ID: 1162718540

View in Genome Browser
Species Human (GRCh38)
Location 19:12648341-12648363
Sequence TCGGAGCCACTAATGGAGAA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 3, 3: 7, 4: 63}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162718540_1162718551 24 Left 1162718540 19:12648341-12648363 CCGTTCTCCATTAGTGGCTCCGA 0: 1
1: 0
2: 3
3: 7
4: 63
Right 1162718551 19:12648388-12648410 CAGCCTTCGGTGCACCTGGGGGG 0: 1
1: 0
2: 0
3: 12
4: 139
1162718540_1162718548 21 Left 1162718540 19:12648341-12648363 CCGTTCTCCATTAGTGGCTCCGA 0: 1
1: 0
2: 3
3: 7
4: 63
Right 1162718548 19:12648385-12648407 CAGCAGCCTTCGGTGCACCTGGG 0: 1
1: 0
2: 2
3: 20
4: 246
1162718540_1162718550 23 Left 1162718540 19:12648341-12648363 CCGTTCTCCATTAGTGGCTCCGA 0: 1
1: 0
2: 3
3: 7
4: 63
Right 1162718550 19:12648387-12648409 GCAGCCTTCGGTGCACCTGGGGG 0: 1
1: 0
2: 1
3: 11
4: 139
1162718540_1162718549 22 Left 1162718540 19:12648341-12648363 CCGTTCTCCATTAGTGGCTCCGA 0: 1
1: 0
2: 3
3: 7
4: 63
Right 1162718549 19:12648386-12648408 AGCAGCCTTCGGTGCACCTGGGG 0: 1
1: 0
2: 2
3: 9
4: 139
1162718540_1162718547 20 Left 1162718540 19:12648341-12648363 CCGTTCTCCATTAGTGGCTCCGA 0: 1
1: 0
2: 3
3: 7
4: 63
Right 1162718547 19:12648384-12648406 TCAGCAGCCTTCGGTGCACCTGG 0: 1
1: 0
2: 1
3: 11
4: 104
1162718540_1162718545 11 Left 1162718540 19:12648341-12648363 CCGTTCTCCATTAGTGGCTCCGA 0: 1
1: 0
2: 3
3: 7
4: 63
Right 1162718545 19:12648375-12648397 CATCGTCCTTCAGCAGCCTTCGG 0: 1
1: 0
2: 0
3: 9
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162718540 Original CRISPR TCGGAGCCACTAATGGAGAA CGG (reversed) Exonic
909465971 1:75974418-75974440 TTGGAGCCACCCATGGAGGAAGG - Intergenic
909937194 1:81565753-81565775 TCTGGGCCACTAAAGAAGAAAGG - Intronic
915734156 1:158074217-158074239 GAGGAGCCACTCATGGAGTATGG + Intronic
917301341 1:173577621-173577643 ACGGGGCCACTAATGGAGGAAGG - Intronic
919643283 1:200066321-200066343 TGGGAGCCATTTGTGGAGAAGGG + Intronic
1063681277 10:8189958-8189980 TCCAAGCCACAAATGGAGAATGG + Intergenic
1065229514 10:23582943-23582965 TGGTACCCACTGATGGAGAAAGG + Intergenic
1067729005 10:48795650-48795672 TTGGAGCCATTGATGGGGAATGG + Intronic
1070776675 10:79113793-79113815 TAGGAGCCATCAATGGAGAGGGG - Intronic
1075576869 10:123584157-123584179 ACGGAGCCACCCCTGGAGAACGG - Intergenic
1082252512 11:49997324-49997346 TCTGAGCCACTATTGTAAAATGG - Intergenic
1085126832 11:74007694-74007716 TCTTAGCCACTCATGGAAAATGG + Intronic
1085687035 11:78632921-78632943 TCTGAGCCACAGAAGGAGAAGGG + Intergenic
1090419230 11:126562584-126562606 TAGGAGACACAAAGGGAGAAGGG + Intronic
1108082438 13:46750657-46750679 TCTGAGCCCCCAATGGAGAAGGG - Intronic
1110170090 13:72490259-72490281 TCTGAGCCAATAATTGAAAATGG + Intergenic
1116599308 14:46899040-46899062 TCGCAGCCGCTAATGGAAAGGGG + Intronic
1120130216 14:80797989-80798011 TCTCAGCCACTAAAGCAGAATGG + Intronic
1123192657 14:106586080-106586102 CAGGTGTCACTAATGGAGAAAGG - Intergenic
1124716120 15:32063892-32063914 CTGGATCCACAAATGGAGAATGG - Intronic
1125046432 15:35246456-35246478 AGGGAGACACTAATGGGGAAAGG - Intronic
1125934009 15:43619001-43619023 TAGGAGCCAGTGATGCAGAAAGG + Intergenic
1125947106 15:43718463-43718485 TAGGAGCCAGTGATGCAGAAAGG + Intergenic
1138551471 16:57751197-57751219 TCAGAGCCACGACTGGAGGAAGG - Intronic
1142207875 16:88792556-88792578 TGGGAGCAACAAAGGGAGAAAGG + Intergenic
