ID: 1162707009

View in Genome Browser
Species Human (GRCh38)
Location 19:12562673-12562695
Sequence TGACAAACCTCTAGTGGGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 84}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162707009_1162707019 4 Left 1162707009 19:12562673-12562695 CCCATCCCACTAGAGGTTTGTCA 0: 1
1: 0
2: 0
3: 6
4: 84
Right 1162707019 19:12562700-12562722 GGGGACAGAGCGTTGGGTTTAGG 0: 1
1: 0
2: 1
3: 13
4: 161
1162707009_1162707018 -2 Left 1162707009 19:12562673-12562695 CCCATCCCACTAGAGGTTTGTCA 0: 1
1: 0
2: 0
3: 6
4: 84
Right 1162707018 19:12562694-12562716 CATGGAGGGGACAGAGCGTTGGG 0: 1
1: 0
2: 2
3: 10
4: 176
1162707009_1162707020 16 Left 1162707009 19:12562673-12562695 CCCATCCCACTAGAGGTTTGTCA 0: 1
1: 0
2: 0
3: 6
4: 84
Right 1162707020 19:12562712-12562734 TTGGGTTTAGGCCTGAGCTTTGG 0: 1
1: 0
2: 0
3: 12
4: 139
1162707009_1162707017 -3 Left 1162707009 19:12562673-12562695 CCCATCCCACTAGAGGTTTGTCA 0: 1
1: 0
2: 0
3: 6
4: 84
Right 1162707017 19:12562693-12562715 TCATGGAGGGGACAGAGCGTTGG 0: 1
1: 0
2: 2
3: 15
4: 193
1162707009_1162707021 22 Left 1162707009 19:12562673-12562695 CCCATCCCACTAGAGGTTTGTCA 0: 1
1: 0
2: 0
3: 6
4: 84
Right 1162707021 19:12562718-12562740 TTAGGCCTGAGCTTTGGAGTTGG 0: 1
1: 0
2: 0
3: 20
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162707009 Original CRISPR TGACAAACCTCTAGTGGGAT GGG (reversed) Intronic
900133044 1:1097749-1097771 TGACAAACCTCTACTAAGAATGG - Intronic
901088616 1:6626983-6627005 TGACAGAGCTCTCGTGGGAGTGG - Intronic
909809802 1:79918590-79918612 TGAAAAATCTCAAGTGGTATTGG - Intergenic
918190180 1:182166158-182166180 TGACAAATCTCCAGAGGGACTGG + Intergenic
919298887 1:195735540-195735562 TGAGAAATCTCTTGTGGGAGGGG + Intergenic
921827023 1:219683795-219683817 TGACAAACCTCTAGTCTTAATGG - Intergenic
1064243106 10:13648363-13648385 TGAAAAACTTCTAATGGGAGAGG + Intronic
1064272371 10:13877411-13877433 GATCAAACCTCTAGTGGCATCGG + Intronic
1066036200 10:31488455-31488477 GGACAAAACTGTAGTAGGATCGG - Intronic
1067246107 10:44546654-44546676 TGACAAACCTCTAATAAGACTGG - Intergenic
1067276700 10:44841920-44841942 TGACAAACCTCTAATAAGATTGG + Intergenic
1068153008 10:53158258-53158280 TGACAACAATCTAATGGGATAGG - Intergenic
1070584334 10:77750324-77750346 TGACAAACTTCTATTGAGGTGGG + Intergenic
1072848833 10:98863521-98863543 TGACTAACCTTCAGTGGCATTGG - Intronic
1073766783 10:106691269-106691291 TGACAAACCTCCCATGGGAATGG + Intronic
1074103547 10:110372764-110372786 TCACAAAGCTCTGTTGGGATGGG - Intergenic
1075186721 10:120267359-120267381 TGATAAACCTCTAGTCAGACTGG + Intergenic
