ID: 1162717846

View in Genome Browser
Species Human (GRCh38)
Location 19:12645110-12645132
Sequence CTGTGGTCCCACTTGGGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 249}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162717846_1162717859 18 Left 1162717846 19:12645110-12645132 CCATGCCCCAAGTGGGACCACAG 0: 1
1: 0
2: 3
3: 26
4: 249
Right 1162717859 19:12645151-12645173 CCCACCCTGGCATCCCTAGGTGG 0: 1
1: 0
2: 0
3: 40
4: 643
1162717846_1162717856 15 Left 1162717846 19:12645110-12645132 CCATGCCCCAAGTGGGACCACAG 0: 1
1: 0
2: 3
3: 26
4: 249
Right 1162717856 19:12645148-12645170 CACCCCACCCTGGCATCCCTAGG 0: 1
1: 2
2: 3
3: 27
4: 386
1162717846_1162717850 -8 Left 1162717846 19:12645110-12645132 CCATGCCCCAAGTGGGACCACAG 0: 1
1: 0
2: 3
3: 26
4: 249
Right 1162717850 19:12645125-12645147 GACCACAGCAGAGTGTCCCCTGG 0: 1
1: 0
2: 4
3: 21
4: 209
1162717846_1162717852 5 Left 1162717846 19:12645110-12645132 CCATGCCCCAAGTGGGACCACAG 0: 1
1: 0
2: 3
3: 26
4: 249
Right 1162717852 19:12645138-12645160 TGTCCCCTGGCACCCCACCCTGG 0: 1
1: 0
2: 2
3: 36
4: 764

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162717846 Original CRISPR CTGTGGTCCCACTTGGGGCA TGG (reversed) Intronic
902067614 1:13700661-13700683 CTGGGGCCCCACGTGGGGCCGGG + Intronic
902479206 1:16702770-16702792 CTGTGGTCCCACAGGAGGCTTGG + Intergenic
903646453 1:24898962-24898984 CTGTGGTCCCAGTTCAGCCATGG + Intergenic
904498064 1:30898619-30898641 CTCTGGTTCCTCTTGGGCCAGGG - Intronic
904615310 1:31746368-31746390 CTGTGGTCCCAAGAGAGGCAGGG - Intronic
904705125 1:32384168-32384190 CTGCAGCCCCACTTGGGGGATGG - Intronic
905216878 1:36414961-36414983 CTCAGGTCCCACCTGGGGCAGGG + Intergenic
905443527 1:38009545-38009567 CTGTGTTCTCACTAGGGGGAAGG - Intronic
908267985 1:62397183-62397205 CTGTGGCCCCACTTTGGGATGGG - Intergenic
909556463 1:76959841-76959863 CTGAGAACCCACTTTGGGCAAGG - Intronic
910463357 1:87471162-87471184 CTGTGTTACCACTTGGAGAAGGG + Intergenic
910672336 1:89785780-89785802 ATGTGTTTCTACTTGGGGCAAGG + Intronic
910733200 1:90421305-90421327 CTTTGGACCCACCTGGGGCCTGG + Intergenic
912242730 1:107927824-107927846 CTCTGGACCCACCTGGGGCCTGG + Intronic
913191327 1:116415860-116415882 CTGTGGTCACACTTGGGGGAGGG - Intergenic
913416788 1:118618191-118618213 CTCTGGACCCACCTGGGGCCTGG - Intergenic
914352142 1:146849695-146849717 CTGGGTTACCACTTGGTGCATGG - Intergenic
915081656 1:153356905-153356927 CTGTGTTCCCACAGTGGGCAGGG + Intergenic
916453838 1:164949771-164949793 GAGTGGTTGCACTTGGGGCAAGG + Intergenic
918516663 1:185370767-185370789 CTGTGGTCCCAGTTGCTTCAGGG - Intergenic
