169 CCGTGTAGGAGGTGGGAGGAGGG - Intergenic
1036806291 8:11836557-11836579 AAGTGAAACAGAAGGCAGGAAGG - Intronic
1037312986 8:17576225-17576247 CAAAGCAACAGAAGGGAGGAAGG + Intergenic
1038119321 8:24594267-24594289 TAGGGTATCAGCAGGGAGGATGG + Intergenic
1038154520 8:24976044-24976066 CAGGGTAGCAGGAGAGAGAATGG - Intergenic
1038332042 8:26616735-26616757 CCGTGGAGCAGGAGGGAAGAGGG - Intronic
1039549312 8:38431319-38431341 CAGTGTGACAGGTGCCAGGAGGG - Intronic
1039587515 8:38719580-38719602 GACTGTAAAGGGAGGGAGGAGGG - Intergenic
1040280588 8:46039860-46039882 GGGGGCAACAGGAGGGAGGAAGG + Intergenic
1040539550 8:48340040-48340062 GAGGGTGACAGGTGGGAGGAGGG - Intergenic
1041143641 8:54848087-54848109 AACTGCAACAGGAGGGAGAAGGG - Intergenic
1041261909 8:56028246-56028268 CAGTGTGGAGGGAGGGAGGACGG + Intergenic
1041552077 8:59114096-59114118 CAGTGGAACAGGAAGAAGTAGGG - Intronic
1041846154 8:62331126-62331148 GGGTGGAAGAGGAGGGAGGAAGG - Intronic
1041872784 8:62653757-62653779 CAGTGGAACAGTAGGGCTGATGG - Intronic
1042117890 8:65452123-65452145 TAGAATAAAAGGAGGGAGGAAGG - Intergenic
1042939536 8:74093246-74093268 CAGTGCAACAGTAGAAAGGAAGG - Intergenic
1044512382 8:93097358-93097380 CAGTGGCAAAGGAGGGAGAAAGG + Intergenic
1046778528 8:118190195-118190217 CAGAGTATGAGAAGGGAGGATGG - Intronic
1046899433 8:119508151-119508173 CTGTGTAACAAGGGGTAGGAAGG + Intergenic
1047525033 8:125625897-125625919 AAGGATAAAAGGAGGGAGGAGGG - Intergenic
1047715725 8:127593406-127593428 CAGGGTTACAGGAGTGAGTAGGG + Intergenic
1048373349 8:133799863-133799885 CAGTGTATCATAAGGGAGAAAGG + Intergenic
1048408826 8:134150695-134150717 CAGGTTAACAGGAAGGGGGAAGG - Intergenic
1048528970 8:135230060-135230082 CAGTGTCAGGGAAGGGAGGAAGG + Intergenic
1048871994 8:138806829-138806851 CAGTGGAACAGGATGGAAGATGG + Intronic
1049276609 8:141723253-141723275 AAGAGGAAGAGGAGGGAGGAAGG - Intergenic
1049370263 8:142261028-142261050 GAGAGAAAGAGGAGGGAGGAAGG + Intronic
1049537852 8:143190219-143190241 CGCTGTAAGAGGAGGGAGGCGGG - Intergenic
1049569617 8:143363003-143363025 CACGGTAACAGGAGAGAAGATGG - Intergenic
1050033762 9:1413730-1413752 GACTGAAACATGAGGGAGGATGG + Intergenic
1050770259 9:9189982-9190004 CACTGTGCCAGGAGCGAGGAAGG - Intronic
1051368167 9:16335880-16335902 CAGTGTGGCAGGAGTCAGGAAGG + Intergenic
1052943029 9:34145461-34145483 AAGTGTAACACCATGGAGGATGG + Intergenic
1053054264 9:34984906-34984928 CAGAGTCAGAGGAGGGAGGCAGG + Intergenic
1053434408 9:38065976-38065998 CAGGGTTACAGGAGGGATGAAGG - Intronic
1054868563 9:70027630-70027652 CAGTGTAGGGGCAGGGAGGATGG + Intergenic
1055687423 9:78791711-78791733 CAGGGAAGCAGGAGGTAGGAAGG + Intergenic
1055734386 9:79312183-79312205 CAGTGATACAAGAGGGAGGCCGG + Intergenic
1056287696 9:85107977-85107999 TGGTGACACAGGAGGGAGGATGG + Intergenic
1056538215 9:87549665-87549687 CAATGTAAAAGGAGGGGCGAGGG - Intronic
1056982355 9:91327178-91327200 CATGGTAACAGGAGGCAGGGCGG - Intronic
