ID: 1162718549

View in Genome Browser
Species Human (GRCh38)
Location 19:12648386-12648408
Sequence AGCAGCCTTCGGTGCACCTG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 139}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162718539_1162718549 23 Left 1162718539 19:12648340-12648362 CCCGTTCTCCATTAGTGGCTCCG 0: 1
1: 0
2: 0
3: 8
4: 55
Right 1162718549 19:12648386-12648408 AGCAGCCTTCGGTGCACCTGGGG 0: 1
1: 0
2: 2
3: 9
4: 139
1162718543_1162718549 -5 Left 1162718543 19:12648368-12648390 CCGCGTCCATCGTCCTTCAGCAG 0: 1
1: 0
2: 1
3: 6
4: 77
Right 1162718549 19:12648386-12648408 AGCAGCCTTCGGTGCACCTGGGG 0: 1
1: 0
2: 2
3: 9
4: 139
1162718540_1162718549 22 Left 1162718540 19:12648341-12648363 CCGTTCTCCATTAGTGGCTCCGA 0: 1
1: 0
2: 3
3: 7
4: 63
Right 1162718549 19:12648386-12648408 AGCAGCCTTCGGTGCACCTGGGG 0: 1
1: 0
2: 2
3: 9
4: 139
1162718534_1162718549 30 Left 1162718534 19:12648333-12648355 CCCCCGACCCGTTCTCCATTAGT 0: 1
1: 0
2: 0
3: 3
4: 62
Right 1162718549 19:12648386-12648408 AGCAGCCTTCGGTGCACCTGGGG 0: 1
1: 0
2: 2
3: 9
4: 139
1162718542_1162718549 3 Left 1162718542 19:12648360-12648382 CCGATACTCCGCGTCCATCGTCC 0: 1
1: 0
2: 0
3: 1
4: 32
Right 1162718549 19:12648386-12648408 AGCAGCCTTCGGTGCACCTGGGG 0: 1
1: 0
2: 2
3: 9
4: 139
1162718538_1162718549 27 Left 1162718538 19:12648336-12648358 CCGACCCGTTCTCCATTAGTGGC 0: 1
1: 0
2: 0
3: 4
4: 67
Right 1162718549 19:12648386-12648408 AGCAGCCTTCGGTGCACCTGGGG 0: 1
1: 0
2: 2
3: 9
4: 139
1162718535_1162718549 29 Left 1162718535 19:12648334-12648356 CCCCGACCCGTTCTCCATTAGTG 0: 1
1: 0
2: 0
3: 1
4: 38
Right 1162718549 19:12648386-12648408 AGCAGCCTTCGGTGCACCTGGGG 0: 1
1: 0
2: 2
3: 9
4: 139
1162718541_1162718549 15 Left 1162718541 19:12648348-12648370 CCATTAGTGGCTCCGATACTCCG 0: 1
1: 0
2: 0
3: 0
4: 13
Right 1162718549 19:12648386-12648408 AGCAGCCTTCGGTGCACCTGGGG 0: 1
1: 0
2: 2
3: 9
4: 139
1162718536_1162718549 28 Left 1162718536 19:12648335-12648357 CCCGACCCGTTCTCCATTAGTGG 0: 1
1: 0
2: 0
3: 4
4: 51
Right 1162718549 19:12648386-12648408 AGCAGCCTTCGGTGCACCTGGGG 0: 1
1: 0
2: 2
3: 9
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162718549 Original CRISPR AGCAGCCTTCGGTGCACCTG GGG Exonic
900474068 1:2868164-2868186 AGCAGCCATAGGTGGCCCTGGGG - Intergenic
903706961 1:25292984-25293006 AGCAGCATTCAGCCCACCTGGGG - Intronic
903720277 1:25400363-25400385 AGCAGCATTCAGCCCACCTGGGG + Intronic
903807736 1:26017492-26017514 AGCCTCCTTCATTGCACCTGAGG + Intergenic
905819529 1:40979231-40979253 AGCCGCCTTCGGGGCAGGTGTGG + Intergenic