919287662 1:195585246-195585268 CTATGGACCCACCTGGGGCCAGG + Intergenic
919731518 1:200916285-200916307 CTGGGGTCCCACTGAGGCCAGGG + Intergenic
920080250 1:203367848-203367870 CTTTGGGCCCATTTAGGGCAAGG + Intergenic
920744989 1:208617697-208617719 CTCTGGACCCACCTGGGGCCTGG + Intergenic
923552909 1:234978465-234978487 CTGTGAGCCCACTTTGGGAAAGG - Intergenic
923593055 1:235337704-235337726 CTGTAGTCCCAGCTGAGGCACGG + Intronic
924490743 1:244535357-244535379 CTCTGGACCCACATGGGGCCTGG - Intronic
1063059093 10:2532254-2532276 CTGTGGTCTCACTTGAGACTAGG - Intergenic
1067781303 10:49209335-49209357 CTGTGCTGTCACTGGGGGCAAGG - Intergenic
1069430131 10:68327288-68327310 CGATGGTCACACTGGGGGCAGGG - Intronic
1070280605 10:75045507-75045529 CTGTGGTCCTGCTTCAGGCAAGG + Intronic
1072610840 10:97016957-97016979 CTGTGGTACGAGCTGGGGCAGGG + Intronic
1072761696 10:98062077-98062099 CTGTGGAGTCACTGGGGGCAGGG + Intergenic
1073679758 10:105689993-105690015 CTGTTGTTACACTGGGGGCAGGG + Intergenic
1074563942 10:114559561-114559583 CTGGGGTCTCCCTCGGGGCAGGG + Intronic
1075018502 10:118929043-118929065 CTGTGGTACCACTTGGGCTGGGG - Intergenic
1076427831 10:130380169-130380191 CTGTGGTCCCAGGGAGGGCACGG - Intergenic
1076671014 10:132121146-132121168 CTCTGCTGACACTTGGGGCAGGG - Intronic
1077250510 11:1558697-1558719 CTGTGGTCCTTCCAGGGGCATGG + Intronic
1077298039 11:1835135-1835157 CTGTGGTGCCAGCTGGGGCCGGG - Exonic
1077309550 11:1882297-1882319 CTCTGGTCCCACTCAAGGCAAGG - Intronic
1077357165 11:2123695-2123717 CTCTGGTCCCATATGGAGCATGG + Intergenic
1078428828 11:11271706-11271728 CAGAGGTCCAACTGGGGGCATGG - Intronic
1081466632 11:43324977-43324999 CTCTGGTCAAATTTGGGGCATGG - Intronic
1081775592 11:45674225-45674247 CTGGGGTCCCAGCTGGGGCAGGG - Intergenic
1084142390 11:67241247-67241269 GTGTGGTGCCACGTGGGACAAGG - Intronic
1084475277 11:69385287-69385309 CAGTGGTCCCTGTTGGGCCAGGG + Intergenic
1084615153 11:70230988-70231010 CAGTGGCCCAGCTTGGGGCAGGG + Intergenic
1090215125 11:124954845-124954867 CTATAGTACCAGTTGGGGCATGG + Exonic
1090839050 11:130473645-130473667 CTGAGCTCCCAGGTGGGGCAGGG - Exonic
1091967131 12:4754298-4754320 CTCTGGACCCACTTGGGACCTGG - Intronic
1092091674 12:5808920-5808942 CTCTGCTCCCACGTGGGGCCTGG - Intronic
1093123958 12:15306554-15306576 CTCTGGACCCACCTGGGGCCTGG - Intronic
1096944768 12:55392345-55392367 GTGTGCTCACGCTTGGGGCACGG - Intergenic
1098235524 12:68414547-68414569 CTGTGGTCTCACATGGTGGAAGG - Intergenic
1099433850 12:82620107-82620129 CTTAGGACCCACTTGGGGCCTGG + Intergenic
1099564848 12:84230252-84230274 CTCTGGACCCACTTGGGTCCTGG - Intergenic