1084175355 11:67419888-67419910 TGGCAAACCACTACTGGGACTGG - Intronic
1085411151 11:76291519-76291541 TGACAGTCCTCTAGAGGGAACGG - Intergenic
1089657188 11:119957876-119957898 AGACAAACCTCTGGCAGGATTGG + Intergenic
1089728912 11:120508321-120508343 TGATAAACTTCTAGTAGGAGAGG + Intergenic
1090742064 11:129672988-129673010 TGACAAACCTCTAGCTAGACTGG + Intergenic
1091990649 12:4953021-4953043 TGTCTAACCTCCAGTGTGATTGG + Intergenic
1097562982 12:61231778-61231800 TGACAAAGCTCCACTGGAATAGG - Intergenic
1098229934 12:68363236-68363258 TGAGAAACCCCTAATGGGAGAGG - Intergenic
1099391905 12:82091804-82091826 GGATAAACCTCTAGTTGGGTAGG + Intergenic
1111100894 13:83584837-83584859 TGGCAAATCTTTAGCGGGATCGG + Intergenic
1112719442 13:102226304-102226326 TCACAACACTCTAGTGAGATAGG - Intronic
1113257806 13:108526050-108526072 TGACCAACCTCTAGTGACTTTGG + Intergenic
1116245111 14:42401072-42401094 TGAAAAACCTGCAGTGGGAAAGG + Intergenic
1117907205 14:60602583-60602605 AGCCAAAGCTCTAGTGGGAGAGG - Intergenic
1130204301 15:81861781-81861803 TGCCAAACCTCCCCTGGGATGGG + Intergenic
1130297759 15:82659246-82659268 TGACAAACCCCTAGAAGGAAAGG + Intergenic
1132064713 15:98721334-98721356 TGAGAAACCACTTGTGGGTTAGG + Intronic
1133679642 16:8108973-8108995 TGGGAAACCTCTAGCGGGTTTGG - Intergenic
1135536215 16:23296435-23296457 TGACAGCCCTCGAGTGGGGTGGG - Intronic
1138916250 16:61468273-61468295 TGAAACAACTCCAGTGGGATAGG - Intergenic
1140564676 16:76027348-76027370 TCACAAACCCCTTGTGGGAGTGG - Intergenic
1150468939 17:65419242-65419264 TGATAAACATCTTGTGGGCTGGG - Intergenic
1153460273 18:5325299-5325321 GGACCAACTTCTAGTGGGAAGGG + Intergenic
1156840576 18:41605706-41605728 TGACAAAGGTCTAGTGCGATTGG - Intergenic
1162707009 19:12562673-12562695 TGACAAACCTCTAGTGGGATGGG - Intronic
1164696236 19:30246581-30246603 TGCCAGACCTCTTGTGGGGTGGG - Intronic
1166095254 19:40534403-40534425 TGACATACCTTGAGTGGGGTTGG - Intronic
925851630 2:8087756-8087778 TGACCACCCTCTGGTGGGAAGGG - Intergenic
929747003 2:44669541-44669563 TGACAAACATATGGTGGAATGGG - Intronic
933629912 2:84644270-84644292 TGACAAAACTCTAGCAGGTTAGG + Intronic
934848739 2:97682058-97682080 TGACAAACTTCTAGCTAGATAGG + Intergenic
937756878 2:125550304-125550326 TGAGAAAGCACTAGGGGGATGGG + Intergenic
944136838 2:196408900-196408922 TGACCAACCTTTTGTGAGATAGG - Intronic
944641527 2:201731036-201731058 TGAGAAACAACTACTGGGATGGG + Intronic
946774763 2:223126019-223126041 TGAAAAACCTCAAGTGGTAGAGG - Intronic
1170132866 20:13041736-13041758 AGACAATCCTCTAGTGGGGGCGG - Intronic
950228300 3:11254233-11254255 TGAAAAATCTCTAGTAGGAGAGG - Intronic
