ID: 1162718550

View in Genome Browser
Species Human (GRCh38)
Location 19:12648387-12648409
Sequence GCAGCCTTCGGTGCACCTGG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 139}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162718535_1162718550 30 Left 1162718535 19:12648334-12648356 CCCCGACCCGTTCTCCATTAGTG 0: 1
1: 0
2: 0
3: 1
4: 38
Right 1162718550 19:12648387-12648409 GCAGCCTTCGGTGCACCTGGGGG 0: 1
1: 0
2: 1
3: 11
4: 139
1162718539_1162718550 24 Left 1162718539 19:12648340-12648362 CCCGTTCTCCATTAGTGGCTCCG 0: 1
1: 0
2: 0
3: 8
4: 55
Right 1162718550 19:12648387-12648409 GCAGCCTTCGGTGCACCTGGGGG 0: 1
1: 0
2: 1
3: 11
4: 139
1162718542_1162718550 4 Left 1162718542 19:12648360-12648382 CCGATACTCCGCGTCCATCGTCC 0: 1
1: 0
2: 0
3: 1
4: 32
Right 1162718550 19:12648387-12648409 GCAGCCTTCGGTGCACCTGGGGG 0: 1
1: 0
2: 1
3: 11
4: 139
1162718541_1162718550 16 Left 1162718541 19:12648348-12648370 CCATTAGTGGCTCCGATACTCCG 0: 1
1: 0
2: 0
3: 0
4: 13
Right 1162718550 19:12648387-12648409 GCAGCCTTCGGTGCACCTGGGGG 0: 1
1: 0
2: 1
3: 11
4: 139
1162718540_1162718550 23 Left 1162718540 19:12648341-12648363 CCGTTCTCCATTAGTGGCTCCGA 0: 1
1: 0
2: 3
3: 7
4: 63
Right 1162718550 19:12648387-12648409 GCAGCCTTCGGTGCACCTGGGGG 0: 1
1: 0
2: 1
3: 11
4: 139
1162718543_1162718550 -4 Left 1162718543 19:12648368-12648390 CCGCGTCCATCGTCCTTCAGCAG 0: 1
1: 0
2: 1
3: 6
4: 77
Right 1162718550 19:12648387-12648409 GCAGCCTTCGGTGCACCTGGGGG 0: 1
1: 0
2: 1
3: 11
4: 139
1162718536_1162718550 29 Left 1162718536 19:12648335-12648357 CCCGACCCGTTCTCCATTAGTGG 0: 1
1: 0
2: 0
3: 4
4: 51
Right 1162718550 19:12648387-12648409 GCAGCCTTCGGTGCACCTGGGGG 0: 1
1: 0
2: 1
3: 11
4: 139
1162718538_1162718550 28 Left 1162718538 19:12648336-12648358 CCGACCCGTTCTCCATTAGTGGC 0: 1
1: 0
2: 0
3: 4
4: 67
Right 1162718550 19:12648387-12648409 GCAGCCTTCGGTGCACCTGGGGG 0: 1
1: 0
2: 1
3: 11
4: 139
1162718544_1162718550 -10 Left 1162718544 19:12648374-12648396 CCATCGTCCTTCAGCAGCCTTCG 0: 1
1: 0
2: 0
3: 6
4: 113
Right 1162718550 19:12648387-12648409 GCAGCCTTCGGTGCACCTGGGGG 0: 1
1: 0
2: 1
3: 11
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162718550 Original CRISPR GCAGCCTTCGGTGCACCTGG GGG Exonic
904663202 1:32100435-32100457 GCATTCTTCAGTCCACCTGGGGG - Exonic
907749245 1:57246416-57246438 GTTGCCTTCTGTGCACCTGCAGG - Intronic
908808144 1:67951923-67951945 CCAGCCTTCTGAGGACCTGGTGG + Intergenic
915515058 1:156407907-156407929 GCACCGTTCTGTACACCTGGTGG + Exonic
915524798 1:156468963-156468985 CCAGCCTTTAGTTCACCTGGGGG - Exonic
918166040 1:181948737-181948759 GTTGACTTCTGTGCACCTGGAGG - Intergenic
923427468 1:233885692-233885714 GCAGTCTTCGGAGGTCCTGGAGG + Intergenic
923540489 1:234885004-234885026 GCAGGCATGGGTGCCCCTGGGGG - Intergenic
1062939599 10:1411318-1411340 GGAGCCTCCGGTGCACTTGAAGG - Intronic