1102222985 12:111207134-111207156 GTGTGGTCCCAAGTTGGGCAGGG - Intronic
1103262690 12:119602057-119602079 GTATGGTCAGACTTGGGGCATGG - Intronic
1104685207 12:130780465-130780487 CTGTGGTTCTGCATGGGGCAGGG - Intergenic
1104824720 12:131701025-131701047 AGCTGGTCCCAGTTGGGGCATGG - Intergenic
1106074854 13:26449120-26449142 CTGTGGACCCATCTGGGGCTGGG + Intergenic
1107210066 13:37842629-37842651 CTGTGTTCCCACATGGTGAAAGG + Intronic
1109071423 13:57773743-57773765 CTGTGTCCCCACATGGGGCCAGG + Intergenic
1111277300 13:85966936-85966958 CTGTAGTACCCCTTGGGGCTAGG - Intergenic
1112719766 13:102230149-102230171 CTGTGTTCTCACATGGTGCAAGG - Intronic
1113522248 13:110949338-110949360 CTGCGGTCCCACCTGCTGCACGG + Intergenic
1114072593 14:19126603-19126625 CTGTGGACCCACTGGTGGCCAGG - Intergenic
1114089663 14:19273369-19273391 CTGTGGACCCACTGGTGGCCAGG + Intergenic
1114987909 14:28252705-28252727 TTCTGGACCCACTTGGGGCCTGG - Intergenic
1117293849 14:54360944-54360966 CTGTGGTCCTGCTTGGGACTGGG + Intergenic
1118855436 14:69618108-69618130 CTGTGGTTCCAATTGGAACAAGG - Intronic
1119269421 14:73288925-73288947 CTGTGGTCCTACTTGGGAGGTGG + Intronic
1119352201 14:73975276-73975298 ATGTGATCCCAGTTGGGGCTAGG - Intronic
1119385603 14:74256579-74256601 CTGTGGTCACACTTGGTGTCTGG + Intronic
1120714946 14:87830654-87830676 GTGTTATTCCACTTGGGGCAAGG + Intergenic
1122282760 14:100633843-100633865 CTGAGTGCCCATTTGGGGCAAGG + Intergenic
1127517263 15:59708502-59708524 CTGGGGTCCCATATGGGGCTTGG + Intergenic
1129233646 15:74210546-74210568 CAGTGGTCACACTTGGGGGAGGG + Intronic
1130157116 15:81360711-81360733 AGTTGGTCCCACTTGGAGCAAGG + Intronic
1130562556 15:84970091-84970113 CTGTGATTACACTTGGGACAGGG + Intergenic
1132701582 16:1224499-1224521 CTGGGGTCCCAATGGGGGCCCGG - Intronic
1133280026 16:4659963-4659985 TTGTGGCCCCATTTGGGGCGGGG + Intronic
1133640182 16:7709178-7709200 CTGAGGTCCCAGCTGGGGAAAGG - Intronic
1134827416 16:17295725-17295747 TTGTTGTCACACTTGGGGAAGGG + Intronic
1136707144 16:32200445-32200467 CTGAGGCCGCACTTGGGGCCAGG + Intergenic
1136760766 16:32728972-32728994 CTGAGGCCGCACTTGGGGCCAGG - Intergenic
1136807337 16:33141414-33141436 CTGAGGCCGCACTTGGGGCCAGG + Intergenic
1138271891 16:55701631-55701653 CTGTGGTCAGACATGGGGCTAGG - Intronic
1138973260 16:62171441-62171463 CTGTGTCCTCACATGGGGCAAGG + Intergenic
1139630376 16:68228209-68228231 CTGTGGCCCCTCTTGGAGCTGGG + Exonic
1139981888 16:70865837-70865859 CTGGGTTACCACTTGGTGCATGG + Intronic
1140744524 16:77969377-77969399 CTGTGGTCTCAAATGGGGAAGGG + Intronic
1141194063 16:81846331-81846353 CTGTGGTCCCACTTAGGGATGGG - Intronic
