ID: 1162718547

View in Genome Browser
Species Human (GRCh38)
Location 19:12648384-12648406
Sequence TCAGCAGCCTTCGGTGCACC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 104}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162718535_1162718547 27 Left 1162718535 19:12648334-12648356 CCCCGACCCGTTCTCCATTAGTG 0: 1
1: 0
2: 0
3: 1
4: 38
Right 1162718547 19:12648384-12648406 TCAGCAGCCTTCGGTGCACCTGG 0: 1
1: 0
2: 1
3: 11
4: 104
1162718534_1162718547 28 Left 1162718534 19:12648333-12648355 CCCCCGACCCGTTCTCCATTAGT 0: 1
1: 0
2: 0
3: 3
4: 62
Right 1162718547 19:12648384-12648406 TCAGCAGCCTTCGGTGCACCTGG 0: 1
1: 0
2: 1
3: 11
4: 104
1162718539_1162718547 21 Left 1162718539 19:12648340-12648362 CCCGTTCTCCATTAGTGGCTCCG 0: 1
1: 0
2: 0
3: 8
4: 55
Right 1162718547 19:12648384-12648406 TCAGCAGCCTTCGGTGCACCTGG 0: 1
1: 0
2: 1
3: 11
4: 104
1162718540_1162718547 20 Left 1162718540 19:12648341-12648363 CCGTTCTCCATTAGTGGCTCCGA 0: 1
1: 0
2: 3
3: 7
4: 63
Right 1162718547 19:12648384-12648406 TCAGCAGCCTTCGGTGCACCTGG 0: 1
1: 0
2: 1
3: 11
4: 104
1162718538_1162718547 25 Left 1162718538 19:12648336-12648358 CCGACCCGTTCTCCATTAGTGGC 0: 1
1: 0
2: 0
3: 4
4: 67
Right 1162718547 19:12648384-12648406 TCAGCAGCCTTCGGTGCACCTGG 0: 1
1: 0
2: 1
3: 11
4: 104
1162718542_1162718547 1 Left 1162718542 19:12648360-12648382 CCGATACTCCGCGTCCATCGTCC 0: 1
1: 0
2: 0
3: 1
4: 32
Right 1162718547 19:12648384-12648406 TCAGCAGCCTTCGGTGCACCTGG 0: 1
1: 0
2: 1
3: 11
4: 104
1162718541_1162718547 13 Left 1162718541 19:12648348-12648370 CCATTAGTGGCTCCGATACTCCG 0: 1
1: 0
2: 0
3: 0
4: 13
Right 1162718547 19:12648384-12648406 TCAGCAGCCTTCGGTGCACCTGG 0: 1
1: 0
2: 1
3: 11
4: 104
1162718536_1162718547 26 Left 1162718536 19:12648335-12648357 CCCGACCCGTTCTCCATTAGTGG 0: 1
1: 0
2: 0
3: 4
4: 51
Right 1162718547 19:12648384-12648406 TCAGCAGCCTTCGGTGCACCTGG 0: 1
1: 0
2: 1
3: 11
4: 104
1162718543_1162718547 -7 Left 1162718543 19:12648368-12648390 CCGCGTCCATCGTCCTTCAGCAG 0: 1
1: 0
2: 1
3: 6
4: 77
Right 1162718547 19:12648384-12648406 TCAGCAGCCTTCGGTGCACCTGG 0: 1
1: 0
2: 1
3: 11
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162718547 Original CRISPR TCAGCAGCCTTCGGTGCACC TGG Exonic
900109830 1:1000676-1000698 TCTGCAGCCCTCCGTGCTCCAGG - Intergenic
900185541 1:1331515-1331537 CCAGCAGCCCTGTGTGCACCAGG + Exonic
902037001 1:13465065-13465087 TCAGCAGCCTGAGGTACAACAGG + Intergenic
903295934 1:22343053-22343075 CCAGCAGCCCTCGGGACACCTGG + Intergenic
903706963 1:25292986-25293008 TCAGCAGCATTCAGCCCACCTGG - Intronic
