ID: 1162718548

View in Genome Browser
Species Human (GRCh38)
Location 19:12648385-12648407
Sequence CAGCAGCCTTCGGTGCACCT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 246}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162718543_1162718548 -6 Left 1162718543 19:12648368-12648390 CCGCGTCCATCGTCCTTCAGCAG 0: 1
1: 0
2: 1
3: 6
4: 77
Right 1162718548 19:12648385-12648407 CAGCAGCCTTCGGTGCACCTGGG 0: 1
1: 0
2: 2
3: 20
4: 246
1162718535_1162718548 28 Left 1162718535 19:12648334-12648356 CCCCGACCCGTTCTCCATTAGTG 0: 1
1: 0
2: 0
3: 1
4: 38
Right 1162718548 19:12648385-12648407 CAGCAGCCTTCGGTGCACCTGGG 0: 1
1: 0
2: 2
3: 20
4: 246
1162718536_1162718548 27 Left 1162718536 19:12648335-12648357 CCCGACCCGTTCTCCATTAGTGG 0: 1
1: 0
2: 0
3: 4
4: 51
Right 1162718548 19:12648385-12648407 CAGCAGCCTTCGGTGCACCTGGG 0: 1
1: 0
2: 2
3: 20
4: 246
1162718538_1162718548 26 Left 1162718538 19:12648336-12648358 CCGACCCGTTCTCCATTAGTGGC 0: 1
1: 0
2: 0
3: 4
4: 67
Right 1162718548 19:12648385-12648407 CAGCAGCCTTCGGTGCACCTGGG 0: 1
1: 0
2: 2
3: 20
4: 246
1162718540_1162718548 21 Left 1162718540 19:12648341-12648363 CCGTTCTCCATTAGTGGCTCCGA 0: 1
1: 0
2: 3
3: 7
4: 63
Right 1162718548 19:12648385-12648407 CAGCAGCCTTCGGTGCACCTGGG 0: 1
1: 0
2: 2
3: 20
4: 246
1162718534_1162718548 29 Left 1162718534 19:12648333-12648355 CCCCCGACCCGTTCTCCATTAGT 0: 1
1: 0
2: 0
3: 3
4: 62
Right 1162718548 19:12648385-12648407 CAGCAGCCTTCGGTGCACCTGGG 0: 1
1: 0
2: 2
3: 20
4: 246
1162718539_1162718548 22 Left 1162718539 19:12648340-12648362 CCCGTTCTCCATTAGTGGCTCCG 0: 1
1: 0
2: 0
3: 8
4: 55
Right 1162718548 19:12648385-12648407 CAGCAGCCTTCGGTGCACCTGGG 0: 1
1: 0
2: 2
3: 20
4: 246
1162718542_1162718548 2 Left 1162718542 19:12648360-12648382 CCGATACTCCGCGTCCATCGTCC 0: 1
1: 0
2: 0
3: 1
4: 32
Right 1162718548 19:12648385-12648407 CAGCAGCCTTCGGTGCACCTGGG 0: 1
1: 0
2: 2
3: 20
4: 246
1162718541_1162718548 14 Left 1162718541 19:12648348-12648370 CCATTAGTGGCTCCGATACTCCG 0: 1
1: 0
2: 0
3: 0
4: 13
Right 1162718548 19:12648385-12648407 CAGCAGCCTTCGGTGCACCTGGG 0: 1
1: 0
2: 2
3: 20
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162718548 Original CRISPR CAGCAGCCTTCGGTGCACCT GGG Exonic
900474069 1:2868165-2868187 CAGCAGCCATAGGTGGCCCTGGG - Intergenic
901054124 1:6440708-6440730 CAGCAGCCAGCTGAGCACCTTGG - Exonic
902421724 1:16286000-16286022 CATCAGCCTTCCGAGCAGCTGGG + Intronic
902520764 1:17014553-17014575 CCTCAGCCTTCTGTGTACCTGGG + Intergenic
902530911 1:17090111-17090133 CAGAAGGCTTCAGTGCTCCTAGG - Intronic
903134885 1:21302898-21302920 CAGCAGCCTGCCGTGGCCCTGGG + Intronic