905902140 1:41588697-41588719 GGCAGCCAACGGTGCTCCTGTGG - Intronic
907545147 1:55253290-55253312 AGCAGCCTTTGTTGCCCCAGCGG - Intergenic
909480234 1:76122519-76122541 AGGAGTCTTCGGTTCACCTTGGG - Intronic
910088172 1:83429158-83429180 GGCAGCCTTCTGTGACCCTGAGG + Intergenic
910798805 1:91124643-91124665 AGCAGGCTTCAGTGCCCCGGAGG - Intergenic
913318723 1:117574256-117574278 ATCAGCCTTCGGGGCCCCTGTGG + Intergenic
913464930 1:119130931-119130953 AGCAGCTTATGCTGCACCTGTGG + Intronic
915524800 1:156468964-156468986 ACCAGCCTTTAGTTCACCTGGGG - Exonic
916056017 1:161069425-161069447 AGCAGTTTCCGGTGCTCCTGGGG - Intronic
917838419 1:178958767-178958789 AGCTGCCTCCGGGGCTCCTGTGG - Intergenic
919152153 1:193714937-193714959 AGGATCCTTCAGTGCACCAGGGG + Intergenic
923833234 1:237580883-237580905 AGCAGGCTTCGTTTCTCCTGAGG - Intronic
924658749 1:245997047-245997069 AGCAGACTGCGAGGCACCTGCGG - Intronic
1062937831 10:1401181-1401203 AGGAGCCTCCGGAGCAGCTGAGG + Intronic
1064327338 10:14363689-14363711 AGCAGCCTTGGGTGCCACTGTGG - Intronic
1067145195 10:43689276-43689298 AGCAGCCGTGGGTCCCCCTGAGG + Intergenic
1067492249 10:46720929-46720951 AGCAGCCATGGGTGAACCAGTGG - Intergenic
1067602413 10:47619455-47619477 AGCAGCCATGGGTGAACCAGTGG + Intergenic
1071203936 10:83252718-83252740 AGCAGCCTGAGTTGCACCTGGGG + Intergenic
1071653767 10:87424867-87424889 AGCAGCCATGGGTGAACCAGTGG + Intergenic
1073586300 10:104713325-104713347 AGCAGCCTCCTGTAAACCTGAGG + Intronic
1075724486 10:124604475-124604497 AGCAGCCTTCAGAGAAGCTGCGG + Intronic
1076482431 10:130793271-130793293 AGCTCCCATGGGTGCACCTGAGG + Intergenic
1077076080 11:702863-702885 AGCAGCCCTCCAGGCACCTGTGG + Intronic
1077502557 11:2916011-2916033 AGCAGCCTGAGGGGCACCTCCGG + Intronic
1077591026 11:3491185-3491207 AGGAGCTTTGGGTGCACATGGGG - Intergenic
1083783638 11:64931553-64931575 AGCAGCCCCCGGATCACCTGTGG - Exonic
1083904026 11:65658586-65658608 ATCACCCTTCGGCCCACCTGAGG + Intronic
1084246741 11:67862936-67862958 AGGAGCTTTGGGTGCACATGGGG - Intergenic
1084825937 11:71731556-71731578 AGGAGCTTTTGGTGCACATGGGG + Intergenic
1095358255 12:41303729-41303751 ACCAGCCTTTGGTGGACATGTGG - Intronic
1095923307 12:47553017-47553039 ACCAGCCTTCGGTACACAGGAGG + Intergenic
1097612071 12:61835903-61835925 AGCAGCCTTCAGTTCAGCAGGGG + Intronic
1103696625 12:122820930-122820952 AGCACCCTTGGGTGCCCCTGAGG + Intronic
1113043098 13:106125523-106125545 AGCAGCCCTGTGGGCACCTGGGG - Intergenic
1118883845 14:69850510-69850532 AGCAGCCTCCGCGCCACCTGCGG - Intergenic