903720275 1:25400361-25400383 TCAGCAGCATTCAGCCCACCTGG + Intronic
905177958 1:36149708-36149730 TCCGCAGCCTTCGGTAATCCTGG + Intronic
907588906 1:55646946-55646968 TCTGCAGCCTTGAGTGCAGCCGG - Intergenic
908023428 1:59922151-59922173 CCAGCAGCCTGCAGTGCAACAGG - Intronic
910098373 1:83549978-83550000 TCAGTTGCCTTGGGTGCACCAGG - Intergenic
912960316 1:114190148-114190170 GCAGCAGCCTTCAGTGAAGCTGG - Intergenic
914972204 1:152317485-152317507 TCAGCAGCATTTGATGCAACTGG + Intronic
915341271 1:155178142-155178164 CCAGCAGGCTCCGGTGCTCCTGG - Exonic
917506172 1:175629081-175629103 TCAGCTGTCTGCGGTGCACTGGG + Intronic
919152151 1:193714935-193714957 GCAGGATCCTTCAGTGCACCAGG + Intergenic
920570103 1:207009867-207009889 TCAACAGGCTTCGGTGTACAAGG - Intronic
924512818 1:244741817-244741839 TCATCAGCCTTTGGAGCAGCTGG - Intergenic
1065867346 10:29925580-29925602 TCTCCAGCCTTTGGTGCTCCTGG + Intergenic
1071203934 10:83252716-83252738 GCAGCAGCCTGAGTTGCACCTGG + Intergenic
1073303952 10:102488257-102488279 AAAGCAGCCCTCGGTGCTCCTGG + Exonic
1074714238 10:116203384-116203406 TCTGCAGCCTCTGATGCACCTGG - Intronic
1080445376 11:32333346-32333368 TGGGCCGCCTTCCGTGCACCTGG - Intergenic
1080959050 11:37136280-37136302 TCAGCAGCCTGCAATGCAACGGG - Intergenic
1082871404 11:57946236-57946258 TCAGCAGCCTGGGGTGCACATGG + Intergenic
1085504068 11:77046098-77046120 ACTGCAGCCTTCCGTGGACCTGG - Intergenic
1087837239 11:102887293-102887315 TCTTCAGCCTTTGGTGCATCGGG + Intergenic
1097612069 12:61835901-61835923 TAAGCAGCCTTCAGTTCAGCAGG + Intronic
1104381465 12:128311675-128311697 ACCGCAGCCTGCGGGGCACCAGG - Intronic
1104820932 12:131677264-131677286 CCGGCAGCCCTGGGTGCACCCGG - Intergenic
1111619102 13:90700412-90700434 ACAGCAGCCTGCCCTGCACCTGG - Intergenic
1116395773 14:44447301-44447323 TCACCAGCCTTAGGTGTAACGGG - Intergenic
1122127779 14:99588374-99588396 ACAGCAGGCTTAGGAGCACCCGG - Intronic
1122933484 14:104945355-104945377 TCAGCTCCCTTCTGTGGACCTGG - Exonic
1127282431 15:57503536-57503558 TCATCAGCCTGCGGTGTTCCAGG + Intronic
1128227019 15:66008984-66009006 TCAGCAGCCTCCAGCTCACCTGG - Intronic
1130178779 15:81604516-81604538 ACAGCAGCCTTTGGTGTAACCGG - Intergenic
1133892199 16:9891021-9891043 CCACCAGCCTGGGGTGCACCTGG + Exonic
1141303400 16:82838640-82838662 TAAGCAGCCCTCTGTGAACCAGG - Intronic
1141379556 16:83564168-83564190 TCAGGTGCCTTCTGTGTACCAGG + Intronic
1142611870 17:1113043-1113065 TTAGCCGCCTGCTGTGCACCAGG + Intronic
1145103041 17:20092709-20092731 TCAACAGCCTTCTGTGTGCCTGG + Intronic
1146662742 17:34675381-34675403 TCACCAGCCCTCAGTGAACCTGG - Intergenic