903295935 1:22343054-22343076 CAGCAGCCCTCGGGACACCTGGG + Intergenic
903680104 1:25090813-25090835 CAGCAGCCTTGCCTGCTCCTGGG - Intergenic
903706962 1:25292985-25293007 CAGCAGCATTCAGCCCACCTGGG - Intronic
903720276 1:25400362-25400384 CAGCAGCATTCAGCCCACCTGGG + Intronic
904469809 1:30729349-30729371 CAGGAGCCTGCAGTGCAGCTGGG + Intergenic
904631859 1:31848480-31848502 CAGGAGCCATCGGTGCTGCTTGG + Intergenic
905177960 1:36149709-36149731 CCGCAGCCTTCGGTAATCCTGGG + Intronic
908023427 1:59922150-59922172 CAGCAGCCTGCAGTGCAACAGGG - Intronic
909480235 1:76122520-76122542 AAGGAGTCTTCGGTTCACCTTGG - Intronic
910159373 1:84257036-84257058 CAGTAGCCTGCAGTGAACCTGGG - Intergenic
911848926 1:102789859-102789881 CAGCAGCCTGCAATGCAACTGGG + Intergenic
912960315 1:114190147-114190169 CAGCAGCCTTCAGTGAAGCTGGG - Intergenic
915151300 1:153834116-153834138 CCTCAGCCTTCCGTGCAGCTGGG + Intronic
915719209 1:157971764-157971786 CAGCAGCCTGAGCTGCATCTTGG + Intergenic
917347440 1:174042878-174042900 CAGCAGCCTCCTGGGCTCCTGGG + Intergenic
917639446 1:176968907-176968929 CACCAGCCTTCCCTGCACCCAGG - Intronic
917777467 1:178352861-178352883 CAGCAGCCTAAGCTGTACCTGGG + Intronic
919152152 1:193714936-193714958 CAGGATCCTTCAGTGCACCAGGG + Intergenic
920011813 1:202873585-202873607 CAGCAGCACTGGGTGCTCCTTGG - Intergenic
920785317 1:209035257-209035279 CAGCAGCCTGAGCTGTACCTGGG + Intergenic
922966311 1:229693907-229693929 CAGGGGCGTTCAGTGCACCTTGG + Intergenic
924512817 1:244741816-244741838 CATCAGCCTTTGGAGCAGCTGGG - Intergenic
924530398 1:244889065-244889087 CATCAGCCTCCGGTGGAGCTGGG + Intergenic
1063098195 10:2926692-2926714 CTGCAGCCTGCGGTACACCATGG - Intergenic
1064674750 10:17749808-17749830 CAGGAGCCTCCGATGCACCCTGG + Intergenic
1065016205 10:21464970-21464992 CCTCAGCCTCCTGTGCACCTGGG - Intergenic
1065506925 10:26438649-26438671 CAGGGGCCTTCCTTGCACCTCGG + Exonic
1065785175 10:29206268-29206290 CTGCACCCTTCTGTGCATCTTGG - Intergenic
1066695876 10:38077112-38077134 CAGCAGCCCAAGCTGCACCTGGG + Intergenic
1071203935 10:83252717-83252739 CAGCAGCCTGAGTTGCACCTGGG + Intergenic
1073303953 10:102488258-102488280 AAGCAGCCCTCGGTGCTCCTGGG + Exonic
1073884188 10:108019468-108019490 CAGCAGTCTGAGGTCCACCTGGG + Intergenic
1075253419 10:120903776-120903798 CAGAATCCTTCAGTGCACATAGG + Intronic
1076623303 10:131806727-131806749 GCGCAGCCTTCGGTGCTCTTCGG + Intergenic
1077591027 11:3491186-3491208 CAGGAGCTTTGGGTGCACATGGG - Intergenic
1078538226 11:12192282-12192304 CAGCAGCCTCCTGGGCACCCAGG + Intronic
1078767583 11:14313701-14313723 CAGCAGCCCTTTGTGCTCCTTGG - Intronic