1063135236 10:3210446-3210468 CCAGCCTGTGGTGCACCTGGTGG - Intergenic
1063868421 10:10392041-10392063 GTAGCCTTCAATGCAGCTGGAGG + Intergenic
1064327337 10:14363688-14363710 GCAGCCTTGGGTGCCACTGTGGG - Intronic
1066134078 10:32425818-32425840 TCAGCCTTCTGTGTAGCTGGGGG + Intergenic
1070806681 10:79274934-79274956 GCAGCCCTCGCTCCTCCTGGGGG - Intronic
1073137361 10:101227382-101227404 GGGGCCTTCGGGGCGCCTGGGGG + Exonic
1076035720 10:127196868-127196890 GCCGCCTCCGGAGCAGCTGGCGG + Intronic
1076921163 10:133455495-133455517 GCAGCCTCCAGGGCCCCTGGAGG - Intergenic
1077103131 11:830886-830908 CCAGGCTGCGGAGCACCTGGAGG + Exonic
1077591025 11:3491184-3491206 GGAGCTTTGGGTGCACATGGGGG - Intergenic
1080409472 11:32010059-32010081 TGAGCCTTCAGTGTACCTGGAGG + Intronic
1082871405 11:57946239-57946261 GCAGCCTGGGGTGCACATGGAGG + Intergenic
1084246740 11:67862935-67862957 GGAGCTTTGGGTGCACATGGGGG - Intergenic
1084315649 11:68343836-68343858 TCATCCTTTGGTGCACCTGTTGG + Intronic
1084825938 11:71731557-71731579 GGAGCTTTTGGTGCACATGGGGG + Intergenic
1084910155 11:72381698-72381720 GGAGCCTGGGGTGGACCTGGAGG - Intronic
1085303535 11:75472550-75472572 GCTGCCTCCTGTGCTCCTGGTGG - Intronic
1088522309 11:110712572-110712594 CCAGCCTGCGGCGCGCCTGGCGG + Intronic
1090496910 11:127222169-127222191 GCAGCCCTCGCTCCACTTGGTGG - Intergenic
1095310462 12:40692320-40692342 GCAGCCTGCGCTGGTCCTGGGGG + Intergenic
1096478625 12:51923664-51923686 GCAGCCTTCCCCGCACCCGGGGG + Intergenic
1097334937 12:58371621-58371643 CCAGCCTTCCCTGCACCTTGGGG - Intergenic
1101434020 12:104649913-104649935 GCATCCCTCAGTGCCCCTGGTGG + Intronic
1102877525 12:116459379-116459401 GCTGCCTTTGCTGCAGCTGGAGG - Intergenic
1103621727 12:122191073-122191095 GAAGCCTCCGGTGCACCTTGCGG - Intronic
1107682457 13:42865937-42865959 GAAGCCCTCGCTGCAGCTGGTGG - Intergenic
1113043097 13:106125522-106125544 GCAGCCCTGTGGGCACCTGGGGG - Intergenic
1114363650 14:22003620-22003642 GAAGCCCTCGGTGCAGCTGTCGG + Intergenic
1119530516 14:75357078-75357100 GAATCCTTCAGGGCACCTGGGGG + Intergenic
1121104572 14:91272011-91272033 GCAGCCTGCAGGGCAGCTGGCGG - Exonic
1121729665 14:96177634-96177656 GGAGCCCTCGGAGCACCTGCTGG + Intergenic
1122100645 14:99406930-99406952 GGAGGCTTAGGTGCACCTGTGGG - Intronic
1122127778 14:99588371-99588393 GCAGGCTTAGGAGCACCCGGCGG - Intronic
1122648340 14:103209863-103209885 GCAGCCTTCCTTGCCTCTGGAGG - Intergenic
1122895696 14:104755734-104755756 GCAGCCCTCGGGGCCCCTGTAGG - Exonic
1122933483 14:104945352-104945374 GCTCCCTTCTGTGGACCTGGAGG - Exonic
1122971020 14:105152276-105152298 CCAGCCGTAGCTGCACCTGGGGG + Exonic
1124139128 15:27062059-27062081 GCTGCCTTCCGGGCAACTGGCGG + Intronic
1125890962 15:43266953-43266975 CCCGCCTTCGGTTCTCCTGGAGG - Intergenic
1129273644 15:74432372-74432394 CCAGCCTGAGGTGCTCCTGGAGG - Intronic