1119530515 14:75357077-75357099 AGAATCCTTCAGGGCACCTGGGG + Intergenic
1122100646 14:99406931-99406953 AGGAGGCTTAGGTGCACCTGTGG - Intronic
1127329357 15:57923564-57923586 AGCAGCATTCTGTCCAGCTGGGG - Intergenic
1129673020 15:77617453-77617475 TGCAGCCTCCAGTGCCCCTGGGG + Intronic
1129910376 15:79221505-79221527 AGCTGCATTGAGTGCACCTGTGG + Intergenic
1132323230 15:100942823-100942845 AGCAGCCTTGGGTCCTCATGAGG + Intronic
1133298858 16:4769392-4769414 AGCAGCCTAGGGTTAACCTGGGG + Intergenic
1136272594 16:29157546-29157568 CGCAGCCTGTGGTGCACCTTCGG + Intergenic
1141391783 16:83670863-83670885 GGCAGCCCTCCATGCACCTGTGG - Exonic
1141891320 16:86928606-86928628 AGTGGCCTCCGGAGCACCTGCGG - Intergenic
1142076149 16:88119360-88119382 CGCAGCCTGTGGTGCACGTGCGG + Intergenic
1142628667 17:1209008-1209030 AGGAGCCTTCAGTGTAACTGTGG - Intronic
1146944882 17:36866814-36866836 AGCAGCCCTGGGGGGACCTGGGG + Intergenic
1152610176 17:81311517-81311539 AGCAGCCTGGGGTGGGCCTGGGG + Exonic
1152878292 17:82800874-82800896 TGCAGCCATCGAGGCACCTGAGG - Exonic
1153525625 18:5992240-5992262 AACAGGCTTCTGTCCACCTGAGG - Intronic
1158613779 18:58967548-58967570 TGCACCCTTCCGTGCACCTGTGG + Intronic
1159137281 18:64351314-64351336 AGCTTCCTTAAGTGCACCTGAGG - Intergenic
1159998986 18:74997997-74998019 TGCAGCCTTTGCAGCACCTGCGG + Intronic
1160013790 18:75125761-75125783 AGCAGCATTCTGTGCAGGTGGGG - Intergenic
1160534321 18:79584169-79584191 AGGAGCCACCGGTGCACCCGGGG - Intergenic
1161883220 19:6972326-6972348 AGCAGCCCTCCGTGGACCAGCGG + Intergenic
1162035114 19:7934355-7934377 AGAGGCCTTCTGTGCTCCTGTGG + Intronic
1162718549 19:12648386-12648408 AGCAGCCTTCGGTGCACCTGGGG + Exonic
1163264259 19:16208856-16208878 GGCAGCCTCTGGTTCACCTGGGG - Intronic
1165883917 19:39063544-39063566 CGGAGCCTTCGGTGAAACTGCGG + Intergenic
1167713680 19:51127198-51127220 AGCTGCCTTGGGTGCACCTGAGG + Exonic
929994435 2:46816591-46816613 AGCAGCACGAGGTGCACCTGAGG - Intergenic
937288185 2:120766194-120766216 CGCAGCCTTCGGTCCAGCTGTGG + Intronic
941693353 2:168525111-168525133 AGCAGCCCACACTGCACCTGTGG - Intronic
942067548 2:172285728-172285750 AGCAGCCTTTTGTGCCCCTGTGG - Intergenic
945314014 2:208350925-208350947 AGCTGCCTTCTATGCAACTGAGG + Exonic
946609326 2:221440923-221440945 AGCAGCATTGGCTTCACCTGTGG + Intronic
1173347336 20:42213102-42213124 AGCAGCATCCGCTTCACCTGGGG + Intronic
1173394236 20:42663260-42663282 AGAAGACTTTGCTGCACCTGTGG + Intronic
1174105605 20:48160482-48160504 GGCAGCCTTGGGTGCACCCTTGG - Intergenic
1175117181 20:56690898-56690920 AGCTGTCTGTGGTGCACCTGGGG + Intergenic