1079007795 11:16804326-16804348 CAGCAGCTATCGGTCCACATTGG - Intronic
1080051493 11:27863599-27863621 CAGCAGCCTCTGCAGCACCTAGG + Intergenic
1083792409 11:64994523-64994545 CAGCTGCCTTTGTTGCTCCTTGG + Exonic
1084246742 11:67862937-67862959 CAGGAGCTTTGGGTGCACATGGG - Intergenic
1084317746 11:68355119-68355141 CAGGAGCCTCAGGTGCACCAAGG - Intronic
1084825936 11:71731555-71731577 CAGGAGCTTTTGGTGCACATGGG + Intergenic
1093207048 12:16263757-16263779 CAGCAGCCTGAGCTGTACCTTGG - Intronic
1096275981 12:50208532-50208554 CTGCAGCCTTCTGAGTACCTGGG - Intronic
1097334940 12:58371623-58371645 CTCCAGCCTTCCCTGCACCTTGG - Intergenic
1097460039 12:59850346-59850368 CAGCACACTTCAGTGCAGCTGGG + Intergenic
1097691430 12:62738183-62738205 CAGCAGCATTGGCTTCACCTGGG + Intronic
1101061438 12:100976639-100976661 CAGCAGCATTAGCTGCAGCTGGG - Intronic
1101742808 12:107514147-107514169 CAGCTGCCCTCTGTGCAACTGGG - Intronic
1103144424 12:118582343-118582365 CAGCAGCCCTCGGGGCTGCTCGG - Intergenic
1103315249 12:120049168-120049190 CAGAAGCTTTCTGTGCTCCTTGG - Intronic
1104598178 12:130134034-130134056 CGGCAGCCGTCGGTGTTCCTCGG - Intergenic
1106383744 13:29264692-29264714 CAGCAGCCTGAGCTGTACCTGGG + Intronic
1111619101 13:90700411-90700433 CAGCAGCCTGCCCTGCACCTGGG - Intergenic
1112953670 13:105033775-105033797 CCTCAGCCTACGGTGCAACTAGG + Intergenic
1116964358 14:50999140-50999162 CAGCAGCATTGGTTTCACCTGGG - Intronic
1116998287 14:51346926-51346948 CAACAGCCTGGGTTGCACCTTGG - Intergenic
1117624226 14:57618813-57618835 CAGCAGTCTGAGGTGGACCTGGG + Intronic
1117886723 14:60371823-60371845 CAGCAGCCTGAGCTGTACCTGGG - Intergenic
1118945411 14:70381663-70381685 CAGCAGCCTTAGCATCACCTGGG + Intronic
1119025761 14:71151055-71151077 CAGCAGCCTGAGCTGTACCTGGG - Intergenic
1119530514 14:75357076-75357098 CAGAATCCTTCAGGGCACCTGGG + Intergenic
1123917960 15:25051200-25051222 CACCAGCATTGGGTGCACCATGG - Intergenic
1124166164 15:27327741-27327763 CAGAAGCCCTGGGTGCATCTAGG + Intronic
1125219555 15:37317645-37317667 CAGCAGTCTGAGGTCCACCTGGG + Intergenic
1125979811 15:43989868-43989890 CAGCAGCATGGGGTGCTCCTTGG + Intronic
1128483315 15:68059118-68059140 CCTCAGCCTTCGGTGTAGCTGGG + Intronic
1128691309 15:69726661-69726683 CAGCTCGCTACGGTGCACCTTGG - Intergenic
1129673019 15:77617452-77617474 CTGCAGCCTCCAGTGCCCCTGGG + Intronic
1130168223 15:81484933-81484955 CAGCAACCTTTTGTACACCTTGG - Intergenic
1130686295 15:86040679-86040701 CAGCAGCCTTCCAGGAACCTAGG - Intergenic
1131248180 15:90813959-90813981 CAGCAGCCTCCATTTCACCTGGG - Intronic
1131566184 15:93487477-93487499 CTGCAACCTCTGGTGCACCTTGG - Intergenic