954957422 3:54534025-54534047 TGACAGACTTCTGGTGGGACAGG - Intronic
955777525 3:62449575-62449597 TTCCAAAACTCTAGTGGGTTGGG - Intronic
969672629 4:8598188-8598210 TCACAGAGCTCTTGTGGGATGGG - Intronic
977921259 4:102645776-102645798 TGACAAACCTTTAGTTAGACTGG - Intronic
981395472 4:144243328-144243350 TGACAAACCTCCAGTCAGATTGG - Intergenic
985934462 5:3084932-3084954 TGACAAATCTTTAGCTGGATTGG + Intergenic
987502684 5:18733456-18733478 TGGCAAGCCTTTAGTCGGATCGG + Intergenic
987942333 5:24555830-24555852 TAACATACGTCTATTGGGATTGG + Intronic
988973110 5:36489213-36489235 TGACAAATCTCCAGTGTGGTTGG + Intergenic
991244379 5:64493756-64493778 TGACATACCTCTGTTGTGATGGG - Intergenic
991325897 5:65432139-65432161 TGACAAATTTGTAGTGGGGTAGG + Intronic
993962498 5:94317104-94317126 TCACAACCCTCAAGTGGGAAGGG + Intronic
995440713 5:112189322-112189344 TCACAAACCTCTAGTGAGGTAGG + Intronic
996520177 5:124417404-124417426 TGTCAACACTCTAGTGGTATTGG + Intergenic
997771976 5:136563597-136563619 TGACAAACCTCTCTTGGTGTAGG - Intergenic
1001291914 5:170469639-170469661 TGAGAAGCCTCTAGCGGGTTTGG - Intronic
1008875981 6:56328411-56328433 TGCCATACCACTAGTGTGATGGG - Intronic
1018184103 6:161250759-161250781 TGACAAACATGTAGTGAAATGGG - Intronic
1021193748 7:17651373-17651395 TGAGGAAGCTCTAGTGGAATTGG - Intergenic
1022227533 7:28379019-28379041 TGTCAAACCTCTAGTAACATTGG - Intronic
1022808123 7:33843445-33843467 TCACACACCTCTAGTGAGAGAGG - Intergenic
1023662624 7:42486097-42486119 TTACAAACCTATATTGAGATTGG - Intergenic
1027445463 7:78268578-78268600 TGCCATACCCCTAGTGGGTTTGG + Intronic
1028235641 7:88358352-88358374 TGACAAACGTCTAGTGGGGAGGG - Intergenic
1031766193 7:125780990-125781012 TTTCAAACCCCTTGTGGGATGGG + Intergenic
1045915851 8:107469813-107469835 TGACAAACCTGTTGTGTGTTAGG - Intronic
1046890009 8:119412559-119412581 TGACAACCTTCCAGTGGGACAGG + Intergenic
1047672951 8:127169062-127169084 TGATAAAACCCTAGTGGGTTAGG + Intergenic
1050776810 9:9273879-9273901 TGACAAACCTCTGGAAGGTTTGG - Intronic
1051230293 9:14948718-14948740 TGAGAAAACTATAGTGGGCTAGG - Intergenic
1059572078 9:115449279-115449301 TGACAACCCTCTAGTGATATTGG - Intergenic
1187834521 X:23417862-23417884 TGACAAGACTCTAGTGAGCTGGG + Intergenic
1191152572 X:57235811-57235833 TGACAAAGGTTTGGTGGGATGGG - Intergenic
1193762086 X:85479469-85479491 TGAGAAACCTATAATGGGGTCGG - Intergenic
1199140722 X:144308519-144308541 TGGCAACCCTCTAGTGAGCTTGG - Intergenic
1200415961 Y:2910243-2910265 TGACAAGCCTCTAGGCAGATTGG + Intronic
1201677647 Y:16605004-16605026 TGACACCACTCTAGTGGGGTTGG - Intergenic