ID: 1162709864

View in Genome Browser
Species Human (GRCh38)
Location 19:12584792-12584814
Sequence CTGGATTTGCATGGTTCTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 674
Summary {0: 1, 1: 0, 2: 0, 3: 57, 4: 616}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162709864 Original CRISPR CTGGATTTGCATGGTTCTAA TGG (reversed) Intronic
900944903 1:5825137-5825159 TTTGATTTGCATGTTTCTGATGG - Intergenic
903079888 1:20801525-20801547 CTGGGTTTGCATGTTGCTATTGG - Intergenic
903493662 1:23749332-23749354 CTGGAATTAGATGGTTATAATGG + Intronic
906053728 1:42897569-42897591 ATGTATTTGCATGGTTTTGAAGG + Intergenic
907001455 1:50863212-50863234 ATGTATTTGCATGGTTTTGAGGG - Intronic
907349391 1:53813975-53813997 ATGTATTTGCATGGTTCTGAAGG - Intronic
907930614 1:58995895-58995917 CTGGATTTGCATGTTTTAAAGGG + Intergenic
908174860 1:61545283-61545305 ATGTATTTGCATGGTTTTGAAGG + Intergenic
908206428 1:61855057-61855079 CTGGATTTGTGTGGTTTTATAGG + Intronic
908803399 1:67904422-67904444 ATGTATTTGCATGGTTTTGAAGG + Intergenic
908890555 1:68842782-68842804 ATGTATTTGCATGGTTTTGAAGG + Intergenic
908982028 1:69969978-69970000 ATGTATTTGCATGGTTTTGAAGG - Intronic
909098555 1:71321092-71321114 ATATATTTGCATGGTTCTGAAGG - Intergenic
909511127 1:76453570-76453592 ATGTATTTGCGTGGTTCTGAGGG + Intronic
909639562 1:77857168-77857190 ATGTATTTGCATGGTTTTGAAGG + Intronic
909896609 1:81078497-81078519 CTGGATATGGATGGTGGTAATGG + Intergenic
910142048 1:84037074-84037096 ATGTATTTGCATGGTTTTGAAGG + Intergenic
910270110 1:85385726-85385748 GTGCATTTGCATTGTTATAAAGG + Intronic
910433420 1:87180806-87180828 CTTCTCTTGCATGGTTCTAACGG + Intergenic
911080953 1:93930076-93930098 ATGTATTTGCATGGTTTTGATGG - Intergenic
911265659 1:95740402-95740424 ATGTATTTGCATGGTTTTGAGGG + Intergenic
911562266 1:99420449-99420471 ATGTATTTGCATGGTTTTGAGGG - Intergenic
911743497 1:101413439-101413461 ATGTATTTGCATGGTTTTGAGGG - Intergenic
911756244 1:101560202-101560224 CTGGTTTTGCATTGCTATAAAGG - Intergenic
912081478 1:105942806-105942828 ATGTATTTGCATGGTTTTGAAGG + Intergenic
913312774 1:117519034-117519056 ATGTATTTGCATGGTTTTGAAGG - Intronic
913383632 1:118236040-118236062 ATGCATTTGCATGGTTTTGAGGG - Intergenic
914455244 1:147830461-147830483 ATGTATTTGCATGGTTTTGAAGG + Intergenic
916566128 1:165979896-165979918 ATGTATTTGCATGGTTTTGAGGG + Intergenic
916842629 1:168615445-168615467 CTGGGTTTTCCTGCTTCTAAGGG + Intergenic
916872925 1:168937125-168937147 ATGTATTTGCATGGTTTTGAAGG + Intergenic
917319232 1:173761584-173761606 ATGTATTTGCATGGTTTTGAAGG - Intronic
917907751 1:179604667-179604689 ATGTATTTGCATGGTTTTTAAGG + Intronic
918158591 1:181875125-181875147 ATGTATTTGCATGGTTTTGAGGG - Intergenic
918721600 1:187859086-187859108 ATGTATTTGCATGGTTTTGAAGG + Intergenic
919073193 1:192782011-192782033 ATGTATTTGCATGGTTTTGAAGG + Intergenic
919549249 1:198964163-198964185 ATGTATTTGCATGGTTTTGAAGG + Intergenic
921532661 1:216304809-216304831 ATGTATTTGCATGGTTTTGAGGG + Intronic
921834750 1:219766581-219766603 ATGCATTTGCATGGTTTTGAAGG - Intronic
921999890 1:221466311-221466333 ATGTATTTGCATGGTTCTGAGGG + Intergenic
922357678 1:224791971-224791993 CTTGCTTTGCATAGTTTTAAAGG + Intergenic
922395775 1:225199628-225199650 ATGTATTTGCATGGTTTTGAAGG + Intronic
922582060 1:226705870-226705892 CTGGGCTTGCATGGTTCCCAGGG - Intronic
923661919 1:235964929-235964951 ATGTATTTGCATGGTTTTGAAGG - Intergenic
923808419 1:237286312-237286334 ATGTATTTGCATGGTTTTGAAGG + Intronic
924307696 1:242708353-242708375 TTGGATTTGAGTGGTTCTAATGG - Intergenic
1063566572 10:7176580-7176602 CTGAATTTGCATGGTTTTCAAGG - Intronic
1064026941 10:11856465-11856487 CTGCACTCGCATGGTTCTCAAGG + Intronic
1064556983 10:16557015-16557037 ATGTATTTGCATGGTTTTGAGGG + Intergenic
1066145289 10:32551690-32551712 ATGTATTTGCATGGTTTTGAAGG + Intronic
1066167836 10:32807774-32807796 CTGCATCTGCTTGGTTCTCACGG - Intronic
1066352956 10:34654106-34654128 ATGTAATTGCATGGTTCTAATGG + Intronic
1067034771 10:42905364-42905386 GTGTATTTGCATGGTTTTGAGGG - Intergenic
1067233984 10:44432350-44432372 ATGTATTTGCATGGTTTTGAAGG + Intergenic
1067675118 10:48367910-48367932 CTGGATGGGCTTTGTTCTAAAGG + Intronic
1068099062 10:52529189-52529211 ATGTATTTGCATGGTTTTGAGGG - Intergenic
1068435534 10:56986082-56986104 CAGGATTTGCTTGTTTGTAAAGG - Intergenic
1068525536 10:58125151-58125173 CTGGAATTGCATAGTGATAATGG + Intergenic
1070353006 10:75611438-75611460 CTGGAGATGGATGGTTGTAACGG - Intronic
1070465134 10:76714180-76714202 ATGTATTTGCATGGTTTTGAAGG - Intergenic
1071062791 10:81592696-81592718 ATGTATTTGCATGGTTTTGAGGG - Intergenic
1071405585 10:85327630-85327652 ATGCATTTGCATGGTTTTGAAGG + Intergenic
1071484913 10:86093079-86093101 ATGGATTTGCATGGTTTTGAAGG - Intronic
1071910883 10:90231674-90231696 ATGTATTTGCATGGTTTTGAAGG - Intergenic
1073495742 10:103889378-103889400 CTGGAATTGCATACTTTTAAGGG + Intronic
1074037114 10:109751270-109751292 ATGTATTTGCATGGTTTTGAGGG + Intergenic
1074582397 10:114732294-114732316 CTCGATTTGCATTTTTCTAATGG + Intergenic
1074985984 10:118659893-118659915 ATGTATTTGCATGGTTTTGAGGG + Intergenic
1075660374 10:124190858-124190880 GTATATTTGCATGGTTCTGAAGG + Intergenic
1075947040 10:126442858-126442880 ATGTATTTTCATGGTTTTAAAGG - Intronic
1075982510 10:126753155-126753177 ATGTATTTGCATGGTTTTGAAGG + Intergenic
1076425734 10:130366439-130366461 TTTGATTTGCATTGCTCTAATGG + Intergenic
1077775030 11:5261201-5261223 CTGTATTTGCATGGTTTTGAAGG - Intronic
1077963502 11:7100859-7100881 CTGGCTGAGCATGGTTCTGAAGG + Intergenic
1078775607 11:14390942-14390964 TTTGATTTGCATTTTTCTAATGG + Intergenic
1078893158 11:15575698-15575720 GTGGATTTGGATGGGTCTAAAGG + Intergenic
1079207816 11:18432256-18432278 ATGTATTTGCATGGTTTTGAAGG + Intronic
1079273419 11:19010850-19010872 ATGTATTTGCATGGTTTTGAAGG + Intergenic
1079704843 11:23601627-23601649 ATGTATTTGCATGGTTTTAGGGG + Intergenic
1079791442 11:24745001-24745023 ATGTATTTGCATGGTTTTGAAGG + Intronic