1131626571 15:94126937-94126959 CAGCAGCATTCATTTCACCTGGG + Intergenic
1132735866 16:1385571-1385593 CAGCGGGCTACGGTGCACTTGGG + Intronic
1132743512 16:1427485-1427507 CAGCAGCCTCTGGGGCATCTGGG - Intergenic
1134063180 16:11211168-11211190 CAGGAGCCCTCAGGGCACCTGGG - Intergenic
1134116064 16:11549728-11549750 CAGCAGCCCGCTATGCACCTGGG + Exonic
1136567075 16:31076933-31076955 CAGCAGCCTTCTTAGCAACTTGG + Exonic
1137553321 16:49455076-49455098 CAGCAGACATAGGTGCCCCTTGG + Intergenic
1139223782 16:65214065-65214087 CAGCAGCTTTCAGTGTTCCTGGG - Intergenic
1140141144 16:72259143-72259165 CTGCAGCCCTAGGTGCTCCTTGG - Intergenic
1140477639 16:75246961-75246983 CAGCAGCCTCCACTGCGCCTTGG - Intronic
1140861908 16:79025525-79025547 CAGCAGCCCTCAGTGCTCCCTGG - Intronic
1141539464 16:84708332-84708354 CCTCAGCCTTCGGAGCAGCTGGG - Intronic
1141997236 16:87643349-87643371 CAGCAGCTGCCTGTGCACCTGGG - Intronic
1146662741 17:34675380-34675402 CACCAGCCCTCAGTGAACCTGGG - Intergenic
1147402891 17:40191648-40191670 CAGCCGCCTTCGACTCACCTGGG + Exonic
1147619393 17:41855191-41855213 CAGCAGCCTTCAGAGCAAGTTGG + Exonic
1147894185 17:43739907-43739929 CAGCAGCCCCCGGGGCCCCTGGG + Intergenic
1149560135 17:57602809-57602831 CAGCAGCCTTGGCAGCCCCTAGG + Intronic
1150333572 17:64313881-64313903 CACCTGCCTTCTGTGGACCTTGG - Intergenic
1152061833 17:78082091-78082113 CAGCAGCCTGCGGTGCAACAGGG + Intronic
1152259983 17:79261631-79261653 CAGCAGCCTCCGTGTCACCTGGG - Intronic
1152589776 17:81205781-81205803 CTTCAGCCTTCGGAGCAGCTGGG - Intronic
1152665090 17:81563452-81563474 CATCAGCTTTCGGAGTACCTAGG - Intronic
1153306914 18:3639868-3639890 CCTCAGCCTTCGGAGCAGCTGGG + Intronic
1153313416 18:3699991-3700013 CAGCAGCCTGAAGTCCACCTGGG - Intronic
1153431033 18:5017337-5017359 CTGCAGCCTCCTGGGCACCTGGG - Intergenic
1155280771 18:24237418-24237440 CCGCAGCCTTCTGAGCAGCTGGG + Intronic
1157265854 18:46221018-46221040 CACCAGCCTCCGGAGCAGCTGGG - Intronic
1157807752 18:50670814-50670836 CAGCAGCCTCAGCTTCACCTAGG + Intronic
1158634765 18:59146980-59147002 CAGCAGCTTTCGTGTCACCTGGG + Intronic
1159172642 18:64791390-64791412 CAGCAGCCCTAGATGCACGTTGG - Intergenic
1160013791 18:75125762-75125784 CAGCAGCATTCTGTGCAGGTGGG - Intergenic
1160120154 18:76122751-76122773 CAGCAGTCTTTGCTGCTCCTTGG + Intergenic
1162105763 19:8368740-8368762 CCGCAGCCTCCGGAGCAGCTGGG - Intronic
1162718548 19:12648385-12648407 CAGCAGCCTTCGGTGCACCTGGG + Exonic
1162760714 19:12886719-12886741 CATCAGCCTACGGAGTACCTGGG + Intronic
1163055190 19:14712654-14712676 CTGCAGCCCTTGGTGCTCCTTGG + Intronic
1163679409 19:18672104-18672126 CAGGAGCCTCCCTTGCACCTGGG + Intergenic