1147333932 17:39715726-39715748 TAGGCGCCACTATGGGAGAAAGG - Exonic
1161206297 19:3042774-3042796 TCCGAGCTAGTACTGGAGAATGG - Intronic
1162718540 19:12648341-12648363 TCGGAGCCACTAATGGAGAACGG - Exonic
1163398526 19:17077759-17077781 TCGCAGCCAGGAATGGAGAGTGG - Intronic
1164875643 19:31684840-31684862 TTGGAATCACTAAGGGAGAAAGG - Intergenic
927619040 2:24632585-24632607 TGGGAGCCAATAATGGAGAAGGG - Intronic
929929877 2:46245554-46245576 TCGTAGCCACTAAGGGCAAAGGG - Intergenic
936403649 2:112184252-112184274 TCTGACCCACCAAGGGAGAACGG + Intronic
944838726 2:203605292-203605314 TCAGAGCCACCAATAAAGAAGGG - Intergenic
945788984 2:214279469-214279491 TCTGAGCCACAACTCGAGAAAGG + Intronic
1168836412 20:880732-880754 TGGGAGCCACTGATTGAAAATGG + Intronic
1179357890 21:40678468-40678490 TCGGAGCCAGTGATAGAGATGGG + Intronic
1179711868 21:43268178-43268200 TCAGGACCACTAAGGGAGAAGGG - Intergenic
1181479124 22:23186577-23186599 TCAGAGACACAGATGGAGAATGG - Intronic
1182424666 22:30265817-30265839 AAGGAGCCACTTATGGAGAGAGG - Intronic
949683585 3:6542686-6542708 TCAGATCCACTAATGCAGAATGG - Intergenic
957216538 3:77327512-77327534 CCGGACCCATTATTGGAGAAGGG + Intronic
961049501 3:123734470-123734492 ACGGAGGCACTAGTAGAGAAGGG - Intronic
961468949 3:127099456-127099478 TCGGAGCCACCAAAGGACAGGGG + Intergenic
964379492 3:156083608-156083630 TAGGAGACATTAATGGAGCAGGG - Intronic
966911691 3:184563288-184563310 TCGGAGCCATTAAATGAGAGAGG + Intronic
973758640 4:54098321-54098343 TTGGAGCCACTGATGGAGAATGG - Intronic
984434979 4:179698134-179698156 TTGGAACCACTTATGAAGAAAGG - Intergenic
989444418 5:41510698-41510720 GCGGAGGCACTAAGGGAGCACGG - Intergenic
990533181 5:56694233-56694255 TCAGAGCCACTACTTGAAAAGGG - Intergenic
991266466 5:64725575-64725597 TCGGAGTCACTAAAGGAGGAAGG - Intronic
1006175984 6:32121860-32121882 GAGGAGCCACTAAAGGAGAAAGG - Intronic
1006259816 6:32858400-32858422 CCGGAGCCACCAATGGCAAAAGG - Exonic
1008021001 6:46577013-46577035 TTAGAGCCAGCAATGGAGAAGGG + Intronic
1008583641 6:52929336-52929358 CTGGAGCCACTAATGGAGAGGGG + Intergenic
1010317424 6:74467147-74467169 TCCCAGACACTAGTGGAGAAGGG - Intergenic
1018373198 6:163187078-163187100 TGGGAGCCACTGATAGGGAAGGG - Intronic
1022897164 7:34762114-34762136 TTGGGGGAACTAATGGAGAAAGG + Intronic
1025871083 7:65434876-65434898 TCGGAGCCACTAGTGTAGAAAGG - Intergenic
1026427517 7:70311364-70311386 TGGGAGACAAGAATGGAGAAAGG - Intronic
1027434356 7:78148888-78148910 GAGGAGCCACTAATGGATTATGG + Intronic
1028219635 7:88182030-88182052 TCTGAACCTCTAATGGAAAAAGG + Intronic
1028567290 7:92246559-92246581 TCGGAGCCACAAATGGGTAGAGG - Intronic
1041602982 8:59744134-59744156 TTGAATCCACTAATGAAGAATGG + Intergenic
1042711600 8:71723391-71723413 TCAGAGCCACAAATTGGGAAAGG - Intergenic
1046857778 8:119053618-119053640 CTGGAGACACAAATGGAGAATGG - Intronic
1047377647 8:124317800-124317822 TCAGAGCCAGCAAGGGAGAAAGG - Intronic
1060163848 9:121392335-121392357 ACTGAGCACCTAATGGAGAAAGG + Intergenic
1060938282 9:127528429-127528451 TCAGATGCACTCATGGAGAAAGG + Intronic
1187669212 X:21651754-21651776 TGGGGGCCTGTAATGGAGAATGG - Intronic
1188494137 X:30765876-30765898 TCCCAGCTACTAAAGGAGAAAGG - Intergenic
1192424088 X:71060307-71060329 TGGGAGCCACAAAGGGAGAGGGG + Exonic
1197334679 X:125198715-125198737 TGGGAGTCACTAATTCAGAATGG - Intergenic
1198162058 X:134017735-134017757 TTGGAGCCACTAGGGTAGAAAGG + Intergenic