ID: 1162715945

View in Genome Browser
Species Human (GRCh38)
Location 19:12633647-12633669
Sequence GATGCTTGGGCCACACATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 148}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162715945_1162715949 -1 Left 1162715945 19:12633647-12633669 CCTTCATGTGTGGCCCAAGCATC 0: 1
1: 0
2: 0
3: 5
4: 148
Right 1162715949 19:12633669-12633691 CTATTTCAGACTGTCATGGTTGG 0: 1
1: 0
2: 2
3: 10
4: 151
1162715945_1162715948 -5 Left 1162715945 19:12633647-12633669 CCTTCATGTGTGGCCCAAGCATC 0: 1
1: 0
2: 0
3: 5
4: 148
Right 1162715948 19:12633665-12633687 GCATCTATTTCAGACTGTCATGG 0: 1
1: 0
2: 0
3: 9
4: 123
1162715945_1162715950 14 Left 1162715945 19:12633647-12633669 CCTTCATGTGTGGCCCAAGCATC 0: 1
1: 0
2: 0
3: 5
4: 148
Right 1162715950 19:12633684-12633706 ATGGTTGGCATTGTTCTCTGAGG 0: 1
1: 0
2: 0
3: 29
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162715945 Original CRISPR GATGCTTGGGCCACACATGA AGG (reversed) Intronic
901046199 1:6397281-6397303 GCTGCTTGGGACACAAATCAGGG + Intergenic
902725354 1:18332093-18332115 TATGCTTGGGTGACACATGTAGG - Intronic
905742580 1:40385162-40385184 CAAGCTTCAGCCACACATGAGGG - Intronic
905944497 1:41890352-41890374 GATGCTCGGGGCACAAATGAGGG + Intronic
907219102 1:52892238-52892260 GATGTTTGGGCCAGGCATGGTGG + Intronic
909347763 1:74612224-74612246 GATGCTTGGCACACACTTTAAGG + Intronic
913264370 1:117030115-117030137 GATCCTTGGGCCAGATGTGATGG + Intronic
919250872 1:195054571-195054593 GAGGCTCAGGCCACACAGGAGGG - Intergenic
921463198 1:215453567-215453589 TATACTTGGACCACACAGGAAGG + Intergenic
1065388409 10:25157017-25157039 GGTTCTTGGGCCTCACATGGTGG - Intergenic
1066441004 10:35438441-35438463 GATGGTTAGGCCAAGCATGATGG - Intronic
1068101163 10:52554899-52554921 GATTTCTAGGCCACACATGAAGG - Intergenic
1068363339 10:56010716-56010738 GATGCTTGGACCCCAACTGAAGG + Intergenic
1073101298 10:101008128-101008150 GAGGCTTGGGCGACTCATAAGGG + Intronic
1073560905 10:104496041-104496063 GCTGCTGGGGCCACATATGGAGG - Intergenic
1074318670 10:112381055-112381077 GATGATCTGGCCAGACATGATGG - Intronic
1074758010 10:116641594-116641616 GATGCTGAGGCCACACAGCATGG - Intronic
1076080113 10:127572196-127572218 GATGATTTGGCCAGACATGGTGG + Intergenic
1076083576 10:127605706-127605728 GATGTCTGGGCCACTCAGGAAGG + Intergenic
1077601155 11:3575862-3575884 GATGCTGGTGACTCACATGACGG - Intergenic
1077826217 11:5810686-5810708 AATGAATGTGCCACACATGAAGG + Intronic
1079981479 11:27155678-27155700 GCTCCCTGGGCCACACATGGGGG - Intergenic
1080446000 11:32337701-32337723 GCTGATTGGGCCACACATGGTGG - Intergenic
1084257074 11:67950437-67950459 GATGCTGGTGACTCACATGACGG - Intergenic
1084815704 11:71644831-71644853 GATGCTGGTGACTCACATGACGG + Intergenic
1085344286 11:75757661-75757683 GACGCTTGGGGCAGCCATGAAGG + Intergenic
1087749860 11:101995410-101995432 GATGCCTGGGTCATACCTGAGGG + Intronic
1089000781 11:115050524-115050546 GATGCTTGGTCCACATGTGGAGG - Intergenic