1163898094 19:20077229-20077251 CCTCAGCCTTCGGTGTAGCTGGG + Intergenic
1164152377 19:22566188-22566210 CAGCAGTCTGAGGTCCACCTGGG - Intergenic
1165435029 19:35790761-35790783 CAGCAGCCGTCGGCTCACCAGGG - Intergenic
1167242635 19:48353858-48353880 CAGCAACCCTTGGTGCTCCTTGG - Intronic
1168087864 19:54061698-54061720 CCGCAGCCTTCTGAGCAGCTAGG - Intronic
925826397 2:7852383-7852405 CTGCAGCCTTGGGAGAACCTGGG - Intergenic
929402292 2:41598644-41598666 CAGCCACCTTCCTTGCACCTAGG + Intergenic
930928474 2:56850758-56850780 CAGCAGCATTTGGTCCAGCTGGG - Intergenic
932260757 2:70325177-70325199 CAGCAGCCTGGGCTCCACCTGGG - Intergenic
933899346 2:86837900-86837922 CAGCAACCTTAGGTGAGCCTGGG - Intronic
935506161 2:103906302-103906324 CCGCAGCCTTCTGTGTAGCTAGG - Intergenic
935781215 2:106511328-106511350 CAGCAACCTTAGGTGAGCCTGGG + Intergenic
936171897 2:110184240-110184262 GAGCAGCCCTTGGTGCTCCTTGG - Intronic
937037785 2:118796077-118796099 CATCAGCCTGGGATGCACCTGGG - Intergenic
939946921 2:148421704-148421726 CAGCAGTCTGAGGTCCACCTGGG + Intronic
940258499 2:151757292-151757314 CAGCAGCATTAGGATCACCTGGG - Intergenic
943409791 2:187532852-187532874 CAGCAGCCTTAAGTCGACCTGGG + Intronic
945122119 2:206467942-206467964 CAGCAGCCTGAGCTGTACCTGGG + Intronic
946164659 2:217856642-217856664 CAGGAGACTTAGGTGCACGTTGG + Intronic
948152679 2:235756725-235756747 CAGCAGCCTTAGATTCTCCTAGG + Intronic
948704758 2:239782008-239782030 CAGCAGCCCTTGGTGTTCCTTGG - Intronic
1169165074 20:3415850-3415872 CAGCAGCCTGAGTTGTACCTGGG + Intergenic
1170620457 20:17991429-17991451 CCTCAGCCTCCGGAGCACCTGGG - Intronic
1170727339 20:18941719-18941741 CAGCAGTCTGAGGTGGACCTGGG - Intergenic
1171440953 20:25162509-25162531 CAGCAGCCTCCTGAGCAGCTGGG + Intergenic
1172302273 20:33858526-33858548 CAGCATTCTTGGGTGCTCCTTGG + Intergenic
1173254067 20:41380957-41380979 CAGCAGCTTTGGGTGGTCCTGGG - Intergenic
1173334763 20:42103409-42103431 CAGCAGCATTGGCTTCACCTGGG - Intronic
1173347335 20:42213101-42213123 CAGCAGCATCCGCTTCACCTGGG + Intronic
1174189479 20:48730010-48730032 CAGCGGCCGTCGGTGCTCCCTGG - Intronic
1174310704 20:49651739-49651761 CAGCAGCCTTGGTTGCACATTGG + Intronic
1174531437 20:51217693-51217715 CAGCAGCCTGAGCTGTACCTTGG + Intergenic
1178550565 21:33534767-33534789 CAGTAGCCTTAGGTGAACCAAGG + Intronic
1179119174 21:38527291-38527313 CAGCAGCCTCAGCTGCAGCTGGG + Intronic
1179444189 21:41420136-41420158 CAGCAGCATTGGCTTCACCTGGG - Intergenic
1183342700 22:37290622-37290644 CAGCCTCCTCCGGTGTACCTGGG + Intronic
1183473497 22:38022433-38022455 CCTCAGCCTTCTGAGCACCTGGG - Intronic
1184349395 22:43933801-43933823 CACCAACCTTTGGTGCTCCTGGG + Intronic