1079856153 11:25608074-25608096 ATGTATTTGCATGGTTTTGAGGG + Intergenic
1079951938 11:26816797-26816819 ATGTATTTGCATGGTTTTGAAGG + Intergenic
1080402539 11:31949721-31949743 ATGTATTTGCATGGTTTTGAAGG - Intronic
1080672304 11:34392345-34392367 ATGTATTTGCATGGTTTTGAAGG + Intergenic
1080863852 11:36175601-36175623 ATGTATTTGCATGGTTTTAAGGG + Intronic
1081589179 11:44409139-44409161 CAGGCTGTGCATGGGTCTAAGGG - Intergenic
1082567443 11:54697941-54697963 ATGCATTTGCATGGTTTCAAAGG + Intergenic
1083127077 11:60580697-60580719 ATGTATTTGCATGGTTTTGAAGG - Intergenic
1083512701 11:63226741-63226763 CTGGATTTGCCTGGGGCCAAGGG - Intronic
1085485120 11:76856906-76856928 TTTGATTTGCATTTTTCTAATGG + Intergenic
1087290510 11:96315588-96315610 CTGGATTCAAAGGGTTCTAATGG + Intronic
1087688710 11:101295113-101295135 ATGTATTTGCATGGTTTTGAAGG + Intergenic
1087995510 11:104802626-104802648 CTTGATTTGCATTTCTCTAATGG - Intergenic
1088179746 11:107095465-107095487 TTGTATTTGCATGGTTTTGAAGG - Intergenic
1088580824 11:111314376-111314398 ATGCATTTGCATGGTTTTGAAGG - Intergenic
1088951382 11:114574059-114574081 ATGTATTTGCATGGTTTTGAGGG - Intronic
1089054565 11:115575105-115575127 AGGGAGATGCATGGTTCTAAAGG + Intergenic
1089203241 11:116738272-116738294 CTGCATTTCCATGGTACTAGAGG + Intergenic
1090487015 11:127122202-127122224 CGGGGCTTGCATTGTTCTAAGGG + Intergenic
1090495085 11:127203982-127204004 TTTGATTTGCATTTTTCTAATGG + Intergenic
1090559255 11:127912796-127912818 ATGCATTTGCATGGTTTTTAAGG + Intergenic
1091210231 11:133851742-133851764 GTGTATTTGCATGGTTCTGAGGG + Intergenic
1092303607 12:7277025-7277047 ATGTATTTGCATGGTTTTGAAGG + Intergenic
1093010765 12:14104357-14104379 ATGTATTTGCATGGTTTTGAAGG - Intergenic
1093105183 12:15077724-15077746 ATGTATTTGCATGGTTTTAAAGG - Intergenic
1093277787 12:17151178-17151200 ATGTATTTGCATGGTTTTGAGGG - Intergenic
1093408977 12:18842532-18842554 ATGTATTTGCATGGTTTTGAAGG + Intergenic
1093488473 12:19678937-19678959 ATGTATTTGCATGGTTTTCAAGG + Intronic
1094263210 12:28525392-28525414 ATGTATTTGCATGGTTTTGAAGG + Intronic
1094268122 12:28581557-28581579 CTGGATTTGCAAAGATATAAAGG - Intergenic
1094297424 12:28923560-28923582 ATGTATTTGCATGGTTTTGAGGG - Intergenic
1095500808 12:42836722-42836744 ATGTATTTGCATGGTTTTGAGGG + Intergenic
1095687637 12:45053007-45053029 GTGTATTTGCATGGTTTTGAAGG + Intergenic
1095932299 12:47639509-47639531 ATGTATTTGCATGGTTTCAAGGG - Intergenic
1096437733 12:51609026-51609048 ATGTATTTGCATGGTTTTGAAGG + Intronic
1097295744 12:57960612-57960634 ATGTATTTGCATGGTTTTGATGG - Intergenic
1097385719 12:58948034-58948056 ATGTATTTGCATGGTTCTGAAGG + Intergenic
1097547482 12:61022958-61022980 ATGTATTTGCATGGTTTTGAAGG + Intergenic
1097659991 12:62419366-62419388 ATGTACTTGCATGGTTCTGAAGG - Intergenic
1098014993 12:66095155-66095177 TTTGATTTGCATGTCTCTAATGG + Intergenic
1098786229 12:74759662-74759684 ATGTATTTGCATGGTTTTGATGG + Intergenic
1098786627 12:74766459-74766481 TTGTATTTTTATGGTTCTAAAGG - Intergenic
1098982445 12:76971851-76971873 ATGTATTTGCATGGTTTTGAAGG + Intergenic
1099472810 12:83072295-83072317 CTATATTTGCATGGTTCTGAAGG + Intronic
1099476921 12:83119436-83119458 GTGTATTTGCATGGTTCTGAAGG + Intronic
1100697008 12:97105596-97105618 ATGTATTTGCATGGTTCTGAAGG + Intergenic
1100706534 12:97206201-97206223 ATGTATTTGCATGGTTCTGAAGG - Intergenic
1100918771 12:99458124-99458146 ATGTATTTGCATGGTTTTCAGGG - Intronic
1101037361 12:100718171-100718193 GTGGTATTGCATGGTTCTGAAGG + Intronic
1101635028 12:106533069-106533091 ATGTATTTGCATGGTTTTGAAGG + Intronic
1104200855 12:126587315-126587337 CTGGAGGTGCATGGTGGTAATGG + Intergenic
1105908515 13:24837546-24837568 ATGTATTTGCATGGTTTTGAAGG - Intronic
1105930993 13:25051893-25051915 TTGTATTTGCATGGTTTTGAAGG - Intergenic
1106976049 13:35217102-35217124 CTGAATTTGCATTTTCCTAATGG + Intronic
1107701801 13:43056032-43056054 ATGTATTTGCATGGTTTTGAGGG + Intronic
1107755746 13:43620538-43620560 ATGTATTTGCATGGTTTTGAAGG + Intronic
1108189264 13:47920500-47920522 ATGTATTTGCATGGTTTTGAGGG - Intergenic
1108469541 13:50753966-50753988 ATGTATTTGCATGGTTTTGAAGG + Intronic
1108587401 13:51882604-51882626 CAGGTTTTTCATGGTTCTGATGG - Intergenic
1109047670 13:57434782-57434804 ATGTATTTGCATGGTTTTGATGG + Intergenic
1109132763 13:58609844-58609866 CTGGATTAGCATGGTTGCATTGG + Intergenic
1109567337 13:64134358-64134380 ATGTATTTGCATGGTTTTGAAGG + Intergenic
1109617990 13:64862263-64862285 ATGTATTTGCATGGTTTTGAAGG + Intergenic
1109625229 13:64965326-64965348 ATGTATTTGCATGGTTTTGAGGG - Intergenic
1110156517 13:72323240-72323262 CTTGATTTGCATTTCTCTAATGG - Intergenic
1110182062 13:72628821-72628843 ATGTATTTGCATGGTTTTGAGGG - Intergenic
1110517799 13:76437096-76437118 CTGTATTTGCATCGTACTAGGGG + Intergenic
1110627804 13:77670919-77670941 ATGTATTTGCATGGTTTTGAAGG - Intergenic
1111195118 13:84865920-84865942 CTGGATGTGCCATGTTCTAATGG - Intergenic
1111288093 13:86121720-86121742 CTGGTAATGCATGGTTCTAATGG + Intergenic
1111714041 13:91855377-91855399 GTGGATTGCCATGGTTGTAATGG - Intronic
1111748118 13:92295310-92295332 ATGTATTTGCATGGTTTTGAAGG + Intronic
1112035161 13:95490559-95490581 ATGTATTTGCATGGTTTTGAAGG + Intronic
1112087226 13:96044214-96044236 ATGTATTTGCATGGTTTTGAAGG - Intronic
1112738367 13:102446200-102446222 ATGTATTTGCATGGTTTTAAAGG - Intergenic
1112825563 13:103388719-103388741 CTGGGTTTACAAGGTTCTTATGG + Intergenic
1113534801 13:111057119-111057141 ATGTATTTGCATGGTTTTGAGGG + Intergenic
1115350400 14:32388643-32388665 ATGTATTTGCATGGTTTTGAAGG + Intronic
1115381647 14:32746345-32746367 CTGGTTTTTCAGGGTTCAAAGGG + Intronic
1115526947 14:34290699-34290721 ATGTATTTGCATGGTTTTGAAGG + Intronic
1115997283 14:39207399-39207421 ATGTATTTGCATGGTTTTGAAGG - Intergenic
1116048802 14:39778769-39778791 GTGTATTTGCATGGTTTTGAAGG + Intergenic
1117113007 14:52478027-52478049 ATGTATTTGCATGGTTTTGAAGG - Intronic
1117470807 14:56042776-56042798 CTCGATTTGCATAATTCTGAAGG - Intergenic