1175979320 20:62729145-62729167 AGCAGACTTGGGTGGATCTGTGG - Intronic
1176376603 21:6089795-6089817 AGCAGCAGTCACTGCACCTGTGG + Intergenic
1179119175 21:38527292-38527314 AGCAGCCTCAGCTGCAGCTGGGG + Intronic
1179746872 21:43448449-43448471 AGCAGCAGTCACTGCACCTGTGG - Intergenic
1180900597 22:19369232-19369254 AGCAGCCCTGGGTGAAACTGTGG - Intronic
1181920062 22:26313527-26313549 AGCTGCCTACCTTGCACCTGAGG - Intronic
1182094811 22:27618934-27618956 CGCAGCCTTCGGTGGGGCTGAGG - Intergenic
1184252403 22:43268190-43268212 AGCAGGCTTCTGTGAGCCTGAGG + Intronic
1184349396 22:43933802-43933824 ACCAACCTTTGGTGCTCCTGGGG + Intronic
1184594276 22:45504385-45504407 AGGAGCCTTCGCAGCCCCTGGGG + Intronic
1185066839 22:48636702-48636724 AGCAGCCCTGGGGGCTCCTGGGG - Intronic
1185088987 22:48755511-48755533 AGCAGCCTTCCCTGCACCCTGGG + Intronic
949728873 3:7083945-7083967 AGCATCCTTCAGTGTAGCTGGGG + Intronic
950162208 3:10768933-10768955 AGCTGACTTCGGTGAACCAGCGG - Intergenic
951912209 3:27762940-27762962 ATCAGCTTTGGGTGCTCCTGTGG - Intergenic
956746362 3:72314136-72314158 GGCAGCCTTCTGTGTACATGAGG - Intergenic
957729237 3:84111027-84111049 AGCAGCCTTTTGTGCCCCAGAGG + Intergenic
961055748 3:123787482-123787504 AGCAGTGTTTGGTGCCCCTGAGG - Intronic
961894861 3:130158670-130158692 AGGAGCTTTGGGTGCACATGGGG - Intergenic
962281016 3:134051934-134051956 AGCAGCCGTAGCTACACCTGAGG - Intronic
966509581 3:180747057-180747079 AGCAGCCTTCACTGGACCTATGG + Intronic
966834544 3:184038854-184038876 AGCAGCACTCGGTGGAGCTGTGG + Exonic
968894562 4:3391508-3391530 AGAAGCCCTTGGTGCCCCTGCGG + Intronic
969747911 4:9088425-9088447 AGGAGCTTTGGGTGCACATGGGG + Intergenic
974625930 4:64429142-64429164 AGCAGCCTGAGATGTACCTGGGG - Intergenic
980775459 4:137430905-137430927 GGCAGCCTGTGCTGCACCTGGGG - Intergenic
981938032 4:150255044-150255066 GGCGGCCTTCAGGGCACCTGGGG - Intronic
985475273 5:75361-75383 TGCAGACTCCAGTGCACCTGAGG - Intergenic
985542887 5:494996-495018 AGCAGCCAGCGGGGCACGTGTGG + Intronic
985874207 5:2583161-2583183 AGCAGCCATGGGAGCCCCTGAGG - Intergenic
986431554 5:7685879-7685901 AGCAGCCATTGGGCCACCTGTGG - Intronic
991293998 5:65061823-65061845 AGCAGCCTTCTGAGTAGCTGGGG + Intergenic
997165864 5:131659803-131659825 AGCAGCATACGGTGCTCCTTGGG + Intronic
997246582 5:132355179-132355201 AGCAGCCTGAGCTGTACCTGAGG - Intergenic
999296220 5:150461196-150461218 AGCAGGACTCGGTGCCCCTGGGG + Intergenic
1002056356 5:176599847-176599869 AGCAGCCTTGGGTGCAGGCGTGG - Exonic
1003641577 6:7879676-7879698 AGGAGCCCACGGTGCTCCTGCGG - Intronic