1184366028 22:44051934-44051956 CATCAGTCCTCGGTGCATCTTGG - Intronic
1184594275 22:45504384-45504406 CAGGAGCCTTCGCAGCCCCTGGG + Intronic
1185066840 22:48636703-48636725 CAGCAGCCCTGGGGGCTCCTGGG - Intronic
1185088986 22:48755510-48755532 CAGCAGCCTTCCCTGCACCCTGG + Intronic
1185173506 22:49306646-49306668 CAGCAGCCTTCGGTGTGCCTGGG + Intergenic
950237757 3:11338562-11338584 CTTCAGCCTTCGGAGCAGCTAGG - Intronic
952955107 3:38551971-38551993 CAGCAGCCTTGGGATCTCCTAGG + Intronic
955389267 3:58508362-58508384 CAGCAGCTTTCTTTGCTCCTTGG + Intronic
956604372 3:71057788-71057810 CCGCAGGTTTGGGTGCACCTGGG - Intronic
956793289 3:72696559-72696581 CTTCAGCCTTCGGAGCAGCTGGG + Intergenic
957524121 3:81358092-81358114 CAGCAGCCTGAGCTGTACCTTGG - Intergenic
958256565 3:91332088-91332110 CAGCAGCCTGAGATGTACCTAGG - Intergenic
958964693 3:100546192-100546214 CAGCAGCCTAGGTGGCACCTTGG + Intronic
959138196 3:102451721-102451743 CAGCAACCTTGGGTGTGCCTGGG + Intronic
959202949 3:103271654-103271676 CAACAGCCTGAGTTGCACCTTGG + Intergenic
959661036 3:108868563-108868585 CCGCAGCCTCCGGAGCAGCTGGG - Intergenic
961473448 3:127132697-127132719 CAGTACCCTTCGGTGGGCCTGGG - Intergenic
961894862 3:130158671-130158693 CAGGAGCTTTGGGTGCACATGGG - Intergenic
964258347 3:154805090-154805112 CTGCAGCCTGAGCTGCACCTTGG + Intergenic
965806006 3:172542593-172542615 CAGCAGTCTCTGCTGCACCTGGG + Intergenic
968295119 3:197570582-197570604 CCGCAGCCTGAGGTGTACCTTGG - Intronic
968507372 4:977107-977129 CAGCAGCCCTCGGTGATCCTTGG - Intronic
968607984 4:1544590-1544612 CAGCAGCCCTCGGTGATCCTTGG - Intergenic
969747910 4:9088424-9088446 CAGGAGCTTTGGGTGCACATGGG + Intergenic
969808944 4:9632957-9632979 CAGGAGCTTTCGGCGCACATGGG + Intergenic
971056021 4:22913761-22913783 CCTCAGCCTTTGGAGCACCTAGG + Intergenic
971224259 4:24736629-24736651 CAGCAGCCTCCTGAGCAGCTGGG - Intergenic
971557858 4:28036873-28036895 CAGCAGCCTGAGCTGTACCTGGG + Intergenic
973798392 4:54451472-54451494 CAGCAGTCTTAAGTGGACCTGGG + Intergenic
974625931 4:64429143-64429165 CAGCAGCCTGAGATGTACCTGGG - Intergenic
975507030 4:75148883-75148905 CAGCAGCCTGAGCTGTACCTTGG + Intergenic
980354031 4:131721989-131722011 CAGCAGCCTGAGCTGTACCTGGG + Intergenic
981131360 4:141161752-141161774 TAGCAGCCTGAGGTGTACCTGGG - Intronic
981831908 4:149011426-149011448 CAGCAGCCATTGCTGCTCCTTGG - Intergenic
982019426 4:151188954-151188976 CAGCAGTCTTTGGTGTACCTTGG - Intronic
982419519 4:155177810-155177832 CAGCAGCCTTAGCCACACCTAGG + Intergenic
983341072 4:166461945-166461967 CAGCAGCCTCAAGTGCACCCAGG + Intergenic