1141702379 16:85648443-85648465 CTGGGGCCTCACTTGGAGCAGGG + Intronic
1142388964 16:89785727-89785749 CTGTGGTCTCAAGTGGGGCTAGG - Intronic
1203062918 16_KI270728v1_random:989286-989308 CTGAGGCCGCACTTGGGGCCAGG - Intergenic
1144504504 17:15818323-15818345 CTGTGGCCCCGCTTGGGACAAGG + Intergenic
1145168356 17:20633837-20633859 CTGTGGCCCGGCTTGGGCCAAGG + Intergenic
1145200323 17:20938792-20938814 CTGTGGCCCCACTCGGCCCAAGG + Intergenic
1148644396 17:49210897-49210919 CCAGGGCCCCACTTGGGGCAGGG - Intronic
1149527569 17:57368516-57368538 CTGTGCTCCCACCTGGGTGACGG + Intronic
1150236162 17:63594518-63594540 CTGTGATCCCAGCTGAGGCATGG + Intergenic
1150759284 17:67945670-67945692 CTGTGCTGCAACTTGGGGCTTGG - Exonic
1152590168 17:81207791-81207813 CTGTGGCCTCCCATGGGGCAGGG - Intronic
1152756297 17:82088467-82088489 CTGTGGTCCCACTTGATGAGTGG + Exonic
1153363386 18:4224743-4224765 CTCTGGACCCACCTGGGGCCAGG + Intronic
1153787754 18:8549705-8549727 CTGTGTTCACACTTGGGTGATGG + Intergenic
1153790162 18:8571609-8571631 CATGGGTCCCACGTGGGGCAGGG - Intergenic
1155312939 18:24542303-24542325 CTGAGGACCCACTTGGTTCAAGG + Intergenic
1155900227 18:31380406-31380428 CTGTGCTCCCACTTGGGGAAGGG - Intronic
1156462080 18:37326751-37326773 CTCTGCTCCCACCTGCGGCAGGG + Intronic
1156463460 18:37334461-37334483 CAGTGGTCCCACTGTGGGCTGGG - Intronic
1157566698 18:48683392-48683414 CAGTGGTCTCACTTCGAGCAGGG + Intronic
1158299525 18:56035681-56035703 TTGTGGTCTCACATGGGGGAAGG + Intergenic
1159394480 18:67838400-67838422 CTCTGGACCCACTTGTGGCCTGG - Intergenic
1159881275 18:73860744-73860766 CTGTGGTCTCACTGTGGGGATGG - Intergenic
1159896420 18:74001249-74001271 CTCTGGACCCACCTGGGGCCTGG - Intergenic
1160027619 18:75231313-75231335 CTGTGATCCTGCCTGGGGCATGG + Intronic
1160237413 18:77097147-77097169 CTGTGGGCCAACTCGGGGCAAGG + Intronic
1160757501 19:765298-765320 CTGGGGTCTCCCTGGGGGCAGGG - Intergenic
1161009436 19:1953224-1953246 CTGTGGCACCACTTGGGACCGGG + Intronic
1161310833 19:3593113-3593135 CTGGGGTCCCACCCGGGGCTTGG - Exonic
1161441523 19:4294483-4294505 CTGTGCTCCCGCCTGGGGGAAGG - Intronic
1161798896 19:6404394-6404416 CTGGGGTCCCAGATGGGGCTAGG - Intergenic
1162386209 19:10361936-10361958 CAGCTGTCCCACTTGGGCCAGGG - Exonic
1162717846 19:12645110-12645132 CTGTGGTCCCACTTGGGGCATGG - Intronic
1162779060 19:12997109-12997131 CTGTGGACACACTTGGCACATGG - Intronic
1163634828 19:18433077-18433099 CGGTGACCCCACTTGGGGAATGG + Intronic
1165454986 19:35905305-35905327 CAGTGTTCACACTTGGGGTAGGG + Intronic
1166677047 19:44747020-44747042 CTGAGGTCCCACCGGGAGCAAGG + Intergenic
