ID: 1162718545

View in Genome Browser
Species Human (GRCh38)
Location 19:12648375-12648397
Sequence CATCGTCCTTCAGCAGCCTT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 98}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162718535_1162718545 18 Left 1162718535 19:12648334-12648356 CCCCGACCCGTTCTCCATTAGTG 0: 1
1: 0
2: 0
3: 1
4: 38
Right 1162718545 19:12648375-12648397 CATCGTCCTTCAGCAGCCTTCGG 0: 1
1: 0
2: 0
3: 9
4: 98
1162718536_1162718545 17 Left 1162718536 19:12648335-12648357 CCCGACCCGTTCTCCATTAGTGG 0: 1
1: 0
2: 0
3: 4
4: 51
Right 1162718545 19:12648375-12648397 CATCGTCCTTCAGCAGCCTTCGG 0: 1
1: 0
2: 0
3: 9
4: 98
1162718541_1162718545 4 Left 1162718541 19:12648348-12648370 CCATTAGTGGCTCCGATACTCCG 0: 1
1: 0
2: 0
3: 0
4: 13
Right 1162718545 19:12648375-12648397 CATCGTCCTTCAGCAGCCTTCGG 0: 1
1: 0
2: 0
3: 9
4: 98
1162718538_1162718545 16 Left 1162718538 19:12648336-12648358 CCGACCCGTTCTCCATTAGTGGC 0: 1
1: 0
2: 0
3: 4
4: 67
Right 1162718545 19:12648375-12648397 CATCGTCCTTCAGCAGCCTTCGG 0: 1
1: 0
2: 0
3: 9
4: 98
1162718534_1162718545 19 Left 1162718534 19:12648333-12648355 CCCCCGACCCGTTCTCCATTAGT 0: 1
1: 0
2: 0
3: 3
4: 62
Right 1162718545 19:12648375-12648397 CATCGTCCTTCAGCAGCCTTCGG 0: 1
1: 0
2: 0
3: 9
4: 98
1162718542_1162718545 -8 Left 1162718542 19:12648360-12648382 CCGATACTCCGCGTCCATCGTCC 0: 1
1: 0
2: 0
3: 1
4: 32
Right 1162718545 19:12648375-12648397 CATCGTCCTTCAGCAGCCTTCGG 0: 1
1: 0
2: 0
3: 9
4: 98
1162718532_1162718545 25 Left 1162718532 19:12648327-12648349 CCCACGCCCCCGACCCGTTCTCC 0: 1
1: 0
2: 0
3: 10
4: 180
Right 1162718545 19:12648375-12648397 CATCGTCCTTCAGCAGCCTTCGG 0: 1
1: 0
2: 0
3: 9
4: 98
1162718539_1162718545 12 Left 1162718539 19:12648340-12648362 CCCGTTCTCCATTAGTGGCTCCG 0: 1
1: 0
2: 0
3: 8
4: 55
Right 1162718545 19:12648375-12648397 CATCGTCCTTCAGCAGCCTTCGG 0: 1
1: 0
2: 0
3: 9
4: 98
1162718540_1162718545 11 Left 1162718540 19:12648341-12648363 CCGTTCTCCATTAGTGGCTCCGA 0: 1
1: 0
2: 3
3: 7
4: 63
Right 1162718545 19:12648375-12648397 CATCGTCCTTCAGCAGCCTTCGG 0: 1
1: 0
2: 0
3: 9
4: 98
1162718533_1162718545 24 Left 1162718533 19:12648328-12648350 CCACGCCCCCGACCCGTTCTCCA 0: 1
1: 1
2: 2
3: 19
4: 295
Right 1162718545 19:12648375-12648397 CATCGTCCTTCAGCAGCCTTCGG 0: 1
1: 0
2: 0
3: 9
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162718545 Original CRISPR CATCGTCCTTCAGCAGCCTT CGG Exonic
901434137 1:9235714-9235736 CATCGTCCTGCCTCAGCCTCCGG + Intronic