1006340664 6:33444751-33444773 AGAAGCCTTCCGTCCATCTGGGG + Intronic
1007323845 6:41045494-41045516 TACAGCCTTGGCTGCACCTGAGG - Intronic
1007547295 6:42704237-42704259 AACAGCCTTCAGTGGAGCTGTGG - Intronic
1008521252 6:52363232-52363254 AGCAGCTTCCTGTGCAGCTGTGG + Intronic
1017685668 6:156911784-156911806 AGCAGCCTCGTTTGCACCTGTGG - Intronic
1018497548 6:164365555-164365577 AGCAGAATTCAGTGCACCTGTGG + Intergenic
1020325091 7:6968209-6968231 AGGAGCTTTGGGTGCACATGGGG - Intergenic
1020400721 7:7774103-7774125 AGAAGATTTTGGTGCACCTGAGG - Intronic
1021519666 7:21526746-21526768 AGCGGCCTGAGGTGTACCTGGGG - Intergenic
1026561920 7:71457514-71457536 AGCAGCCTTCGGGGCTGCTCTGG - Intronic
1027305042 7:76885595-76885617 GGCAGCCTTCTGTGACCCTGAGG + Intergenic
1029507331 7:100970155-100970177 AGTAGCCTCAGGTGCACCCGGGG + Intronic
1030274445 7:107705043-107705065 AGCAGCCTTCGGTGGCTCAGGGG - Intronic
1030676943 7:112394160-112394182 AGCAGCCTTGGATGGAGCTGGGG - Intergenic
1034394069 7:150806910-150806932 ACCAGCCTTCCTTGCAACTGAGG + Intergenic
1034978399 7:155460908-155460930 AGCTGCCCTTGGTGCTCCTGAGG + Intronic
1035925326 8:3721932-3721954 GACGGCCTTGGGTGCACCTGTGG - Intronic
1039956086 8:42208076-42208098 ACCAGCCTTGGGCTCACCTGCGG + Intergenic
1045064244 8:98431501-98431523 ACCTGCCTTCAGTGCAGCTGGGG - Exonic
1048420191 8:134270532-134270554 AGCAGCCCTGGCAGCACCTGGGG + Intergenic
1049605672 8:143528157-143528179 ACCACCCTGCGGTGCACCTCGGG + Intronic
1049619720 8:143592571-143592593 CCCAGCCCTCGCTGCACCTGAGG - Intronic
1052193406 9:25683778-25683800 GGCAGCCTGAGCTGCACCTGGGG - Intergenic
1052530833 9:29682302-29682324 GGCAGCCTGAGCTGCACCTGGGG - Intergenic
1058332816 9:103785380-103785402 TGCAGCCTTGGGAGCATCTGTGG - Intergenic
1058911663 9:109525431-109525453 CTCAGCCTTGGGTGCACATGAGG + Intergenic
1060482400 9:124024379-124024401 ATCAGCATTCAGGGCACCTGGGG - Intronic
1061478522 9:130884858-130884880 AGCAGGCTCAGGTGCACCAGGGG + Exonic
1062461562 9:136664588-136664610 ACCAGCTTTCGGTGCTGCTGTGG - Intronic
1062475080 9:136722712-136722734 GGCAGCCTTGGGTGCACCTGGGG - Intronic
1187095053 X:16139369-16139391 CGCAGCCTGCGGACCACCTGCGG + Intronic
1187375586 X:18750110-18750132 AGGAGCTTGCTGTGCACCTGAGG - Intronic
1187649994 X:21391481-21391503 AGCAGCCTAAGGTGTATCTGGGG + Intronic
1194922267 X:99780684-99780706 AGCAGCCTGAGCTGCATCTGAGG + Intergenic
1194971276 X:100347031-100347053 AGCCTCCTTGGGTACACCTGCGG + Intronic
1199560959 X:149161863-149161885 AGCAGCCTCCGGTGCCCAGGGGG + Intergenic