1166808651 19:45501869-45501891 CTGGGGTCGCACTTGGGGTTGGG + Intronic
1166817328 19:45554097-45554119 CTGGTGTCCCTCTTGGGGCGCGG - Intronic
1167302276 19:48685110-48685132 CTGAGGTCCTACTTGGGGCTAGG - Intergenic
1167317037 19:48770275-48770297 CTGTGTTTCCACTTGGTGAAAGG - Intergenic
1167735075 19:51289408-51289430 CTGTGTCCCCACTTGGTGGAAGG + Intergenic
1202713245 1_KI270714v1_random:28676-28698 CTGTGGTCCCACAGGAGGCTTGG + Intergenic
926239586 2:11074712-11074734 ATGTTGTCCCACCTGAGGCAAGG - Intergenic
927356266 2:22177333-22177355 CTGTGGTCCAAGTTAGGGCAGGG + Intergenic
928472291 2:31586300-31586322 CTCTGGACCCACCTGGGGCTTGG + Intergenic
929604300 2:43225034-43225056 CTGTGGTGCAACTTGGGCCGCGG + Exonic
932698317 2:73975637-73975659 CTGTGGGCACTCCTGGGGCAAGG - Intergenic
935262670 2:101368779-101368801 CTGTGCCCTCACTTGGGGCAAGG - Intronic
935341607 2:102064194-102064216 CTTTGTTCCCACTTGGAGTAGGG + Intergenic
935478536 2:103556617-103556639 CTCTCGACCCACTTGGGGCCAGG - Intergenic
936287292 2:111190652-111190674 CTGTGCTCCTACACGGGGCAGGG - Intergenic
936440964 2:112552845-112552867 CAGTGGTACCACTTGTGGAATGG + Intronic
937661353 2:124433163-124433185 CTGTGGCCCCACTTTGGTCTGGG + Intronic
945098335 2:206240228-206240250 CTGTGGTCCGTCTTGGGGATTGG + Intergenic
945447886 2:209959724-209959746 CTGTGTTCACACTTGGGGCAGGG - Intronic
948523153 2:238554337-238554359 CTGTGGCCCCACTTGGCACAGGG - Intergenic
949042494 2:241855735-241855757 CCGTGGTCCCATTAGGGACAAGG + Intronic
1169477116 20:5941690-5941712 CTGTGGTCCCACTGGATGCAGGG - Intronic
1170669653 20:18420044-18420066 TTGGGGTCCTATTTGGGGCAGGG - Intronic
1170964378 20:21053007-21053029 CAGTGGGCCTACTGGGGGCAGGG - Intergenic
1171307746 20:24120451-24120473 CTGTAGTGCCACATGGGGAAGGG - Intergenic
1172189441 20:33053415-33053437 CTCTGGGCACACTTGGGGGAGGG - Intergenic
1172569906 20:35961907-35961929 CTCTGGTCCCACTGGGACCAAGG - Intronic
1172962478 20:38808246-38808268 CTGTTGCTACACTTGGGGCATGG - Intronic
1173229525 20:41183397-41183419 ATGTGGTCCCTATTGGGACAGGG + Exonic
1173570301 20:44071528-44071550 ATGTGGCCCCACTTGGGCCATGG - Intergenic
1173648076 20:44646069-44646091 CTGTGGTACCCCCTGGGGCGGGG - Intronic
1174488644 20:50876866-50876888 CTGTGGTCTCACATGAGGCAGGG - Exonic
1177456394 21:21344674-21344696 CTCTGGACCCACCTGGGGCAAGG + Intronic
1179652572 21:42821156-42821178 CCCTGGACCCACTTGGGGCCTGG + Intergenic
1179933961 21:44590948-44590970 CTGTGGACCCCCGAGGGGCATGG - Intronic
1179940932 21:44638591-44638613 CTGTGGACCCCCGAGGGGCATGG + Intronic
1183991946 22:41603031-41603053 CTGTGGTTGCACTTAGGCCAGGG + Intronic