902571389 1:17349138-17349160 CATCCTGTTTCAGCAGCGTTGGG + Intronic
903389744 1:22955346-22955368 CATCGTCCTTGAGCAGGTTCAGG + Exonic
904012746 1:27399098-27399120 GATCTGCCTTCAGGAGCCTTCGG - Intergenic
905128555 1:35733873-35733895 CATCCTCCTTCCTCAACCTTTGG - Intronic
905183391 1:36179694-36179716 CAGCCTCCTTCTGCAGCCCTGGG - Exonic
906086178 1:43136599-43136621 CAGATTCTTTCAGCAGCCTTGGG + Intergenic
909344112 1:74565408-74565430 GATCGGCCTCCAGCAGCCTGGGG + Intergenic
909475173 1:76074370-76074392 CATCGCCCTTCTGGAGACTTTGG - Intergenic
910058495 1:83060506-83060528 CAGCATCCCTCAGCATCCTTAGG - Intergenic
913169962 1:116222777-116222799 CAGTGTCCTTCTGCAGCCTCAGG - Intergenic
913266071 1:117046018-117046040 CATCTTCTTTCTGCTGCCTTTGG - Intergenic
916174235 1:162024230-162024252 CATCGTCCTTTAGCACACCTGGG + Intergenic
916968064 1:169974868-169974890 AATCTTCCCTCAGCAGCCATGGG + Intronic
923283838 1:232471468-232471490 CATCGTCTTCCAGGAGCCTGGGG - Exonic
924609576 1:245562642-245562664 CAAAGTCCTTCAGAACCCTTGGG + Intronic
1065121151 10:22531448-22531470 GATCCTCCTTCCTCAGCCTTTGG - Intergenic
1070801226 10:79245450-79245472 CATCATCATTCAGCAGCCACTGG - Intronic
1074511593 10:114117521-114117543 CATTGTCCTTCAGGAGGCTAAGG - Intergenic
1076003802 10:126932299-126932321 AATCGTCCTGCCTCAGCCTTCGG - Intronic
1079082313 11:17422373-17422395 CATGATCCTTCTGCAGCATTTGG + Intronic
1081778980 11:45696798-45696820 CATCTTCCTTCCTCACCCTTAGG + Intergenic
1083721483 11:64605802-64605824 CCTCATCCTTCAGCAGCCCTTGG - Intergenic
1085770769 11:79323962-79323984 CATTGTCCTTCAGTATCCTTGGG + Intronic
1096617140 12:52839771-52839793 CCTCGCCCTCCAGCAGCCTGCGG + Exonic
1097098602 12:56570136-56570158 CATCTTCCTCCAGCAGCCAGGGG - Intronic
1099244917 12:80182927-80182949 CATGGGCTATCAGCAGCCTTGGG - Intergenic
1102483233 12:113238362-113238384 CTTCCTGCTTCAGCAGCATTTGG + Intronic
1103612498 12:122132555-122132577 CAGCATCCTTCAGCACCCATGGG + Intronic
1107064191 13:36195200-36195222 CAACCTGCCTCAGCAGCCTTGGG + Intronic
1107632740 13:42358741-42358763 GATCATGCTTGAGCAGCCTTTGG + Intergenic
1112785421 13:102946350-102946372 CTTTGTCCTTGAGAAGCCTTTGG + Intergenic
1113076638 13:106473519-106473541 CCTGGTCCTCCAGCAGCCCTAGG + Intergenic
1123674064 15:22690642-22690664 CATCCTCCTTCAGAAGCTTCAGG + Intergenic
1123722263 15:23069725-23069747 AATCCTCCTGCATCAGCCTTTGG - Intergenic
1124326072 15:28763634-28763656 CATCCTCCTTCAGAAGCTTCAGG + Intergenic
1126324735 15:47464408-47464430 CATCCTGCTTCAGGTGCCTTTGG + Intronic