1117525671 14:56600596-56600618 TTGGATTTGCATTTTCCTAATGG - Intronic
1117768768 14:59110541-59110563 ATGTATTTGCATGGTTTTAGAGG - Intergenic
1118165854 14:63335261-63335283 ATGGATTTGCATGGTTTTGAAGG - Intergenic
1118421073 14:65604449-65604471 ATATATTTGCATGGTTTTAAAGG - Intronic
1118423888 14:65636637-65636659 ATGTGTTTGCATGGTTTTAAAGG + Intronic
1120502621 14:85315722-85315744 CTGGATCTCCATGGTTTGAATGG - Intergenic
1120545524 14:85806934-85806956 ATGTATTTGCATGGTTTTGAAGG + Intergenic
1120736123 14:88055039-88055061 ATGTATTTGCATGGTTTTGAGGG + Intergenic
1121460106 14:94068710-94068732 ATGTATTTGCATGGTTTTGAAGG - Intronic
1121475800 14:94201117-94201139 ATGTATTTGCATGGTTTTGAGGG + Intronic
1121848208 14:97194035-97194057 ATGTATTTGCATGGTTTTGAGGG + Intergenic
1121986310 14:98509914-98509936 CTGATTTTGCAGGATTCTAAAGG - Intergenic
1122165877 14:99823353-99823375 CTGGAAATGCCTGGTTCTGATGG - Intronic
1123104044 14:105829003-105829025 ATGTATTTGCATGGTTTTGAAGG - Intergenic
1123506637 15:20947615-20947637 CAGGATTTGCTTGTTTGTAAAGG + Intergenic
1123563863 15:21521360-21521382 CAGGATTTGCTTGTTTGTAAAGG + Intergenic
1123600117 15:21958644-21958666 CAGGATTTGCTTGTTTGTAAAGG + Intergenic
1124386708 15:29214737-29214759 ATGTATTTGCATGGTTTTGAAGG + Intronic
1124673886 15:31666922-31666944 ATGTATTTGCATGGTTTTGAAGG + Intronic
1125269121 15:37918922-37918944 ATGTATTTGCATGGTTTTGAAGG + Intergenic
1125273218 15:37963344-37963366 GTGTATTTGCATGGTTTTGAAGG + Intronic
1125342928 15:38692375-38692397 CTAGACTGGGATGGTTCTAATGG + Intergenic
1126133065 15:45362719-45362741 CTGGGTTTGTATGGTTATACAGG + Intronic
1126488365 15:49208445-49208467 ATGTATTTGCATGGTTTTGAAGG + Intronic
1126521280 15:49597320-49597342 AGGTATTTGCATGGTTTTAAGGG - Intronic
1126566157 15:50101940-50101962 ATTTATTTGCATGGTTTTAAGGG - Intronic
1126572963 15:50171404-50171426 ATGTATTTGCATGGTTTTGAAGG - Intronic
1126577775 15:50213658-50213680 CTGTATTTGCATGGTTTTGAAGG - Intronic
1127113489 15:55699738-55699760 CTGTATTTTCATTGGTCTAAGGG + Intronic
1127694439 15:61431046-61431068 ATGTATTTGCATGGTTTTGAGGG + Intergenic
1128115945 15:65105564-65105586 CTTGATTTGCATGATTTTATGGG - Intronic
1128436920 15:67661541-67661563 CAGAATTTACATGTTTCTAAAGG + Intronic
1130079800 15:80722887-80722909 CAGGATTTCCATCTTTCTAAGGG + Intronic
1130749532 15:86695887-86695909 ATGTATTTGCATGGTTATGAAGG + Intronic
1202972222 15_KI270727v1_random:248455-248477 CAGGATTTGCTTGTTTGTAAAGG + Intergenic
1134334115 16:13279183-13279205 GTGTATTTGCGTGGTTCTGAAGG + Intergenic
1134540163 16:15057476-15057498 CTAGCTTTGCATGATTCCAAAGG + Intronic
1134885521 16:17787688-17787710 CTGGATTTACTAGGTTCAAAGGG + Intergenic
1135779314 16:25285912-25285934 CTTGATTTGCATTTTCCTAATGG + Intergenic
1137401382 16:48156637-48156659 CGGGATGTGCAGGGTTCCAAGGG - Intergenic
1137858871 16:51825914-51825936 GTGGATTTGCATGAATCAAAGGG + Intergenic
1140064165 16:71595953-71595975 ATGTATTTGCATGGTTTTAAAGG - Intergenic
1142085810 16:88179700-88179722 CTGGAACTGCATGCTTCAAATGG + Intergenic
1142840919 17:2629386-2629408 ATGTATTTGCATGGTTTTGAAGG + Intronic
1143429416 17:6869458-6869480 TTGGTATTGTATGGTTCTAAGGG + Intergenic
1144139428 17:12334133-12334155 ATGTATTTGCATGGTTCTGAAGG + Intergenic
1145257676 17:21336219-21336241 CTTGGTGTGCATGTTTCTAAGGG + Intergenic
1145318961 17:21751804-21751826 CTTGGTGTGCATGTTTCTAAGGG - Intergenic
1145719457 17:27055696-27055718 TTTGATTTGCATTTTTCTAATGG - Intergenic
1146583638 17:34062221-34062243 ATGTATTTGCATGGTTTTGAAGG - Intronic
1146751202 17:35382528-35382550 ATGTATTTGCATGGTTTTGAAGG + Intergenic
1148400350 17:47354170-47354192 CTGTATTTGCATAGTTTTGAGGG + Intronic
1148408006 17:47437053-47437075 TTGTATTTGCATGGTTTTGAAGG + Intronic
1149052534 17:52324286-52324308 ATGTATTTGCATGGTTTTGAAGG - Intergenic
1149339029 17:55667431-55667453 CTGCATGTGCATGGATGTAAAGG - Intergenic
1149410665 17:56402989-56403011 ATGTATTTGCATGGTTTTGAAGG + Intronic
1150818524 17:68415313-68415335 ATGTATTTGCATGGTTCTGAAGG + Intronic
1150896052 17:69212270-69212292 GTGTGTTTGCATGGTTCTGAGGG + Intronic
1151048630 17:70950311-70950333 ATGTATTTGCATGGTTTTGAAGG - Intergenic
1151079049 17:71307290-71307312 ATGTATTTGCATGGTTTTGAGGG - Intergenic
1152386109 17:79975758-79975780 CTGAATTTGTATTGTACTAAGGG - Intronic
1153065693 18:1042228-1042250 ATGTATTTGCATGGTTTTGAAGG - Intergenic
1153069252 18:1086839-1086861 ATGTATTTGCATGGTTTTGAAGG + Intergenic
1153079672 18:1208021-1208043 ATGTATTTGCATGGTTTTGAAGG + Intergenic
1153400714 18:4681468-4681490 ATGTATTTGCATGGTTTTGAAGG - Intergenic
1153443501 18:5147161-5147183 TTGTATTTTAATGGTTCTAATGG - Intronic
1153869715 18:9306523-9306545 ATGTATTTGCATGGTTTTGAAGG - Intergenic
1154090236 18:11351914-11351936 ATGTATTTGCATGGTTTTGAGGG - Intergenic
1155814984 18:30296085-30296107 TTTGATTTGCATTTTTCTAATGG + Intergenic
1156011078 18:32498663-32498685 ATGTATTTGCATGGTTTTGAAGG + Intergenic
1156283156 18:35661681-35661703 CTGGATTTGCATCCCTTTAATGG + Intronic
1157218830 18:45809569-45809591 ATGTATTTGCATGGTTTTGAAGG - Intergenic
1158751812 18:60270868-60270890 CTGGATATGCTTGGTTTTGAAGG + Intergenic
1159451386 18:68606728-68606750 CTGTTTTTGCATTGTTATAAAGG + Intergenic
1159740954 18:72169463-72169485 CTGTATCTGCATGCTTCTCACGG + Intergenic
1160219567 18:76964353-76964375 ATGTATTTGCATGGTTTTGAAGG + Intronic
1162709864 19:12584792-12584814 CTGGATTTGCATGGTTCTAATGG - Intronic
1163855626 19:19699521-19699543 ATGTATTTGCATGGTTTTGATGG + Intergenic
1163871692 19:19826897-19826919 GTGTATTTGCATGGTTTTGATGG - Intergenic
1163888132 19:19987258-19987280 ATGTATTTGCATGGTTTTGATGG - Intergenic
1163897283 19:20070539-20070561 GTGTATTTGCATGGTTGTGAGGG - Intergenic
1163908005 19:20164286-20164308 ATGGATTTGCATGGTTTTGAGGG - Intergenic
1164125459 19:22311484-22311506 ATGTATTTGCATGGTTTTGAAGG + Intronic
1164287971 19:23839228-23839250 ATGTATTTGCATGGTTTTGAAGG + Intergenic