983379097 4:166968514-166968536 CAACAGCCTGAGCTGCACCTTGG - Intronic
984146716 4:176070627-176070649 CAGCAGCCTTCTGAGCAGCTGGG + Intronic
984493676 4:180468698-180468720 CAGCAGCCTGAAGTGGACCTGGG + Intergenic
985487424 5:159225-159247 CACCTGCCCTCAGTGCACCTGGG - Intronic
985487433 5:159261-159283 CACCTGCCCTCAGTGCACCTGGG - Intronic
985487442 5:159297-159319 CACCTGCCCTCGGTGCACCTGGG - Intronic
985921810 5:2983474-2983496 CAGCAGCCTTCCGTGCAGGAAGG - Intergenic
986182602 5:5407479-5407501 TAGCAGCCTTCGGTCTACTTTGG - Intergenic
986208981 5:5652408-5652430 CCGCAGCCTTAGGTTCTCCTGGG + Intergenic
986708528 5:10470920-10470942 CAGCAGCCTTCCCTGCCACTGGG - Intronic
990448430 5:55914419-55914441 CAGCAGCATTGGGATCACCTGGG - Intronic
991507624 5:67342031-67342053 CAGCAGCATTGGCTTCACCTTGG - Intergenic
992614724 5:78537004-78537026 CAGCAGCGTTGGTGGCACCTAGG + Intronic
994823308 5:104680642-104680664 CAACAGCCTGCGTTGTACCTTGG - Intergenic
997165863 5:131659802-131659824 CAGCAGCATACGGTGCTCCTTGG + Intronic
997995711 5:138584348-138584370 CAGCTTTCTTCGGTGGACCTAGG + Intergenic
998136116 5:139675559-139675581 GAGCAGCCTTAGGGGTACCTAGG + Intronic
1002007227 5:176245311-176245333 CAGCAGTCCTCGGTGTTCCTTGG - Intronic
1002219153 5:177665311-177665333 CAGCAGTCCTCGGTGTTCCTTGG + Intergenic
1004165893 6:13256165-13256187 CAGCAGCCTGAGCTGCACCTGGG + Intronic
1004206907 6:13599610-13599632 CAGCAGCCTTTGGGCCACATTGG + Intronic
1005597601 6:27394363-27394385 CAGCAGCCTGAGCTGTACCTGGG - Intronic
1007884754 6:45214594-45214616 CATCAGCCTTCTGAGCAGCTGGG - Intronic
1008998774 6:57689072-57689094 CAGCAGCCTGAGATGTACCTAGG + Intergenic
1009938319 6:70259805-70259827 CAGCAGCCTGCGGAGTGCCTTGG + Intronic
1016937522 6:149458249-149458271 CCTCAGCCTTCCGTGCAGCTAGG + Intronic
1019547978 7:1587518-1587540 CAGCAGCCTCCGGGGCACCTGGG - Intergenic
1019552488 7:1610113-1610135 CAGCAGGCTTGGCTGGACCTTGG + Intergenic
1020325092 7:6968210-6968232 CAGGAGCTTTGGGTGCACATGGG - Intergenic
1024372917 7:48607072-48607094 CAGCAGTCTGAGGTGGACCTGGG - Intronic
1024415979 7:49107714-49107736 CAACAGCCTGAGCTGCACCTTGG - Intergenic
1026292336 7:69018891-69018913 CAGCAGCCTGAGTTGTACCTGGG + Intergenic
1027191221 7:75996439-75996461 CAGTACCCTTCGGTGGGCCTCGG + Exonic
1030676944 7:112394161-112394183 CAGCAGCCTTGGATGGAGCTGGG - Intergenic
1030752167 7:113241681-113241703 CAGCAGCCTCAGCTGTACCTTGG - Intergenic
1031857116 7:126936547-126936569 CAACAGCCTTCTTTGCACCTCGG + Intronic
1032069180 7:128793094-128793116 CAGCAGCCTTAGGTTCAACTGGG - Intronic
1032312585 7:130802393-130802415 CAGCAGTCTGAGGTGGACCTGGG - Intergenic