1126798741 15:52281605-52281627 CATCGCACTTCAGCAACCCTGGG + Intronic
1127988478 15:64093809-64093831 CACCGTCTCTCAGCAGCCTCGGG + Exonic
1131284854 15:91048377-91048399 CATCCTCCTTCCTCAGCCTCTGG + Intergenic
1135853076 16:25982175-25982197 CGCCGTCCTTCAGCAGCCGGGGG - Intronic
1135954610 16:26945729-26945751 CATCGTCCTCCAGCAGCTGTGGG - Intergenic
1138696149 16:58815344-58815366 CATCATTCGTCAGCAGCCTCAGG + Intergenic
1144093056 17:11874981-11875003 CATCATCCATCAGCATCCTCAGG - Exonic
1144373878 17:14619753-14619775 GATAGAACTTCAGCAGCCTTAGG - Intergenic
1148629004 17:49092332-49092354 CAGCTTCCTACAGCAGCCTGTGG + Intergenic
1149378379 17:56068346-56068368 CAGCTTCCAGCAGCAGCCTTAGG - Intergenic
1151758428 17:76087693-76087715 CCTCTTCCTGCAGCAGCTTTTGG - Exonic
1161964402 19:7540323-7540345 CATCCTCCTGCAGCAGCCCCTGG - Intronic
1162718545 19:12648375-12648397 CATCGTCCTTCAGCAGCCTTCGG + Exonic
1162793985 19:13077327-13077349 CATCCTCCTGCAGCACCCTCCGG + Intronic
1163258442 19:16172024-16172046 CAGGGACCTGCAGCAGCCTTGGG + Intronic
1167419965 19:49397134-49397156 CAACCTCCTTCATCAGGCTTGGG + Intronic
926858658 2:17284675-17284697 CATCTTCCTTCAGAAGCTTCAGG - Intergenic
927592986 2:24372819-24372841 CATCCTCCTCCCTCAGCCTTCGG - Intergenic
938633272 2:133192750-133192772 CATCCTCACTCATCAGCCTTTGG - Intronic
939670856 2:145010432-145010454 AATCGGCCTTCTGCAGACTTAGG + Intergenic
940044666 2:149396849-149396871 CATTGTCCTTCAGTAGCTGTGGG + Intronic
942855406 2:180540616-180540638 CATCAGCCTTCAGTAGCCATAGG + Intergenic
943715148 2:191143458-191143480 CACCATCGTTCAGCAGCCCTTGG - Intronic
945746055 2:213720530-213720552 CATTGTCCTGCCTCAGCCTTCGG - Intronic
1170745897 20:19098645-19098667 CATCCTCCTTCACCAGCCCTGGG + Intergenic
1171225072 20:23436004-23436026 CATCGTCCTCATCCAGCCTTTGG - Intergenic
1171879014 20:30602986-30603008 CCTCTCCCCTCAGCAGCCTTGGG + Intergenic
1174414998 20:50360501-50360523 CACCCTCCGTCAGCAGCCTGGGG + Intergenic
1175456699 20:59120791-59120813 CAGCCTCCTTCACCAGCCTCAGG + Intergenic
1175916798 20:62429750-62429772 CGGCGTCCTTCTGCAGCCGTGGG + Intergenic
1183063623 22:35349689-35349711 CATCTTACCTCAGCAGCCTTAGG - Intergenic
1183736469 22:39647515-39647537 CATCCTCCTGCCTCAGCCTTCGG + Intronic
1184949633 22:47832040-47832062 CTTCGTCTTTCAGAATCCTTGGG - Intergenic
949798335 3:7875885-7875907 AATCATTCTTCAGCAACCTTGGG - Intergenic
956793954 3:72701580-72701602 CAGCCTCCTTCTGCAGCCTTGGG + Intergenic