1164760888 19:30727564-30727586 CTGTGTTTGCTTGGTGCTAAGGG + Intergenic
1164907033 19:31976090-31976112 GTCGATTTGCATTGTTATAAAGG + Intergenic
1165983210 19:39743901-39743923 ATGTATTTGCATGGTTTTGAGGG + Intergenic
1166604007 19:44124306-44124328 ATGTATTTGCATGGTTTTGAAGG + Intronic
1166899914 19:46052342-46052364 ATGTATTTGCATGGTTTTGAAGG - Intronic
1168011025 19:53532410-53532432 CTGGATTTTCCTGGTTTTTAAGG + Intronic
925652051 2:6101404-6101426 ATGTATTTGCATGGTTTTGAGGG + Intergenic
927301568 2:21521718-21521740 CTTGATTTGCATTTCTCTAATGG + Intergenic
927570721 2:24157117-24157139 ATGTATTTGCATGGTTTTGAGGG + Intronic
927722277 2:25391770-25391792 ATGTATTTGCATGGTTTTGAGGG - Intronic
928356938 2:30624961-30624983 ATGTATTTGCATGGTTTTAAGGG - Intronic
928733945 2:34263848-34263870 ATGTATTTGCATGGTTTTGAAGG - Intergenic
929010044 2:37432659-37432681 TTGTATTTGCATGGTTTTAAAGG + Intergenic
929037095 2:37704536-37704558 TTGCATTTGCATGGTTTTGAAGG + Intronic
929250040 2:39743321-39743343 ATGGATATGCATTTTTCTAATGG - Intronic
931136212 2:59404501-59404523 CTGTATTTGCATGATTTTGAGGG - Intergenic
931524902 2:63142428-63142450 ATGTATTTGTATGGTTCTGAAGG + Intronic
931553918 2:63478527-63478549 ATGTATTTGCATGGTTTTGAGGG - Intronic
931834872 2:66088119-66088141 ATGTATTTGCATGGTTTTGAGGG - Intergenic
931844462 2:66188689-66188711 CTGAATTTGAATGGTTTTGATGG + Intergenic
932080724 2:68712239-68712261 TTTGATTTGCATTTTTCTAATGG + Intronic
932100317 2:68893560-68893582 ATGTATTTGCATGGTTTTGAAGG + Intergenic
933382154 2:81562041-81562063 ATGTATTTGCATGGTTTTGAGGG - Intergenic
933398152 2:81757668-81757690 ATGTATTTGCATGGTTTTAAAGG - Intergenic
933410965 2:81924511-81924533 ATGTATTTGCATGGTTTTGAGGG - Intergenic
933433247 2:82212340-82212362 ATGGATTTACATGGTTTTGAGGG + Intergenic
935007352 2:99092131-99092153 ATGTATTTGCATGGTTTTGAAGG - Intronic
935610214 2:105015088-105015110 ATGTATTTGCATGGTTTTGAAGG + Intergenic
936701881 2:115020867-115020889 ATGTATTTGCATGATTCTGAGGG - Intronic
936910916 2:117592629-117592651 ATGTATTTGCATGGTTTTGAAGG + Intergenic
937572898 2:123385694-123385716 ATGTATTTGCATGGTTTTAAAGG - Intergenic
937767393 2:125677760-125677782 ATGTATTTGCATGGTTTTGAAGG + Intergenic
938421945 2:131153354-131153376 CTGGCTTTGCATGGCTCTCTGGG + Intronic
938834287 2:135083837-135083859 TTTGATTTGCATTTTTCTAATGG + Intronic
938853776 2:135289219-135289241 ATGTATTTGCATGGTTTTGAGGG + Intronic
938996651 2:136685950-136685972 ATGTATTTGCATGGTTTTGAGGG - Intergenic
939769800 2:146301246-146301268 ATATATTTGCATGGTTCTGAAGG - Intergenic
940034460 2:149299336-149299358 ATGTATTTGCATGATTCTGAAGG + Intergenic
940671374 2:156673108-156673130 ATGGCTTGGTATGGTTCTAAGGG + Intergenic
940784744 2:157969265-157969287 ATGTATTTGCATGGTTTTGAAGG + Intronic
941631375 2:167888745-167888767 ATGTATTTGCATGTTTTTAAAGG + Intergenic
941702346 2:168617080-168617102 ATGTATTTGCATGGTTTTGAAGG - Intronic
942154486 2:173113684-173113706 ATGTATTTGCATGGTTTTGAAGG + Intronic
943048877 2:182892423-182892445 CTGAATTTGCCTAGTCCTAAAGG + Intergenic
943621134 2:190149613-190149635 ATATATTTGCATGGTTCTGAAGG + Intronic
944031512 2:195240272-195240294 CTGGATTTAGGTAGTTCTAAAGG - Intergenic
944201739 2:197114879-197114901 TTTGTTTTGTATGGTTCTAAGGG + Intronic
944326467 2:198411000-198411022 CTGCATTTTCATTGTACTAACGG + Intronic
944420940 2:199529579-199529601 ATGTATTTTCATGGTTCTGAAGG - Intergenic
944431797 2:199641966-199641988 ATGTATTTGCATGGTTTTAGAGG + Intergenic
944528650 2:200646352-200646374 ATGTATTTGCATGGTTCTGAAGG + Intronic
944696294 2:202203109-202203131 CTGGATTTACGTGGTTCTGAAGG - Intergenic
944985055 2:205166885-205166907 CTGCCTCTGCATGCTTCTAACGG - Intronic
945480956 2:210345215-210345237 GTGTATTTGCATGGTTTTGAAGG + Intergenic
945825990 2:214720457-214720479 ATGTATTTGCATGGTTTTAAAGG - Intergenic
945865028 2:215164525-215164547 ATGTATTTGCATGGTTTTAAAGG - Intergenic
946036717 2:216748684-216748706 ATGTATTTGCATGGTTTTGAAGG - Intergenic
946824225 2:223660069-223660091 ATGTATTTGCATGGTTTTGAGGG - Intergenic
946956859 2:224940435-224940457 TTGGATTTGAATGGTCTTAAAGG + Intronic
947445035 2:230156837-230156859 CTGGATCTGCCTGATTCTCAAGG + Intergenic
947681213 2:232035713-232035735 CAGGATTTGCATGTCTGTAAAGG + Intronic
947781156 2:232764624-232764646 CTTGATCTGTATGTTTCTAAAGG + Intronic
948531431 2:238609105-238609127 ATGTATTTGCATGGTTTTGAAGG - Intergenic
948576959 2:238958996-238959018 ATGTATTTGCATGGTTTTGAGGG - Intergenic
1169335901 20:4756779-4756801 ATGTATTTGCATGGTTTTGAAGG + Intergenic
1169840999 20:9937346-9937368 ATGTATTTGCATGGTTTTGAGGG - Intergenic
1170133777 20:13051786-13051808 ATGTATTTGCATGGTTTTGAAGG - Intronic
1170179106 20:13509170-13509192 CAGGATTTTCTTGGTTTTAAAGG - Intronic
1170375631 20:15697346-15697368 ATGTATTTGCATGGTTTTGAAGG + Intronic
1170985471 20:21253940-21253962 CTGGATTTGCATTTCTCTGATGG + Intergenic
1171080336 20:22175681-22175703 AAGTATTTGCATGGTTTTAAGGG + Intergenic
1171160243 20:22915843-22915865 ATGTATTTGCATGGTTTCAAAGG + Intergenic
1171165841 20:22969911-22969933 ATGTATTTGCATGGTTTTGAGGG - Intergenic
1172851197 20:37966716-37966738 ATGTATTTGCATGGTTTTGAGGG + Intergenic
1173697612 20:45032996-45033018 TTTGATTTGCATTTTTCTAATGG + Intronic
1175069366 20:56319226-56319248 ATGTATTTGCACGGTTCTGAAGG - Intergenic
1177140812 21:17355977-17355999 ATGTATTTGCATGGTTTTGAAGG - Intergenic
1177176704 21:17707445-17707467 ATGTATTTGCATGGTTTTGAAGG - Intergenic
1177364316 21:20114695-20114717 ATGTATTTGCATGGTTTTGAGGG + Intergenic
1177965175 21:27718711-27718733 GTTTATTTGCATTGTTCTAATGG - Intergenic
1178406975 21:32332718-32332740 TTGAATTTGCATTTTTCTAATGG - Intronic
1178733103 21:35123155-35123177 ATGTATTTGCATGGTTTTGAGGG - Intronic
1179083916 21:38200099-38200121 ATGTATTTGCATGGTTTTGAAGG + Intronic
1179467533 21:41586720-41586742 ATGTATTTGCATGGTTTTGAGGG + Intergenic
1179588853 21:42391848-42391870 CCAGATTTGCCTGGTTCTAGGGG - Intronic
1180250986 21:46588154-46588176 ATGTATTTGCATGGTTTTGAAGG - Intergenic