1089201649 11:116728154-116728176 GACTCTTGAGCCACACCTGATGG + Intergenic
1090088600 11:123673577-123673599 GAGGCTTGGGCCAGGCATGGTGG + Intergenic
1090924324 11:131236215-131236237 TTTGCCTGGGCCACACATGCTGG + Intergenic
1092427307 12:8385221-8385243 GATGCTGGTGACTCACATGACGG - Intergenic
1094677155 12:32631789-32631811 GCTGTTTGGGCCAGACATGGTGG - Intronic
1095943390 12:47740338-47740360 GTTGCTGAGGCCAAACATGACGG + Exonic
1104832178 12:131760784-131760806 GTTGCTGGGGCCAGACATGGTGG + Intronic
1112820985 13:103334876-103334898 GAAACTTGGGGCACAAATGAAGG - Intergenic
1114533735 14:23410490-23410512 GAGGCTTCGGCCACAGGTGAGGG + Intergenic
1119485737 14:74985253-74985275 GATGCCTGGCACACACCTGAGGG - Intergenic
1120407951 14:84113268-84113290 AATGCTTTGTCCTCACATGACGG - Intergenic
1121197569 14:92087722-92087744 AATGCTTGGGCCCCACAGTAGGG + Intronic
1122465930 14:101933498-101933520 GGGTCTTGGGCCACACAGGATGG - Intergenic
1122474180 14:101995051-101995073 GATGCTAGGATCAAACATGACGG + Exonic
1123477080 15:20597858-20597880 GATGGTTGTGACACCCATGAGGG - Intergenic
1123640933 15:22402506-22402528 GATGGTTGTGACACCCATGAGGG + Intergenic
1124472738 15:30002686-30002708 GATGCAGGGGCCATGCATGATGG - Intergenic
1125568936 15:40699571-40699593 GATGCTTTGGCCAGGCATGGTGG - Intronic
1125726521 15:41871105-41871127 GATGGTGGGGCCAGACATCAGGG - Intronic
1125930977 15:43599983-43600005 GTTGCATGGGCCCAACATGAGGG - Exonic
1125944141 15:43699799-43699821 GTTGCATGGGCCCAACATGAGGG - Intergenic
1127199390 15:56626742-56626764 GATTATTGGGCCACACTTTAAGG - Intergenic
1127348376 15:58124850-58124872 GATTCTTGTGCAAGACATGAAGG - Intronic
1127381576 15:58434904-58434926 TATGCTTGTGACACTCATGAGGG - Intronic
1130048426 15:80463890-80463912 GATGTTTGGCTCTCACATGATGG + Intronic
1133985414 16:10664599-10664621 GATGCCTGGGCCTCACTTTAGGG - Intronic
1137707607 16:50546419-50546441 GTTGCGAGGGCTACACATGATGG + Intergenic
1139322507 16:66126853-66126875 CAGTCTTAGGCCACACATGATGG + Intergenic
1140104313 16:71945728-71945750 GGTGCTTGGAACACACATGCTGG - Intronic
1141698715 16:85632755-85632777 GGCGCTGGGGCCACACATGGTGG - Intronic
1145209281 17:21001262-21001284 CAGGCTTCTGCCACACATGATGG + Exonic
1150333606 17:64314009-64314031 GATGCCTGGGGCACCCAGGAAGG - Intergenic
1153112606 18:1610133-1610155 AATAATTAGGCCACACATGATGG + Intergenic
1153932233 18:9888032-9888054 AAAGGTTGGGACACACATGATGG - Exonic
1157778799 18:50419444-50419466 TATGTTTGGGGTACACATGAAGG + Intergenic
1162715945 19:12633647-12633669 GATGCTTGGGCCACACATGAAGG - Intronic
1166486978 19:43222006-43222028 GAGGCTCGGGCCGCACATGGAGG + Intronic
1167764249 19:51469614-51469636 GAGGCATGGGACACTCATGAGGG + Intergenic
1168320055 19:55503753-55503775 GAGGCTTGGGCCTCTCAGGAGGG - Intronic
924987347 2:284267-284289 GATGATTGGTCTGCACATGAAGG - Intronic
927223508 2:20737964-20737986 GATTCTTGGGCCGGACATGGTGG + Intronic
929602498 2:43213122-43213144 GATGGTTGGGCAACCTATGAGGG + Intergenic