1057066736 9:92060040-92060062 CAGTGTCACAGGAGGGCGAGTGG + Intronic
1057519798 9:95751821-95751843 CTGAGCCACAGGAGGGAGGATGG + Intergenic
1058945546 9:109852257-109852279 CATTCCAAAAGGAGGGAGGAAGG - Intronic
1059099621 9:111457488-111457510 CATTGTAACAGGAGGGAAACAGG + Intronic
1059433705 9:114264430-114264452 CAGTGTCGGAGGAGTGAGGAAGG - Intronic
1059688253 9:116658510-116658532 CAGAGAAACAGTAGGTAGGAAGG + Intronic
1060056029 9:120413800-120413822 CAGTGAGCGAGGAGGGAGGAGGG + Intronic
1060104614 9:120865952-120865974 AATTGTTCCAGGAGGGAGGAGGG + Intronic
1060248246 9:121964657-121964679 GAGTGTATTAGGAGAGAGGAAGG - Intronic
1060439859 9:123628313-123628335 CAGTGACATGGGAGGGAGGAAGG + Intronic
1060589783 9:124809489-124809511 CAGAGGAACAGCAGGGACGAAGG + Intronic
1061105795 9:128529408-128529430 CAGTCTGACAGGAGACAGGAAGG - Intronic
1061514252 9:131079367-131079389 CAGGGTTGCAGGAGGGAGAAGGG + Intronic
1062080852 9:134622623-134622645 AAGAGAAAGAGGAGGGAGGAGGG - Intergenic
1062080883 9:134622722-134622744 AAGAGAAAGAGGAGGGAGGAGGG - Intergenic
1062080914 9:134622823-134622845 AAGAGAAAGAGGAGGGAGGAGGG - Intergenic
1062186628 9:135221900-135221922 CAGTGTGTCTGGAGGGAGCAAGG - Intergenic
1062571458 9:137187643-137187665 CAGAGTAAGAGGAAGGGGGAAGG - Exonic
1187324896 X:18277813-18277835 CAGTGTAATAGGGGAGAAGATGG + Intronic
1187492028 X:19761098-19761120 GAGTGGAACAGGAGGTTGGAAGG + Intronic
1188666452 X:32827575-32827597 AAGAGTAAAAGGTGGGAGGAGGG - Intronic
1188668039 X:32848894-32848916 AAGTGTTACAGGAGGCAGGCTGG + Intronic
1189178400 X:38980835-38980857 CAGTGACACAGGCAGGAGGAGGG - Intergenic
1189920799 X:45901414-45901436 CACTGGTACAGGAGGGAGGCAGG + Intergenic
1190118224 X:47639393-47639415 CAGGGTGTCAGGGGGGAGGAGGG + Intronic
1191736003 X:64388407-64388429 ATATGTAACAGGAGGAAGGAAGG + Intronic
1191780242 X:64856731-64856753 CAGTGTAACTGAAAGGGGGATGG - Intergenic
1192191504 X:68994124-68994146 CAGTGTAACAGCAAAGAGGGAGG - Intergenic
1192777785 X:74263060-74263082 AAGTGTCACAGTAGGGAGTAAGG + Intergenic
1193273387 X:79555137-79555159 CATGAAAACAGGAGGGAGGAGGG + Intergenic
1193797049 X:85890037-85890059 GACTCTAAAAGGAGGGAGGAAGG + Intronic
1195141191 X:101961800-101961822 CAGAGAAGCAGGAGGAAGGAAGG + Intergenic
1195726960 X:107927849-107927871 GTGCGTGACAGGAGGGAGGAAGG - Intergenic
1197665285 X:129216635-129216657 CAGGGTAGCAGGAAGGAGAAGGG + Intergenic
1197875167 X:131095265-131095287 GAATGGAACAGGAGGCAGGAGGG - Intergenic
1198080616 X:133235957-133235979 CAGAGCAACAGGAAAGAGGAAGG - Intergenic
1198416578 X:136426083-136426105 CACTGTAACAGGAAGGAAGGTGG + Intergenic
1198533500 X:137566496-137566518 CAGAGGGATAGGAGGGAGGAGGG - Exonic
1200275680 X:154730277-154730299 CAGAGGAACAGGGGTGAGGAAGG - Intronic
1200886585 Y:8278099-8278121 CAGTGTGACAGGGGGAAGGTGGG - Intergenic
1201438622 Y:13985557-13985579 AAGTGTGTCAGGAGGGAGGCAGG - Intergenic
1201445951 Y:14057151-14057173 AAGTGTGTCAGGAGGGAGGCAGG + Intergenic