1181454519 22:23049482-23049504 ATGTATTTGCATGGTTTTGAAGG - Intergenic
1181679460 22:24483248-24483270 CTGGACTTGCATGGTACTTTTGG + Intergenic
1182682777 22:32095134-32095156 ATGTATTTGCATGGTTTTGAAGG + Intronic
1183048121 22:35238020-35238042 ATGTATTTGCATGGTTTTGAAGG + Intergenic
949149754 3:752320-752342 CTGTATTTGCATGTTTATTATGG - Intergenic
950449446 3:13057480-13057502 CTGCATGTGTATGGTGCTAAGGG - Intronic
950717241 3:14857729-14857751 CTGCATTTTCATTGTTCTGATGG + Intronic
951138558 3:19133772-19133794 CTGGATTTGCATATTTCCTAAGG + Intergenic
951153503 3:19321473-19321495 ATGTATTTGCATGGTTTTGAGGG + Intronic
951268234 3:20595209-20595231 ATGTATTTGCATGGTTTTGAGGG + Intergenic
951357947 3:21691808-21691830 CTGGATTTGCATAGTGGTGATGG - Intronic
951690787 3:25394190-25394212 ATGTATTTGCATGGTTTTGAGGG + Intronic
951750049 3:26025095-26025117 ATGTATTTGCATGGTTTTGAGGG + Intergenic
951761283 3:26149630-26149652 ATGTATTTGCATGGTTTTGAAGG - Intergenic
951764006 3:26176761-26176783 GTGTATTTGTATGGTTTTAAAGG + Intergenic
951852191 3:27153654-27153676 ATGTATTTGCATGGTTTTGAAGG - Intronic
952714687 3:36468139-36468161 CTGTATTTGCATGGTTTCAAGGG + Intronic
953185518 3:40634180-40634202 ATGTATTTGCATGGTTTTCAGGG - Intergenic
953195543 3:40729329-40729351 ATGTATTTGCATGGTTTTGATGG + Intergenic
953276930 3:41510680-41510702 ATGTATTTGCATGGTTTTGAGGG - Intronic
955088578 3:55727097-55727119 CTGGATTTGCCTGCTACTAAGGG - Intronic
955859862 3:63317025-63317047 ATGTATTTTCATGGTTCTGAAGG + Intronic
956377153 3:68626320-68626342 ATGTATTTGCATGGTTTTGAGGG + Intergenic
956606973 3:71082997-71083019 CTGGATCTACGTGGTTTTAAGGG + Intronic
956950503 3:74276487-74276509 ATGTATTTGCATGGTTTTAAAGG - Intronic
956995426 3:74821924-74821946 ATGTATTTGCATGGTTCTTAAGG + Intergenic
957126984 3:76174087-76174109 TTTGATTTGCATTGCTCTAATGG + Intronic
957433162 3:80140007-80140029 ATGTATTTGCATGGTTTTGAGGG - Intergenic
957860912 3:85947212-85947234 CTTGATTTGCATTTTTCTGATGG - Intronic
958066423 3:88549571-88549593 ATGTATTTGCATGGTTTTGAGGG + Intergenic
958088070 3:88838505-88838527 ATGTATTTGCATGGTTTTGAAGG + Intergenic
958480559 3:94641005-94641027 ATGTATTTGCATGGTTTTGAAGG + Intergenic
958775397 3:98477007-98477029 ATGTACTTGCATGGTTTTAAGGG + Intergenic
958818731 3:98948447-98948469 ATGTATTTGCATGGTTTTGAGGG + Intergenic
958969688 3:100598280-100598302 ATGTATTTGCATGGTTTTGAAGG + Intergenic
959125681 3:102287967-102287989 ATTTATTTGCATGGTTTTAAGGG + Intronic
959325476 3:104931395-104931417 ATGTATTTGCATGGTTTTGAAGG + Intergenic
959666251 3:108925415-108925437 ATGTATTTGCATGGTTTTGAGGG + Intronic
959715500 3:109428761-109428783 ATGTATTTGCATGGTTTTGAAGG + Intergenic
959722066 3:109503137-109503159 ATGTATTTGCATTGTTTTAAAGG + Intergenic
959756737 3:109908575-109908597 ATGTATTTGCATGGTTTTGAAGG + Intergenic
959875379 3:111376045-111376067 ATGTATTTGCATGGTTTTGAAGG - Intronic
960512615 3:118569285-118569307 ATGTATTTGCATGGTTTTGAAGG + Intergenic
962013150 3:131413213-131413235 ATGTATTTGCATGGTTTTGAGGG - Intergenic
962147200 3:132852843-132852865 ATGTATTTGCATGGTTTTGAGGG + Intergenic
962401614 3:135064996-135065018 ATGTATTTGCATGGTTTTGAGGG + Intronic
962503133 3:136016110-136016132 ATGTATTTGCATGGTTTTGAGGG + Intronic
962504708 3:136034515-136034537 ATGTATTTGCATGGTTTTGAGGG + Intronic
962709653 3:138075503-138075525 ATGTATTTGCATGGTTTTGAGGG - Intronic
962999622 3:140666562-140666584 ATGTATTTGCATGGTTTTGAAGG - Intergenic
963399620 3:144781217-144781239 GTGGATTTGTATTCTTCTAATGG - Intergenic
964075887 3:152691137-152691159 ATGTATTTGCATGGTTTTAAGGG - Intergenic
964299622 3:155273809-155273831 ATGTATTTGCATGGTTTTGAGGG - Intergenic
964916100 3:161844022-161844044 ATGTATTTGCATGGTTTTGAAGG + Intergenic
965154260 3:165026669-165026691 ATGTATTTGCATGGTTTTGAAGG - Intronic
966234716 3:177687694-177687716 TTGGATTTGCCTGGATCTGAGGG - Intergenic
967488896 3:190065997-190066019 ATGTATTTGCATGGTTTTGAAGG + Intronic
970270625 4:14343432-14343454 CTGGCTTTGAAAGGTACTAATGG + Intergenic
970346493 4:15157952-15157974 ATGTATTTGCATGGTTTTCAAGG + Intergenic
970463844 4:16303899-16303921 CTGGACTTGCCTGGGTCTATGGG - Intergenic
970549065 4:17161213-17161235 ATGTATTTGCATGGTTTTGAAGG + Intergenic
971182876 4:24347057-24347079 ATGTATTTGCATGGTTTTGAAGG + Intergenic
971199509 4:24499389-24499411 CTGCACTTGCATGGTCCTGAGGG - Intergenic
971554741 4:27999733-27999755 ATGTATTTGCATGGTTTTCAGGG + Intergenic
971771679 4:30905375-30905397 CTGGAACTCCATGGTTCTATAGG + Intronic
971921651 4:32948069-32948091 ATGCATTTGCATGGTTTTGAAGG + Intergenic
971938308 4:33182490-33182512 ATGTATTTGCATGGTTTTGAGGG + Intergenic
972049045 4:34704993-34705015 ATGTATTTGCATGGTTCTGAAGG - Intergenic
972188832 4:36566218-36566240 ATGTATTTGCATGGTTTTGAAGG + Intergenic
972558016 4:40199895-40199917 GTGGATTTGCATTTTTTTAAAGG - Intronic
972827019 4:42770460-42770482 ATGTATTTGCATGGTTTTGAGGG - Intergenic
973179345 4:47249301-47249323 ATGTATTTGCATGGTTTTGAAGG + Intronic
973244285 4:47993970-47993992 CATGATTTGCATGGTTTTGAAGG + Intronic
974327703 4:60436353-60436375 ATGTATTTGCATGGTTTTGAAGG + Intergenic
975216271 4:71759616-71759638 CTTGATTTGCATGTATCTTAAGG + Intronic
975517535 4:75263023-75263045 ATGTATTTGCATGGTTTTGAAGG - Intergenic
975621063 4:76297092-76297114 CTGGATCTCCATAGTTCTACTGG + Intronic
976163921 4:82233133-82233155 CTGTATTTGAAAAGTTCTAATGG + Intergenic
976452440 4:85206164-85206186 ATGTATTTGCATGGTTTTGAAGG + Intergenic
976686090 4:87817022-87817044 ATGTATTTGCATGGTTTTGAAGG + Intergenic
976695124 4:87910789-87910811 CTGGGTTTGCTTGGGACTAAGGG + Intergenic
976791480 4:88883360-88883382 ATGTATTTGCATGGTTTTGAAGG - Intronic
977019703 4:91744177-91744199 ATGTATTTGCATGGTTCTGAAGG + Intergenic
977489459 4:97693863-97693885 ATGTATTTGCATGGTTTTGAGGG - Intronic
977513680 4:97994259-97994281 ATGTATTTGCATGGTTTTGAGGG + Intronic
977828963 4:101567334-101567356 ATGTATTTGCATGGTTTTGAGGG - Intronic