1184907340 22:47497765-47497787 CTCAGGGCCTACTTGGGGCAGGG + Intergenic
1185249092 22:49790172-49790194 CTGTGGTCCCGGCTGGGGGAGGG - Intronic
952066375 3:29576581-29576603 CTCTGGACCCACCTGGGGCCTGG - Intronic
953261897 3:41347777-41347799 CTCTGGGCCCACTGAGGGCAAGG + Intronic
955274288 3:57532933-57532955 CTCTGGACCCACCTGGGGCTTGG - Intronic
956049437 3:65231640-65231662 CTGTGGTCTAATTTGGGGCCTGG + Intergenic
956920783 3:73926978-73927000 CTATGGTCACAGTTAGGGCAGGG + Intergenic
959191223 3:103113615-103113637 CTCTGGACACACTTGGGGCCTGG + Intergenic
960593307 3:119386404-119386426 CTGTGTTCTCACATGGGGAAAGG + Intronic
961778874 3:129309800-129309822 CAGTGGTCCTACATGGGGCCTGG - Intergenic
962193662 3:133337099-133337121 CTCTGGACCCACCTGGGGCCTGG + Intronic
962740110 3:138357223-138357245 CAGAGGCCCCGCTTGGGGCAAGG - Intronic
963042467 3:141079784-141079806 CAGTGGTCCCCTTTGGGGGAGGG + Intronic
964538728 3:157755899-157755921 CTGTGCACCCACTTAGGGCACGG - Intergenic
965380692 3:167983727-167983749 GTCTGGACCCACTTGGGGCCTGG + Intergenic
965953890 3:174344646-174344668 CTGAGGTCTCAGTTGGAGCATGG + Intergenic
966312970 3:178615372-178615394 CTCTGGACCCACTTGGGGCCTGG - Intronic
966348637 3:179005395-179005417 CTCTGGACCCACCTGGGGCCTGG + Intergenic
966545504 3:181142295-181142317 CTGTGATCCTAGTTTGGGCAAGG + Intergenic
966741048 3:183234143-183234165 CTGTGGTCCCACTTGATGCCAGG - Intronic
967636677 3:191809359-191809381 CTCTGGACCCACCTGAGGCAGGG + Intergenic
967871335 3:194232198-194232220 CAGTGGTCACCCTTTGGGCAGGG + Intergenic
968083101 3:195860412-195860434 CTGTGGACCCATCTGGGGCACGG + Intergenic
968253811 3:197247341-197247363 CTGTGCACCCACTTGGGGCGGGG + Intronic
968290506 3:197535533-197535555 CTGTTGTCCCACGTGGTGCATGG - Intronic
968307018 3:197657291-197657313 CTGTGGTCCCACGTGGCTCCTGG - Intergenic
968518852 4:1026702-1026724 CTGTGGTCTCTCCTGGGGCCCGG + Exonic
968661698 4:1801319-1801341 CTCTGCTCCCACTCGGGTCATGG + Intronic
969967833 4:11014936-11014958 GTGTGGCCCACCTTGGGGCATGG - Intergenic
971127724 4:23772618-23772640 ATTTGGTTCCACTTGGGCCATGG + Intronic
974556203 4:63451877-63451899 CTGTGCTCTCTCTTGGGGAAGGG + Intergenic
974637381 4:64582644-64582666 CTGTTTTCCCACATGGGGGAAGG + Intergenic
976908307 4:90267389-90267411 CTCTGGACCCACCTGGGGCCTGG + Intronic
978654441 4:111049423-111049445 CTTTGGACCCACCTGGGGCCAGG + Intergenic
980370588 4:131864458-131864480 CAGTGGGGCCTCTTGGGGCATGG + Intergenic
980475863 4:133315493-133315515 CTGGTGTCCAACTTGTGGCATGG + Intergenic
981147517 4:141342825-141342847 CTGTAATCCCACTTGAGGCCAGG + Intergenic