957592004 3:82211387-82211409 CATCCTTCCTCAGCACCCTTGGG + Intergenic
959703078 3:109316389-109316411 GATCCTCCCTCCGCAGCCTTCGG + Exonic
960161019 3:114350694-114350716 GAGCGTCCTACAACAGCCTTCGG - Exonic
961082688 3:124039897-124039919 CATCATTTTTCAGGAGCCTTTGG + Intergenic
961923787 3:130453929-130453951 CATCGTCCTTCAGAAGGTGTTGG - Intronic
982895510 4:160917592-160917614 CACTGTCCTTCAGAAGACTTTGG - Intergenic
987411979 5:17624065-17624087 CATGGGCCTTGAGCATCCTTTGG - Intergenic
992188470 5:74266855-74266877 CATTGTCATTCAGCAGATTTAGG - Intergenic
995574483 5:113514336-113514358 CCGCGTCTTTCAGCAGCCTTGGG + Intronic
1002083330 5:176750453-176750475 CATCCTCCATGAGCAGCCCTGGG - Intergenic
1006787155 6:36676251-36676273 CATCCTCCTTCTTCAGGCTTGGG + Intergenic
1007257562 6:40539442-40539464 CATCCACTCTCAGCAGCCTTGGG + Intronic
1015626225 6:135182592-135182614 CACCCTCCTTCAGCCGCCTTAGG + Intronic
1016850752 6:148616340-148616362 GATTGTTCTTCAGCTGCCTTAGG - Intergenic
1017475292 6:154784783-154784805 AGTTGTCCTTCAGTAGCCTTGGG - Intronic
1017719742 6:157236187-157236209 CAGCGCCCTTCAGCAGGCCTGGG + Intergenic
1018320870 6:162607316-162607338 CATCATCCTTCTTCAGGCTTTGG - Intronic
1021719781 7:23493880-23493902 CATCCCCCTTCTTCAGCCTTCGG - Intergenic
1023868693 7:44251455-44251477 CCTCGGGCTTCAGCAGCCTTGGG - Intronic
1030749218 7:113209797-113209819 CATCCCATTTCAGCAGCCTTAGG + Intergenic
1031981633 7:128130770-128130792 CCTTGTCCTGCAGCAGCCCTGGG - Intergenic
1034690753 7:153011730-153011752 CATCTTCCCTCTGTAGCCTTTGG + Intergenic
1034702261 7:153106749-153106771 CAACGTTCTCCAGCAGCCTCTGG - Intergenic
1035994843 8:4534247-4534269 GGGCGTCCTTCAGCATCCTTGGG - Intronic
1041953512 8:63531988-63532010 CATGGTCCATGAGCAGCTTTCGG - Intergenic
1045100088 8:98835497-98835519 CATGTACCTTCATCAGCCTTTGG + Intronic
1052193155 9:25681265-25681287 AATTGTCCCTCAGCATCCTTGGG - Intergenic
1056499726 9:87197075-87197097 CATCGTCCTCCATCAGCTCTGGG - Intergenic
1057866720 9:98687357-98687379 CCTCGTCCTTCACAAGCCTCAGG - Intronic
1058139053 9:101339062-101339084 CATCCTGCTTGAGCAGCCTCCGG + Intergenic
1060134654 9:121141385-121141407 CATAGTCCTTCAGATGTCTTAGG + Exonic
1062318120 9:135978142-135978164 CCTCCACCTTCAGCAGCCCTGGG + Intergenic
1187123503 X:16431969-16431991 TATCATCCTTCTGCAGACTTTGG + Intergenic
1187503377 X:19858520-19858542 CATCCTCCTGCCTCAGCCTTTGG - Intronic
1192556792 X:72096381-72096403 CATTGTACCTCACCAGCCTTGGG - Intergenic
1198543167 X:137662041-137662063 CATCTTCCTTCAGAAGCTTCAGG - Intergenic