978201771 4:106030675-106030697 ATGTATTTGCATGGTTTTAAGGG + Intergenic
978316709 4:107445935-107445957 ATGTATTTGCATGGTTTTGAAGG + Intergenic
979202054 4:117990357-117990379 ATGTATTTGCATGGTTTTGAGGG - Intergenic
979381855 4:120015983-120016005 ATGTATTTGCATGGTTCTGAAGG + Intergenic
979638653 4:122986066-122986088 ATGTATTTGCATGGTTCTGAAGG + Intronic
979734731 4:124069384-124069406 CTGGATTAAAATGTTTCTAATGG - Intergenic
980086971 4:128401413-128401435 ATGTATTTGCATGGTTTTGAAGG + Intergenic
980152973 4:129071069-129071091 ATGTATTTGCATGGTTTTGAAGG + Intronic
980195010 4:129577556-129577578 ATGTATTTGCATGGTTTTGAAGG + Intergenic
981215820 4:142165945-142165967 TTGAATTTGCATTTTTCTAATGG + Intronic
981346926 4:143686674-143686696 ATGTATTTGCATGGTTTTGAAGG - Intronic
982829985 4:160047013-160047035 ATGTATTTGCATGGTTTTGAAGG - Intergenic
983569523 4:169189925-169189947 ATGTATTTGCATGGTTTTGAAGG - Intronic
984266421 4:177502735-177502757 ATGTATTTGCATGGTTTTCAAGG + Intergenic
984527322 4:180873060-180873082 ATGTATTTGCATGGTTTTGAAGG + Intergenic
984897737 4:184556886-184556908 TTGGATTTGCATATTTCTGATGG - Intergenic
985008373 4:185557520-185557542 ATGTATTTGCATGGTTTTGAAGG + Intergenic
986703854 5:10439126-10439148 CTGGCTGTGCATTGGTCTAATGG + Exonic
986870458 5:12039177-12039199 ATGCATTTGCATGGTTTTGAGGG - Intergenic
987563770 5:19557992-19558014 ATGTATTTGCATGGTTTTGAGGG - Intronic
988079357 5:26397011-26397033 TTTGATTTGCATTTTTCTAATGG - Intergenic
988420883 5:31004900-31004922 ATGCATTTGCATGGTTTTGAGGG + Intergenic
988619949 5:32812691-32812713 ATGGATATGCATGGTTCTTCAGG - Intergenic
988894913 5:35662151-35662173 TTTGATTTGCATGTATCTAATGG + Intronic
989533568 5:42537450-42537472 ATGTATTTGCATGGTTTTGACGG + Intronic
990080570 5:51908578-51908600 CTGGATTTTTAAGATTCTAAAGG + Intergenic
990233578 5:53741697-53741719 ATGTATTTGCATGGTTTTGAAGG - Intergenic
990243781 5:53841589-53841611 ATGTATTTGCATGGTTTTGAAGG - Intergenic
990245498 5:53859754-53859776 CTGGAGGTGCTTGGTTCTTAGGG - Intergenic
990803702 5:59633667-59633689 CAGGATTTGCTTGTTTGTAAAGG - Intronic
991387237 5:66103688-66103710 ATGTATTTGCATGGTTTTGAAGG - Intergenic
991499988 5:67267583-67267605 TTGGATATGCATGGTGATAAAGG + Intergenic
991924112 5:71686773-71686795 ATGTATTTGCATGGTTTTGAAGG - Intergenic
992339850 5:75812120-75812142 ATGTATTTGCATGGTTTTGAAGG + Intergenic
992520390 5:77545018-77545040 ATGTATTTGCATGGTTTTGAAGG - Intronic
993268027 5:85752714-85752736 TTGGATTTGCATTTTTTTAAAGG + Intergenic
993277599 5:85880690-85880712 ATGTATTTGCATGGTTTTGAAGG + Intergenic
993743507 5:91567376-91567398 ATGTATTTGCATGGTTTTGAAGG - Intergenic
993883646 5:93392394-93392416 ATGTATTTGCATGGTTTTGAAGG + Intergenic
993917295 5:93758592-93758614 ATGTATTTGCATGGTTTTGAAGG - Intronic
993948333 5:94141835-94141857 ATGTACTTGCATGGTTTTAAAGG + Intergenic
994051080 5:95363302-95363324 ATGTATTTGCATGGTTTTGAAGG + Intergenic
994496785 5:100522739-100522761 ATGTATTTGCATGGTTTTGAGGG - Intergenic
994545495 5:101162048-101162070 TTTGATTTGCATTTTTCTAATGG + Intergenic
994885081 5:105549646-105549668 CTGGAATTGGATGATACTAAAGG + Intergenic
995317674 5:110794930-110794952 ATGTATTTGCATGGTTTTGAAGG + Intergenic
995425204 5:112013652-112013674 CAGGACTTCCATGGTTCTGAAGG - Intergenic
995818062 5:116194015-116194037 ATGTATTTGCATGGTTTTGAAGG - Intronic
996010993 5:118481542-118481564 ATGTATTTGCATGGTTTTGAAGG - Intergenic
996025461 5:118640292-118640314 ATGTATTTGCGTGGTTTTAAAGG - Intergenic
996032207 5:118718070-118718092 ATGTATTTGCATGGTTTTGAAGG - Intergenic
996875148 5:128232727-128232749 ATGTATTTGCATGGTTTTGAGGG + Intergenic
997105732 5:131017366-131017388 ATGTATTTGCATGGTTTTGAAGG + Intergenic
999490910 5:152050663-152050685 ATGTATTTGCATGGTTTTGAGGG + Intergenic
999599643 5:153247852-153247874 ATGTATTTGCATGGTTTTGAAGG + Intergenic
999603373 5:153291374-153291396 CTTGATTTGCATTTTTCTGATGG + Intergenic
999801033 5:155036660-155036682 GTGTATTTGCATGGTTTTGAAGG + Intergenic
999839156 5:155405703-155405725 ATGTATTTGCATGGTTTTGAGGG - Intergenic
999913134 5:156227934-156227956 ATGTATTTGCATGGTTTTGAAGG + Intronic
1000867236 5:166528781-166528803 CTGGTTGTACATGTTTCTAAGGG + Intergenic
1001189343 5:169613317-169613339 ATGTATTTGCATGGTTTTGAAGG + Intergenic
1001693537 5:173651604-173651626 ATGTATTTGCATGGTTTTGAGGG + Intergenic
1001733525 5:173979102-173979124 ATGTATTTGCATGGTTTTGAGGG + Intronic
1002814103 6:662502-662524 ATGTATTTGCATGGTTTTGAAGG - Intronic
1003063395 6:2880141-2880163 ATGTATTTGCATGGTTTTGAAGG - Intergenic
1003451119 6:6232801-6232823 ATGTATTTGCATGGTTTTGAAGG - Intronic
1003582261 6:7350608-7350630 ATGTATTTGCATGGTTTTGAAGG - Intronic
1003930126 6:10916611-10916633 ATGTATTTGCATGGTTTTGAAGG + Intronic
1005072743 6:21877041-21877063 ATGTATTTGCATGGTTTTGAAGG - Intergenic
1005193137 6:23251337-23251359 ACATATTTGCATGGTTCTAATGG + Intergenic
1005305502 6:24510096-24510118 ATGTATTTGCATGGTTTTGAAGG + Intronic
1005760581 6:28963939-28963961 ATGTATTTGCATGGTTTTGAAGG - Intergenic
1006199190 6:32271342-32271364 ATGTATTTGCGTGGTTTTAAAGG - Intergenic
1007892960 6:45312986-45313008 ATGTATTTGCATGGTTTTGAGGG - Intronic
1008042054 6:46812759-46812781 ATGCATTTGCATGGTTTTGAGGG + Intronic
1008528381 6:52431494-52431516 ATGTATTTGCATGGTTTTGAAGG + Intronic
1009589316 6:65645382-65645404 ATGTATTTGCATGGTTTTGAAGG - Intronic
1009843460 6:69106307-69106329 CTGGAAATGCATGGTTGGAATGG - Intronic
1009969079 6:70607343-70607365 ATGTATTTGCATGGTTTTGAAGG - Intergenic
1010076127 6:71800970-71800992 ATGTATTTGCATGGTTTTGAAGG + Intergenic
1010164861 6:72903623-72903645 ATGTATTTGCATGGTTTTGAAGG + Intronic
1010531673 6:76976042-76976064 CTTGCTCTGCATGGTTCAAAGGG - Intergenic
1010707495 6:79132433-79132455 ATGTATTTGCATGGTTTTGAAGG + Intergenic
1011132887 6:84070386-84070408 ATGTATTTGCATGGTTTTGAAGG + Intronic
1011320976 6:86093015-86093037 ATGCATTTGCATGGTTTTAAGGG + Intergenic