1147402890 17:40191647-40191669 TCAGCCGCCTTCGACTCACCTGG + Exonic
1147845271 17:43400150-43400172 TCAGCAGCGCTCAGTGCCCCGGG - Exonic
1151804648 17:76397873-76397895 CCAGCAGCCATCGGTGGGCCAGG - Exonic
1152061832 17:78082090-78082112 CCAGCAGCCTGCGGTGCAACAGG + Intronic
1152236768 17:79143002-79143024 ACAGCAGCCCACCGTGCACCAGG - Intronic
1152332897 17:79683871-79683893 ACAGCAGCCCTCGGTTCTCCAGG - Intergenic
1155434232 18:25794638-25794660 CCAGCAGCCTTCTGAGCATCCGG + Intergenic
1160519014 18:79493937-79493959 TCAGCGGCCTCCGGAGCACCCGG - Intronic
1160874155 19:1289598-1289620 TCTGCAGCCTTGGGGGCACTGGG + Intronic
1161135484 19:2617146-2617168 TCAGCACCCTGCAGTGCACCAGG - Intronic
1161563002 19:4984116-4984138 TCAGCACCCTGCAGTGCCCCGGG + Intronic
1162718547 19:12648384-12648406 TCAGCAGCCTTCGGTGCACCTGG + Exonic
1163518924 19:17780602-17780624 TCAGCACCCTACAGTGCACAGGG + Intronic
1165435030 19:35790762-35790784 CCAGCAGCCGTCGGCTCACCAGG - Intergenic
1166350938 19:42197836-42197858 TCATCAGCCTTGGGTGTAGCTGG + Intergenic
926105080 2:10144963-10144985 CCAGCAGCCTTGGGGGCTCCCGG - Intronic
926144679 2:10389482-10389504 TCAGGAGCCATCTGTACACCAGG + Intronic
927496024 2:23552516-23552538 TCAGCAGCAGTGGGTGCAGCTGG - Intronic
930889390 2:56365431-56365453 TCAGCAGCCTTCGAAGGAACTGG - Intronic
934845509 2:97659459-97659481 TCAGCAGCCCCCGGTGCTCCTGG + Exonic
937011728 2:118568849-118568871 TCAGCTGGCTTCTGTGCAGCCGG - Intergenic
948355481 2:237374018-237374040 TCAGCAGCCTTCTGTGAGGCAGG - Intronic
948459804 2:238123671-238123693 TCAGCAGCCCCCGGTGTCCCAGG + Intronic
1169209914 20:3760149-3760171 TCAGCAGCCTCCCATGCTCCAGG + Exonic
1169284784 20:4298846-4298868 GCAGCAGCCTTCTGGTCACCTGG + Intergenic
1171205859 20:23280381-23280403 TAAGGAGCCTGCTGTGCACCAGG + Intergenic
1173844473 20:46179189-46179211 GCAGCAGCCTTCGGAGCTCTGGG - Intronic
1179504424 21:41831315-41831337 TCAGCATCCCACGGTGCACAGGG - Intronic
1183342699 22:37290621-37290643 TCAGCCTCCTCCGGTGTACCTGG + Intronic
1184188999 22:42882472-42882494 TCAGGAGCCATCTGTGCACGTGG - Intronic
1185173505 22:49306645-49306667 CCAGCAGCCTTCGGTGTGCCTGG + Intergenic
955839603 3:63097582-63097604 TCAGCAGGCTTTGGTTGACCGGG + Intergenic
963120062 3:141768818-141768840 TCAGCAGCATTCGATGCAGTTGG + Intergenic
966208955 3:177433222-177433244 TCAGCAGCCTGTGCTGCCCCAGG + Intergenic
968461535 4:728135-728157 TCACCTGCTTTAGGTGCACCCGG + Intronic
971224260 4:24736630-24736652 TCAGCAGCCTCCTGAGCAGCTGG - Intergenic
975720707 4:77246068-77246090 TCAACAGGCTCAGGTGCACCAGG - Intronic
975992246 4:80268705-80268727 TCAGCAGCCTGCGGCGCACGTGG + Intronic