981719845 4:147790189-147790211 CTGTGTCCTCACTTGGGACACGG + Intronic
985744017 5:1636531-1636553 CTGTGGTCCCACGTGGCTCCTGG - Intergenic
985749983 5:1668143-1668165 CTGAAGTCCCCCTTGGGGCCTGG + Intergenic
987121586 5:14772959-14772981 CAGTGGTCCCACTTGGAGGCAGG - Intronic
987791963 5:22580107-22580129 ATGAGGTCCTATTTGGGGCAGGG - Intronic
990700167 5:58466505-58466527 CTGTGGTCTCACATGGTGGAAGG - Intergenic
992860492 5:80904355-80904377 CTGTGGTTTGACTTGGGGAAGGG - Intergenic
995777907 5:115745518-115745540 CTCTGGACCCACCTGGGGCATGG - Intergenic
997511483 5:134457828-134457850 CTGTGGTCCACCTTGGGTAAAGG - Intergenic
998634075 5:143932687-143932709 CTCTGGACACACTTGGGGCCTGG + Intergenic
998695937 5:144639603-144639625 ATGTGGTACAACTAGGGGCATGG - Intergenic
1002519854 5:179786373-179786395 CAGTGGTCCCACTGGGAGCTGGG - Intronic
1003833461 6:10040817-10040839 CTGTGTCCTCACTTGGTGCAAGG + Intronic
1006884402 6:37368870-37368892 CTGTGGTCTTACTTGGCTCAAGG - Exonic
1007664697 6:43507344-43507366 CTGTGGTCCCCATTGGAGGAAGG - Intronic
1007848458 6:44780437-44780459 CCATGGTCCCAGTTGGGCCAGGG + Intergenic
1008438096 6:51499573-51499595 CTGTGTTCTCACTTGGTGGAAGG + Intergenic
1010838976 6:80624645-80624667 CTCTGGACACACTTGGGGCCTGG + Intergenic
1012028682 6:94030163-94030185 CTCTGGACCCACCTGGGGCCTGG + Intergenic
1014286501 6:119504628-119504650 CTGTGCTCTCACTTTGGGCCAGG - Intergenic
1015030381 6:128587176-128587198 CTCTGGACCCACGTGGGGCCTGG + Intergenic
1015962153 6:138660967-138660989 CTGTAGTCCCAGTTGGGACTGGG + Intronic
1016962156 6:149684201-149684223 CTCCTGTCCCACCTGGGGCATGG - Exonic
1023876561 7:44289379-44289401 GTGTGGTCCTGCTGGGGGCAAGG - Intronic
1026136919 7:67671603-67671625 CTCTAGTCACCCTTGGGGCAGGG + Intergenic
1027400163 7:77798689-77798711 CTGTGGGCCCAATGGGAGCACGG - Intergenic
1028509514 7:91608555-91608577 CTGTGAAACCACTGGGGGCATGG + Intergenic
1030048513 7:105518644-105518666 CTGTAATCCCAGTTGAGGCAGGG - Intronic
1033177002 7:139133983-139134005 CTGTGTTCCCACGGGGGACAGGG + Intronic
1033312743 7:140273624-140273646 CTGTGGGCCCCCCTGGGGGAAGG + Intergenic
1033867714 7:145713199-145713221 CTCTGGACCCACCTGGGGCCTGG - Intergenic
1036354635 8:8033791-8033813 CTGAGCTCCCAGTTGGGTCAAGG - Intergenic
1036793299 8:11737687-11737709 CTGAGGACCCACTTGGGAAATGG + Intronic
1037765480 8:21769877-21769899 CTGTGGTCCTTCTTGGAGGATGG - Intronic
1038006454 8:23434564-23434586 CTGTGGGCAGCCTTGGGGCAGGG + Intronic
1040095772 8:43440858-43440880 CTCTGGACCCACATGGGGCCTGG + Intergenic
1040586672 8:48749954-48749976 ATGTGGACCCACTTGAGCCAAGG - Intergenic