1011619905 6:89233316-89233338 ATGTATTTGCATGGTTTTGAAGG + Intergenic
1011817340 6:91208288-91208310 ATGTATTTGCATGGTTTTGAAGG + Intergenic
1012156203 6:95822385-95822407 CTGTATTTGCATGGTTTTGGAGG - Intergenic
1012786445 6:103634300-103634322 ATGTATTTGCATGGTTCTGAAGG - Intergenic
1013900761 6:115153783-115153805 ATGTATTTGCATGGTTCTGAAGG + Intergenic
1013940813 6:115659557-115659579 ATGTATTTGCATGGTTTTGAAGG + Intergenic
1014337066 6:120149886-120149908 ATGTATTTGCATGGTTTTCAAGG - Intergenic
1014420076 6:121233000-121233022 ATGTATTTGCATGGTTTTGAGGG + Intronic
1014531156 6:122561333-122561355 ATGTATTTGCATGGTTCTGAAGG + Intronic
1014609506 6:123523541-123523563 CTGGATTAGCATGGACCTGAGGG + Intronic
1014803378 6:125802199-125802221 GTGGATCAGGATGGTTCTAAGGG + Intronic
1014967235 6:127770347-127770369 TTTGATTTGCATTTTTCTAATGG + Intronic
1015196615 6:130530383-130530405 ATGTATTTGCATGGTTTTGAGGG - Intergenic
1015565818 6:134569747-134569769 ATGTATTTGCATGGTTTTGAAGG - Intergenic
1015849466 6:137557110-137557132 ATGTATTTGCATGGTTTTGAAGG + Intergenic
1015877730 6:137840659-137840681 ATGTATTTGCATGGTTTTGAAGG + Intergenic
1016289726 6:142515903-142515925 ATGTATTTGCATGGTTTTCAAGG + Intergenic
1017155873 6:151322259-151322281 TTTGATTTGCATTTTTCTAAGGG + Intronic
1017415583 6:154216961-154216983 CTTGGTTTGCATGGTTTTATGGG - Intronic
1017556081 6:155570543-155570565 ATGTATTTGCATGGTTTTGAGGG + Intergenic
1018009645 6:159658142-159658164 ATGTATTTGCATGGTTTTGAAGG - Intergenic
1018168511 6:161124519-161124541 ATGTATTTGCATGGTTTTGAGGG + Intergenic
1018241148 6:161776013-161776035 ATGGACTTGAATGGTACTAATGG + Intronic
1020721967 7:11756675-11756697 ATGGATTTGCTTGTTTCTATCGG + Intronic
1021204531 7:17764244-17764266 ATGTATTTGCATGGTTTTGAAGG - Intergenic
1021340044 7:19454093-19454115 ATGTATTTGCATGGTTTTGAGGG + Intergenic
1021625938 7:22593179-22593201 TTAGTTTTGCTTGGTTCTAAGGG - Intronic
1023537505 7:41229033-41229055 ATGGATTTCCATGGTTTTGAGGG + Intergenic
1023692718 7:42808250-42808272 ATGTATTTGCATGGTTTTGAGGG - Intergenic
1023748677 7:43348802-43348824 ATGTATTTGCATGGTTTTAAAGG + Intronic
1024174972 7:46830027-46830049 ATGAATTTGCATGGTTTTGAGGG - Intergenic
1024367076 7:48533289-48533311 ATGTATTTGCATGGTTTTGAGGG + Intronic
1024665334 7:51541339-51541361 ATGTATTTGCATGGTTTTGAAGG + Intergenic
1024669053 7:51575088-51575110 ATGTATTTGCATGGTTTTGAAGG + Intergenic
1024745124 7:52397538-52397560 ATGTATTTGCATGGTTTTGAAGG + Intergenic
1024916979 7:54512839-54512861 ATGTATTTGCATGGTTTTGAAGG + Intergenic
1024946925 7:54817754-54817776 ATGTATTTGCATGGTTTTGAGGG + Intergenic
1025771963 7:64516814-64516836 ATGTATTTGAATGGTTTTAAAGG - Intergenic
1025773102 7:64531639-64531661 ATGTATTTGCATGGTTTTGAAGG - Intronic
1027328744 7:77068978-77069000 ATGTATTTGCATGGTTTTGAAGG + Intergenic
1027350167 7:77303775-77303797 ATGTATTTGCATGGTTTTGAAGG + Intronic
1028783109 7:94759801-94759823 ATGTATTTGCATGGTTTTGAGGG - Intergenic
1028818536 7:95178231-95178253 ATGTATTTGCATGGTTTTGAAGG - Intronic
1029787027 7:102802389-102802411 ATGTATTTGCATGGTTTTGAAGG - Intronic
1030278124 7:107742123-107742145 CTGGATTTCCATGAATCTGAAGG + Intergenic
1031475385 7:122215031-122215053 CTGAAATTGAATGGGTCTAAGGG + Intergenic
1031673245 7:124578066-124578088 CTGCATTTTCATGGTTTTATTGG + Intergenic
1031683530 7:124704244-124704266 CTGCATTTGCATGTTTATCACGG - Intergenic
1031761022 7:125713609-125713631 ATGTATTTGCATGGCTCTGAAGG + Intergenic
1031879460 7:127179697-127179719 ATGCATTTGCATGGTTCTGAAGG - Intronic
1033451550 7:141466453-141466475 CTGGATATACATGATTCTCATGG - Intronic
1033545326 7:142394347-142394369 CTGGAGTTGCATGGATATCAGGG + Intergenic
1033623127 7:143080423-143080445 ATGTATTTGCATGGTTTTGAAGG - Intergenic
1034507103 7:151501637-151501659 CTGTATTTGCATGTTTATACTGG + Intronic
1034592760 7:152156975-152156997 CTTGATTTGCATGGTGTTATTGG - Intronic
1034705270 7:153137145-153137167 ATGTATTTGCATGGTTTTGAAGG + Intergenic
1034822807 7:154232477-154232499 CTGGATTGGAATGGTGTTAAGGG + Intronic
1035427683 7:158791645-158791667 CTAGATTTGCATTTTCCTAATGG + Intronic
1038237311 8:25771889-25771911 ATGTATTTGCATGGTTCTGAAGG - Intergenic
1038363008 8:26901744-26901766 GTGGATTTGCATGGATAGAAGGG + Intergenic
1038469427 8:27800881-27800903 CTGGATTTGCCTGCCTCTTATGG - Intronic
1039030329 8:33302028-33302050 ATGTATTTGCATGGTTTTGAGGG - Intergenic
1039494348 8:37969416-37969438 ATGGATTTCCATGGATCCAAAGG - Intergenic
1039672747 8:39621208-39621230 CTTAATTTGCATTTTTCTAATGG - Intronic
1039810270 8:41041604-41041626 ATGTATTTGCATGGTTTCAAAGG + Intergenic
1040442595 8:47459928-47459950 ATGTATTTGCATGGTTTTGAAGG + Intronic
1040809558 8:51436559-51436581 ATGTATTTGCATGGTTTTGAGGG - Intronic
1041112514 8:54497867-54497889 ATGTATTTGCATGGTTTTGACGG + Intergenic
1041150545 8:54928273-54928295 GTGTATTTGCATGGTTTTGAGGG - Intergenic
1041570302 8:59330690-59330712 ATGTATTTGCATGGTTTTGAAGG + Intergenic
1041621742 8:59977907-59977929 CTGGATTTGCTTTATTCTTATGG - Intergenic
1041637359 8:60158926-60158948 ATGTATTTGCATGGTTTTGAAGG - Intergenic
1042160813 8:65892791-65892813 GTGAATTTGCATGGTTCTGAGGG - Intergenic
1042375615 8:68047729-68047751 CAGGATTTGCATAATTCAAATGG - Intronic
1042380898 8:68113007-68113029 CTGGAATTGCATGCTGCTGAAGG + Intronic
1042995748 8:74696170-74696192 ATGTATTTGCATGGTTTTGAGGG - Intronic
1043476441 8:80610343-80610365 CTTGATTTGCCTGGGACTAAGGG + Intergenic
1044788018 8:95816719-95816741 ATGTATTTGCATGGTTTTGAAGG + Intergenic
1044903562 8:96974712-96974734 ATGTATTTACATGGTTTTAAGGG - Intronic
1045122018 8:99048141-99048163 ATGTATTTGCATGGTTTTGAAGG + Intronic
1045440890 8:102209401-102209423 CTTGATTTGCATGTCTCTAATGG - Intronic
1045780067 8:105852241-105852263 ATGTATTTGCATGGTTTTGAAGG - Intergenic
1045881230 8:107043174-107043196 GTGTATTTGCATGGTTTTGAAGG + Intergenic
1046493623 8:114985285-114985307 TTGGATTTGCATTTTTCTGATGG + Intergenic
1046734209 8:117758853-117758875 CTGAATTTGCATGGTCTTGAAGG + Intergenic