984146715 4:176070626-176070648 ACAGCAGCCTTCTGAGCAGCTGG + Intronic
985487443 5:159298-159320 ACACCTGCCCTCGGTGCACCTGG - Intronic
985635884 5:1035769-1035791 TCAGCAGCTTTGGGGGCAACAGG + Intronic
991575496 5:68099161-68099183 TCCGCAGCCTTTTGGGCACCGGG + Intergenic
995039043 5:107567712-107567734 TCTGCAGCCTTCAGGGAACCTGG - Intronic
998801381 5:145872991-145873013 TCTCCAGCCTTCCGTGCAGCCGG + Intergenic
999966872 5:156819638-156819660 TGAGCAGTCTTCTGTGCACCAGG + Intergenic
1004165892 6:13256164-13256186 GCAGCAGCCTGAGCTGCACCTGG + Intronic
1012626808 6:101414763-101414785 TTCCCAGCCTTCTGTGCACCAGG - Intronic
1013125483 6:107180213-107180235 TCAGAAGCCACCTGTGCACCAGG - Intronic
1015663837 6:135604552-135604574 GAAGCTGCTTTCGGTGCACCTGG + Intergenic
1016130221 6:140459034-140459056 TAATCAGCCTTGGCTGCACCGGG + Intergenic
1019547979 7:1587519-1587541 TCAGCAGCCTCCGGGGCACCTGG - Intergenic
1024051601 7:45627348-45627370 TCACCAGCCTTCTGTGGAACGGG + Intronic
1030676945 7:112394162-112394184 TCAGCAGCCTTGGATGGAGCTGG - Intergenic
1031297437 7:120019761-120019783 ACAGCAGCATTCTGTGCACATGG - Intergenic
1032069181 7:128793095-128793117 TCAGCAGCCTTAGGTTCAACTGG - Intronic
1032444079 7:131965663-131965685 TCAGCAGACTTAGGGGGACCAGG + Intergenic
1034099147 7:148436585-148436607 TCAGCATCCTTCCCTCCACCTGG + Intergenic
1035256526 7:157632292-157632314 TCACCAGGCGTTGGTGCACCAGG - Intronic
1038485903 8:27935113-27935135 TCAGCAGCCTTGGTTGCTTCTGG - Intronic
1039751476 8:40482647-40482669 TCAGCAGCGTCCTGAGCACCAGG + Intergenic
1042480225 8:69294590-69294612 TGGGCAGACTTCGGTGCAGCAGG + Intergenic
1047716909 8:127603975-127603997 GCAGCAGCCTTCCGAGCAGCTGG - Intergenic
1057933727 9:99218994-99219016 TCTGTAGCCTTCTGTACACCAGG - Intronic
1060345213 9:122809908-122809930 CCAGCAGCCTGCAGTGCAACGGG - Intronic
1061048266 9:128179180-128179202 TCTGCAGCTTTGGCTGCACCTGG + Exonic
1062475082 9:136722714-136722736 CTGGCAGCCTTGGGTGCACCTGG - Intronic
1185863898 X:3605437-3605459 TGTGCAGCCTGAGGTGCACCTGG + Exonic
1185871567 X:3669013-3669035 TCAGCACCCTACAGTGCACAGGG + Intronic
1187649992 X:21391479-21391501 TCAGCAGCCTAAGGTGTATCTGG + Intronic
1189192471 X:39122428-39122450 TCACCAGCCTCCGTTACACCTGG + Intergenic
1192151204 X:68713565-68713587 TCAGCAGCATTCGGTGCCACTGG + Intronic
1193789426 X:85800394-85800416 TCTGCAGGCTTCATTGCACCAGG - Intergenic
1199560957 X:149161861-149161883 ACAGCAGCCTCCGGTGCCCAGGG + Intergenic
1199998355 X:153041694-153041716 TCAGCCTCCTTCCCTGCACCTGG + Intergenic
1200092724 X:153643420-153643442 TCAGCAGCCTTGGGCCCCCCAGG + Intronic