1042162703 8:65912928-65912950 CTCTGGACCCACCTGGGGCCTGG + Intergenic
1044192991 8:89342127-89342149 CTCTGGACCCACTTGGAGCTTGG - Intergenic
1045590024 8:103582833-103582855 CTCTGGACCCACCTGGGGCCTGG + Intronic
1045777381 8:105821759-105821781 CTTTGGACCCACCTGGGGCCTGG - Intergenic
1047903659 8:129450006-129450028 CTGTGCTCCCCCTGGGGCCAGGG + Intergenic
1049030756 8:140035801-140035823 CTGTGGGCTCACGTGGAGCAAGG - Intronic
1049218660 8:141418951-141418973 CTTTGCTCTCACCTGGGGCAGGG + Intronic
1049237519 8:141519462-141519484 CTGTGGGCCCGCTGGTGGCAGGG + Intergenic
1049330055 8:142045670-142045692 CTGGGGTCCCACTGGGGCCTGGG + Intergenic
1049447388 8:142637597-142637619 CTGTGGTCCCAGCTGGGCCATGG - Intergenic
1049738830 8:144224795-144224817 CTGTGGTGCCACTGGGTGCTGGG + Intronic
1049741834 8:144244723-144244745 CAGAGGTCCCACCTGGGTCAGGG - Intronic
1052622370 9:30930199-30930221 CTGTGTCCCCACTTAGGGGAGGG + Intergenic
1052709374 9:32034538-32034560 CTGTGGTTCCTCTGAGGGCATGG + Intergenic
1059791832 9:117648685-117648707 CTGAGGACCCACCTGAGGCAGGG - Intergenic
1060370000 9:123059709-123059731 CTGTGTTCTCATATGGGGCAGGG - Intronic
1060522744 9:124302947-124302969 CTGTGTACCCACTTGGGACGGGG + Intronic
1060665917 9:125432074-125432096 CCTTGGTCCCATTTTGGGCAAGG + Intergenic
1061160871 9:128892988-128893010 CTGTGGGCCCACATGGGGTCTGG + Intronic
1061387952 9:130301513-130301535 CTGTGGTCCCATTTAGCTCATGG + Intronic
1061421102 9:130473248-130473270 GTGTTTTCCCACTTTGGGCAAGG - Intronic
1061660545 9:132127267-132127289 CTGTGTTCCCACTAGAGGCTGGG - Intergenic
1189657928 X:43266824-43266846 CTCTGGACCCACCTGGGACATGG - Intergenic
1190588078 X:51967393-51967415 CTCTGGACCCACCTGGGGCCTGG - Intergenic
1190614666 X:52217841-52217863 CTCTGGACCCACTTGGGGCCTGG + Intergenic
1190622558 X:52302074-52302096 CAGTGGTTCCTCTTGGGGCAAGG - Intergenic
1190862992 X:54361100-54361122 CTGTGGTATCACTTGGGTTAAGG - Intergenic
1192538807 X:71950669-71950691 CTCTGCTCCCACTTGTGACATGG + Intergenic
1193670358 X:84376794-84376816 CTCTGGACCCACCTGGGGCCTGG + Intronic
1193683659 X:84552289-84552311 CTCTGGACCCACCTGGGGCCTGG - Intergenic
1194787556 X:98105908-98105930 CTCTGGACCCACCTGGGGCATGG - Intergenic
1194791867 X:98160354-98160376 CTCTGGACCCACCTGGGGCCTGG + Intergenic
1195879894 X:109581621-109581643 CTGTGGTCCCACTGGCCTCAGGG + Intergenic
1197113001 X:122798167-122798189 CTCTGGACCCACCTGGGGCTGGG + Intergenic
1197376062 X:125682942-125682964 CTCTGGACACACTTGGGGCTTGG + Intergenic
1198134958 X:133739751-133739773 CTGTAGTCCCACTTATGGCATGG + Intronic
1198515137 X:137399831-137399853 CTCTGGACACACCTGGGGCATGG - Intergenic