1047032606 8:120898791-120898813 ATGTATTTGCATGGTTTTGAAGG - Intergenic
1047937189 8:129794032-129794054 ATGCATTTGCATGGTTTTGAGGG + Intergenic
1048815192 8:138326726-138326748 CTGGATTTGCAGTTTACTAATGG + Intronic
1049295741 8:141835661-141835683 TTGTATTTGCATGGTTCCGAAGG + Intergenic
1049869495 8:144962948-144962970 ATGTATTTGCATGGTTTTGAAGG + Intergenic
1050354439 9:4769649-4769671 CTCATTTTCCATGGTTCTAAGGG - Intergenic
1051601126 9:18875541-18875563 ATGTATTTGCATGGTTTTGAAGG + Intronic
1051687432 9:19672827-19672849 ATGTATTTGCATGGTTTTGAGGG + Intronic
1051733435 9:20172062-20172084 ATGTATTTGCATGGTTTTGAAGG - Intergenic
1051816718 9:21117038-21117060 ATGTATTTGCATGGTTTTGAGGG + Intergenic
1051982849 9:23045616-23045638 CTGGAAGTGCATGGATCCAAGGG + Intergenic
1052247202 9:26350148-26350170 CTGTATTTGCATGATTTTGAAGG - Intergenic
1054865897 9:70000648-70000670 CTGGATTTGTTTGGATCTAGAGG + Intergenic
1055138141 9:72846769-72846791 ATGTATTTGCATGGTTTTGAAGG - Intergenic
1056437938 9:86591022-86591044 CTGGATTTGACTGGAACTAAAGG + Intergenic
1057295388 9:93832251-93832273 TTTGATTTGCATTTTTCTAATGG + Intergenic
1057306808 9:93917025-93917047 CTGCATCTGTATGGTTCCAATGG + Intergenic
1057475949 9:95401860-95401882 ATGTATTTGCATGGTTTTGAGGG - Intergenic
1059022050 9:110586844-110586866 ATGTATTTGCATGGTTATGAAGG + Intergenic
1059674005 9:116519355-116519377 ATGTATTTGCATGGTTTTGAGGG - Intronic
1060679416 9:125547889-125547911 CTGGCTTTGCATGATGATAATGG + Intronic
1062705644 9:137939413-137939435 ATGTATTTGCATGGTTTTGAGGG - Intronic
1186677157 X:11830749-11830771 CTAGATTTGGATGTTTATAAAGG - Intergenic
1187218964 X:17305399-17305421 ATGTATTTGCATGGTTTTGAAGG + Intergenic
1187695917 X:21920047-21920069 CCGTATTTGCATGGTTTTTAGGG + Intergenic
1187748947 X:22440257-22440279 ATGTATTTGCATGGTTTTGAAGG - Intergenic
1188145036 X:26601492-26601514 ATGGATTTGCATTGATCTATAGG - Intergenic
1188389129 X:29598318-29598340 ATGTATTTGCATGGTTTTGAGGG + Intronic
1188994419 X:36865567-36865589 CAATATTTGCATGGTGCTAAGGG - Intergenic
1189218418 X:39347460-39347482 ATGTATTTGCATGGTTTTGAAGG - Intergenic
1189567434 X:42257558-42257580 ATGAATTTGCATGGTTTTGAGGG - Intergenic
1189650177 X:43180361-43180383 ATGTATTTGCATGGTTTTGAAGG + Intergenic
1189878909 X:45468767-45468789 GTGTATTTGCATGGTTTTGAAGG + Intergenic
1189962287 X:46335388-46335410 ATGTATTTGCATGGTTTTGAAGG - Intergenic
1190153521 X:47968034-47968056 CTGTTTTTGCATTGTTGTAAAGG - Intronic
1190897036 X:54630546-54630568 ATGTATTTGCATGGTTTTGAGGG + Intergenic
1191065720 X:56345094-56345116 ATGTATTTGCATGGTTTTGAAGG - Intergenic
1191100502 X:56721743-56721765 ATGTATTTGCATGGTTTTGAGGG - Intergenic
1191819986 X:65295253-65295275 ATGTATTTGCATGGTTTTTAAGG - Intergenic
1191888665 X:65917865-65917887 GTGTATTTGCATGGTTTTGAGGG + Intergenic
1191906051 X:66091556-66091578 ATGTATTTGCATGGTTTTGAAGG + Intergenic
1191970710 X:66812948-66812970 GTGTATTTGCATGGTTATGAGGG + Intergenic
1191994309 X:67074640-67074662 ATGTATTTGCATGGTTTTTAAGG - Intergenic
1192298281 X:69873094-69873116 ATGTATTTGCATGGTTTTGAGGG - Intronic
1192609936 X:72557421-72557443 ATGTATTTGCATGGTTTTGAGGG - Intronic
1192673792 X:73173353-73173375 ATGTATTTGCATGGTTTTGAGGG + Intergenic
1193446694 X:81614072-81614094 ATGTATTTGCATGGTTTTGAGGG + Intergenic
1193578754 X:83235223-83235245 ATGTATTTGCATGGTTTTGAAGG - Intergenic
1194237478 X:91401961-91401983 ATGTATTTGCATGGTTTTGAAGG - Intergenic
1194359056 X:92925143-92925165 TTTGATTTGCATTTTTCTAATGG - Intergenic
1194381328 X:93194986-93195008 ATGTATTTGCATGGTTTTGAGGG - Intergenic
1194504954 X:94723077-94723099 ATGTATTTGCATGGTTTTGAGGG + Intergenic
1194543233 X:95201081-95201103 ATGCATTTGCATGGTTTTGAAGG + Intergenic
1194630500 X:96276992-96277014 ATGTATTTGCATGGTTTTGAAGG - Intergenic
1194926437 X:99830703-99830725 ATGTATTTGCATGGTTTTGAAGG + Intergenic
1194955797 X:100178922-100178944 ATGTATTTGCATGGTTTTGAAGG - Intergenic
1194967580 X:100306261-100306283 ATGTATTTGCATGGTTTTGAAGG - Intronic
1195019273 X:100810307-100810329 ATGTATTTGCATGGTTTTGAAGG + Intergenic
1195237350 X:102914038-102914060 ATGTATTTGCATGGTTTTTAAGG - Intergenic
1195949268 X:110250006-110250028 CTGCAGTTGAATAGTTCTAAGGG + Intronic
1196024383 X:111024996-111025018 ATGTATTTGCATGGTTTTGAGGG - Intronic
1196180006 X:112679403-112679425 CTGGATTTGCCTAAATCTAAGGG - Intronic
1196219132 X:113090752-113090774 GTGTATTTGCATGGTTTTAAAGG - Intergenic
1196434863 X:115665486-115665508 CTGGAAATGCTTGGTTCTTAGGG - Intergenic
1196530919 X:116785407-116785429 ATGTATTTGCATGGTTTTGAAGG - Intergenic
1196720530 X:118849534-118849556 CTTGATTAGAATGGTTCAAAAGG + Intergenic
1197054142 X:122096980-122097002 ATTTATTTGCATGGTTTTAAGGG + Intergenic
1197055274 X:122111320-122111342 ATGTATTTGCATGGTTTTGAAGG + Intergenic
1197120312 X:122883120-122883142 ATGTATTTGCATGGTTTTGAGGG - Intergenic
1197184612 X:123572848-123572870 ATGCATTTGCATGGTTTTGAGGG - Intergenic
1197515313 X:127420653-127420675 ATGTATTTGCATGGTTTTGAGGG + Intergenic
1197664379 X:129208002-129208024 ATGTATTTGCATGGTTTTAAAGG + Intergenic
1197668844 X:129253515-129253537 ATGTATTTGCATGGTTTTGAAGG + Intergenic
1197671351 X:129281667-129281689 ATGTATTTGCATGGTTTTGAAGG + Intergenic
1197911223 X:131484523-131484545 ATGTATTTGCATGGTTTTAAAGG - Intergenic
1197953932 X:131926269-131926291 ATGTATTTGCATGGTTTTGAAGG - Intergenic
1198559644 X:137835514-137835536 ATGTATTTGCATGGTTTTGAGGG + Intergenic
1198695974 X:139338568-139338590 ATGTATTTGCATGGTTTTGAGGG + Intergenic
1199054745 X:143280471-143280493 TTAGGTTTGCATGGTTCTAAGGG - Intergenic
1199103510 X:143835595-143835617 ATGTATTTGCATGGTTTTGAAGG - Intergenic
1199493014 X:148422136-148422158 TTGGATCTGTCTGGTTCTAAAGG - Intergenic
1199668792 X:150123660-150123682 ATGTATTTGCATGGTTTTGAAGG - Intergenic
1200667265 Y:6041149-6041171 TTTGATTTGCATTTTTCTAATGG - Intergenic
1200934653 Y:8727759-8727781 CTGGATTTGCCTGGTAATCAAGG - Intergenic