1033383866 7:140852251-140852273 CATCAGCCTTCTGAGTACCTGGG - Intronic
1036396971 8:8377979-8378001 CAGCAGGCTTCTGTACACCTCGG + Exonic
1036487503 8:9192844-9192866 CCTCAGCCTCCGGAGCACCTCGG - Intergenic
1037660279 8:20920272-20920294 CAACAGCCTGAGGTGTACCTTGG + Intergenic
1037812625 8:22096009-22096031 CAGCAGCCTTCTGTGGGCCCAGG + Intronic
1038368335 8:26960999-26961021 CAGCAGCATTCGGTTCTCATAGG + Intergenic
1040013102 8:42678649-42678671 AAGCAGCCTTTGCTGCCCCTCGG - Intergenic
1042037468 8:64551588-64551610 CAGCAGCCTCCTGAGCAGCTGGG + Intergenic
1043474207 8:80590504-80590526 CAGCAGCATTGGCAGCACCTGGG + Intergenic
1044327637 8:90877635-90877657 CAGCAGCATTAGTTTCACCTAGG - Intronic
1044937363 8:97306058-97306080 CAGCAGCCTTTGCTGTAGCTAGG + Intergenic
1045064245 8:98431502-98431524 CACCTGCCTTCAGTGCAGCTGGG - Exonic
1045084390 8:98665511-98665533 CATCAGCCTCCGGAGCAGCTGGG + Intronic
1047716908 8:127603974-127603996 CAGCAGCCTTCCGAGCAGCTGGG - Intergenic
1049605671 8:143528156-143528178 AACCACCCTGCGGTGCACCTCGG + Intronic
1049681682 8:143921517-143921539 CAGCAGCTTGTGGTGCAGCTCGG + Exonic
1051706778 9:19889102-19889124 CATCAACCTTCAGAGCACCTTGG + Intergenic
1055019694 9:71656517-71656539 CAGCAGCCTTAGCATCACCTGGG + Intergenic
1055372758 9:75617946-75617968 CAGCAGTCTTTGGTGTTCCTTGG + Intergenic
1056855655 9:90127372-90127394 CATCAGCCTTCTGAGTACCTGGG + Intergenic
1057257194 9:93558964-93558986 CAGAACCTTTCTGTGCACCTGGG + Intronic
1060345212 9:122809907-122809929 CAGCAGCCTGCAGTGCAACGGGG - Intronic
1060482401 9:124024380-124024402 CATCAGCATTCAGGGCACCTGGG - Intronic
1060905076 9:127297252-127297274 CCTCAGCCTTCTGTGCAGCTGGG + Intronic
1061048267 9:128179181-128179203 CTGCAGCTTTGGCTGCACCTGGG + Exonic
1061551709 9:131338703-131338725 CAGCAGCCTCCAGTGTTCCTTGG - Intergenic
1062022961 9:134327655-134327677 CTGCAGCCTGGGGTGCAGCTTGG + Intronic
1062475081 9:136722713-136722735 TGGCAGCCTTGGGTGCACCTGGG - Intronic
1187649993 X:21391480-21391502 CAGCAGCCTAAGGTGTATCTGGG + Intronic
1188105627 X:26144180-26144202 CAGCAGCCTGAGCTGTACCTGGG + Intergenic
1188803293 X:34557977-34557999 CAGCAGCATCAGGAGCACCTGGG - Intergenic
1189957334 X:46288813-46288835 CAGCAGCATGGGGTGCTCCTCGG + Intergenic
1191222346 X:58003018-58003040 CAGCAGCCTGAGGTTGACCTGGG + Intergenic
1192434949 X:71137336-71137358 CAGCAACCTGCGGTGCCCCAAGG + Exonic
1193068589 X:77283101-77283123 CAGCAGACTGAGGTGAACCTGGG + Intergenic
1194419023 X:93649659-93649681 CAGCAGCCTGAGATGTACCTGGG - Intergenic
1199560958 X:149161862-149161884 CAGCAGCCTCCGGTGCCCAGGGG + Intergenic
1201490870 Y:14540064-14540086 CAGCAGTCTTAGGTCAACCTGGG + Intronic