929930597 2:46252760-46252782 AATGCTGGGGACACACAAGAAGG - Intergenic
931128164 2:59301143-59301165 GATGCTTAGACCACACTTTAAGG - Intergenic
932224625 2:70029837-70029859 GGTCCTTGGGCCACAAATGGTGG + Intergenic
935960135 2:108417580-108417602 GATGCATGGGCCACATAACATGG - Intergenic
936842187 2:116784524-116784546 GATGTATGGGCCACACAGAAAGG + Intergenic
940604351 2:155901178-155901200 GGCACTTGGGCCAAACATGATGG - Intergenic
942367598 2:175244062-175244084 GATATTTGGGCCAAACTTGATGG + Intergenic
942687156 2:178545372-178545394 GATTCTTGGAGCTCACATGATGG + Exonic
943748834 2:191490257-191490279 GATCCTTAGGCCAGGCATGATGG + Intergenic
945857512 2:215086138-215086160 GATCCTTTGGCCAGTCATGATGG - Intronic
946894215 2:224306685-224306707 AATGCTGGGGCCAGACATGGTGG + Intergenic
947050645 2:226038908-226038930 GATGCTTGGGCCAAAATGGATGG + Intergenic
947620492 2:231587548-231587570 TATGCTTGGGCCAGGCATGGTGG - Intergenic
1168809258 20:693369-693391 GATGGAGGGGCCACACATCAAGG - Intergenic
1175515721 20:59568645-59568667 GATGTCAGGGGCACACATGAGGG - Intergenic
1176264186 20:64200127-64200149 GATGCTGGTGCGCCACATGATGG - Intronic
1179019419 21:37624916-37624938 CAGGCTTGGGCCACAAATGAGGG + Exonic
1181260525 22:21593946-21593968 GATGATTATGCCAGACATGAAGG + Intronic
1182550156 22:31096645-31096667 GGTGCATGGGGCACACAAGACGG - Intronic
1183986475 22:41573055-41573077 AATGTTTGGGCCAGACATGGTGG + Intronic
1184102884 22:42350466-42350488 GATGCTGGGGCCAGGCATGGTGG - Intergenic
1184552469 22:45211910-45211932 GATGCTTGGGGCACAGACGCAGG + Intronic
1185423246 22:50747081-50747103 AATGCTTTGGCCACATAGGAGGG + Intergenic
950334200 3:12180695-12180717 TATGCTTTGGCCACCCTTGATGG - Intronic
950461506 3:13124945-13124967 GATGCCCTGGCCAAACATGACGG - Intergenic
950750488 3:15124284-15124306 GATGCTGGTGACTCACATGACGG + Intergenic
951426641 3:22553673-22553695 GGTGCTAGGACCACACATAATGG - Intergenic
952717490 3:36494696-36494718 GATTCTTTGGCATCACATGAGGG + Intronic
952736527 3:36696975-36696997 GAGGCTGTGGCCACACTTGAGGG - Intergenic
959110458 3:102116426-102116448 GCTGTTTGGGCCACAGAGGAGGG - Intronic
961173679 3:124816929-124816951 GATTCTTTGGCCAGGCATGATGG + Intronic
961282126 3:125772171-125772193 GATGCTGGTGACTCACATGACGG + Intergenic
962886001 3:139628557-139628579 AATGCTTGGGCCCCAGATAAAGG - Intronic
963348304 3:144122956-144122978 GATGGTTGTGCCACAAATGGTGG - Intergenic
963871192 3:150415783-150415805 GAAGCCTGGGCCACACAGCAAGG + Intronic
964463259 3:156960571-156960593 TATGCTTGGGCCAGGCATGGTGG - Intronic
969158445 4:5233719-5233741 GAGGCTGGGGTCACACATGCGGG + Intronic
969998827 4:11343372-11343394 GCTGCTTGTGCCACACAGGGTGG - Intergenic
972541652 4:40044118-40044140 GATGTCTGGGCCAGACATGCTGG + Intergenic
975048950 4:69835239-69835261 GATGCTTTGGAAACACATAAAGG - Intronic
981740279 4:147994323-147994345 GTTGCTTGAGCCACACATGCCGG + Intronic
983767266 4:171499795-171499817 GAGGCTTGTGCCAGACATGTTGG - Intergenic
986254050 5:6087113-6087135 GCTTCTTGGGCCTCACATGGAGG + Intergenic
986471897 5:8084131-8084153 AATGCATGGGAGACACATGATGG - Intergenic
987805306 5:22757634-22757656 TATGCTTTGGAGACACATGAAGG - Intronic
988709364 5:33758208-33758230 GATGCCTGGGCCACAAGTTAAGG + Intronic
991602787 5:68370322-68370344 TATGCTTGGACCTCACATTATGG - Intergenic
992828795 5:80573971-80573993 GATGCTTGGGCCAGGCGTGGTGG + Intergenic
995526741 5:113056164-113056186 GACGCTTGGGTCACACGTAAAGG - Intronic
997726552 5:136125662-136125684 GATGCTTTGGCAGCATATGATGG + Intergenic
998368275 5:141644938-141644960 CCTGCCTGGGCCACACACGAAGG + Exonic
999410962 5:151349419-151349441 GATGCCTGGGCCACTCGTGTTGG - Intergenic
1002254676 5:177950457-177950479 GCTGGATGGGCCACACCTGAGGG - Intergenic
1002483310 5:179517362-179517384 GGTGGATGGGCCACACCTGAAGG + Intergenic
1006317979 6:33301708-33301730 GAAGCTTGGGCCAGAGATGATGG + Intronic
1013174837 6:107668375-107668397 GATGCTTGGGAAACAGTTGAAGG - Intergenic
1020653596 7:10904215-10904237 GTTTCTTTGGCCACACGTGAAGG + Intergenic
1022515663 7:30973842-30973864 GCTCCTTGGGCCACCCAAGAGGG - Intronic
1023447792 7:40250108-40250130 TATTCTTGGGCCAGACATGGTGG + Intronic
1023899229 7:44462356-44462378 GATGCTAGTGGCACACATTATGG - Intronic
1026516391 7:71076960-71076982 GATCATTTGACCACACATGAAGG - Intergenic
1028169753 7:87581972-87581994 GATGCTTGTCCCAGAGATGAGGG - Intronic
1029074272 7:97923871-97923893 GATGCTGGTGACTCACATGACGG - Intergenic
1031999919 7:128258151-128258173 GATTCTTGGGCCAGGCACGATGG + Intergenic
1033160706 7:138993891-138993913 TCTGCTGTGGCCACACATGATGG - Intergenic
1036243435 8:7097417-7097439 GATGCTGGTGACTCACATGACGG + Intergenic
1036829290 8:12009774-12009796 GATGCTGGTGACTCACATGACGG - Intergenic
1037143424 8:15544939-15544961 GATTCTTGTGTCACAGATGAAGG + Intronic
1042210214 8:66372499-66372521 GAGGCTTGGGCCAGGCATGGTGG - Intergenic
1049272356 8:141702677-141702699 CATGCATGAGCCACACCTGAAGG - Intergenic
1050034512 9:1421397-1421419 AGTGCTTGGGGCACACTTGAAGG - Intergenic
1051996854 9:23227752-23227774 GATACTTGGGCCAGACATCGTGG + Intergenic
1052743409 9:32415912-32415934 TATGCTTGGCCCTCAAATGAAGG - Intronic
1054864819 9:69989369-69989391 GAAGCCTGGGCCACAGATGGAGG + Intergenic
1056770995 9:89478375-89478397 GACACTGGGGCCACACAAGAGGG + Intronic
1058024132 9:100121862-100121884 GGTTCTTGCACCACACATGAGGG - Intronic
1061481664 9:130900472-130900494 GCTGCTTGGGCCACACAGTTTGG + Intergenic
1061656805 9:132098151-132098173 AACCCTTGGGCCACACATCAAGG + Intergenic
1189752744 X:44239084-44239106 TATGGTTGGAACACACATGAAGG + Intronic
1190733651 X:53241061-53241083 GATGCTTGGGCCAGGCACGGTGG - Intronic
1193240066 X:79158005-79158027 AATACTTGGGTTACACATGAAGG - Intergenic
1195322953 X:103735543-103735565 GATAATTTGGACACACATGAGGG - Intergenic
1198316132 X:135468422-135468444 GATGCTAGGGCCCCAGAGGAGGG + Intergenic
1200766937 Y:7088083-7088105 GTATCTTGGGCCACACCTGAGGG + Intronic