1129931124 15:79412015-79412037 GCAGCCTTGGGTAGCCCTGGGGG + Intronic
1130789288 15:87134767-87134789 GAAGTCTTCAGGGCACCTGGGGG + Intergenic
1133886162 16:9829728-9829750 GCAACCTTCGGTGCTGCTGGTGG - Intronic
1136251965 16:29011354-29011376 GCATCCTTCAGAGCTCCTGGTGG + Intergenic
1136272595 16:29157547-29157569 GCAGCCTGTGGTGCACCTTCGGG + Intergenic
1140096869 16:71883581-71883603 ACAGCCTTGGGTGGAGCTGGGGG - Intronic
1141744754 16:85918474-85918496 GCAGCCCTCGGGGCAGGTGGTGG - Exonic
1142076150 16:88119361-88119383 GCAGCCTGTGGTGCACGTGCGGG + Intergenic
1142112808 16:88341240-88341262 CCAGCATTCAGTGCACCAGGCGG - Intergenic
1142957071 17:3529541-3529563 GGAGAGTTCGGTGCAACTGGAGG - Intronic
1144778340 17:17795948-17795970 GCAGCCCCCGGTGCACCCGACGG - Exonic
1144795553 17:17888950-17888972 GAAGTCTTTGGTGCCCCTGGGGG + Intronic
1147998764 17:44375701-44375723 GCAGCCCCCAGTCCACCTGGGGG + Exonic
1150508573 17:65724877-65724899 GCAGCCTTGGGGGCAGCAGGAGG - Intronic
1151804647 17:76397870-76397892 GCAGCCATCGGTGGGCCAGGTGG - Exonic
1152013830 17:77736541-77736563 GCAGCCTGCTGGGCCCCTGGTGG - Intergenic
1152332896 17:79683868-79683890 GCAGCCCTCGGTTCTCCAGGTGG - Intergenic
1152639285 17:81442952-81442974 GCCACCTTCTGTGCCCCTGGGGG - Exonic
1155446284 18:25916109-25916131 GCTACCTTCGGGGCACCTAGTGG + Intergenic
1158464840 18:57680869-57680891 GAAGCCTTCACTTCACCTGGAGG - Intronic
1160559661 18:79748344-79748366 GCAGCATTCGCAGCACCAGGAGG + Intronic
1160734826 19:657753-657775 CCGGCCTTCGGTGGCCCTGGAGG - Intronic
1160874156 19:1289601-1289623 GCAGCCTTGGGGGCACTGGGTGG + Intronic
1162718550 19:12648387-12648409 GCAGCCTTCGGTGCACCTGGGGG + Exonic
1164608106 19:29614263-29614285 GCAGCCTTTGGGGCAGGTGGAGG - Intronic
1166456003 19:42939807-42939829 GGAGCACTCGGCGCACCTGGAGG - Intronic
1167336694 19:48890753-48890775 GTAGACTTCCGTGCACCTGGAGG - Intronic
1167713681 19:51127199-51127221 GCTGCCTTGGGTGCACCTGAGGG + Exonic
1168325552 19:55536918-55536940 GGAGCCTGGGCTGCACCTGGAGG - Intronic
925921084 2:8638376-8638398 GCAGCCTTTGGAGCTCCTTGAGG - Intergenic
926381664 2:12296540-12296562 GCAGCCTTCGGAGCTCCATGTGG - Intergenic
926848832 2:17172427-17172449 GCAGCCTTCAGTGCTGGTGGTGG + Intergenic
928094187 2:28393829-28393851 GCGGGCCCCGGTGCACCTGGCGG + Intronic
929561843 2:42961071-42961093 GCAGCCTTCAGCTCCCCTGGGGG - Intergenic
931670363 2:64641861-64641883 CAAGCCTTAGGTTCACCTGGAGG + Intronic
934845510 2:97659462-97659484 GCAGCCCCCGGTGCTCCTGGTGG + Exonic
935199253 2:100842116-100842138 GCAGTCTTCCTGGCACCTGGGGG - Intronic
935640504 2:105285540-105285562 GCTGCCTGCTGTGTACCTGGAGG - Intronic
937314819 2:120925052-120925074 CCAGCCTCCGGAGCACCTGGTGG + Intronic
946397817 2:219452011-219452033 CCAGCCTTCTGTGCGCCTTGGGG - Intronic
948466251 2:238153145-238153167 GCAGCCTTCAGGGCACCAGGAGG + Intergenic
1169552851 20:6718885-6718907 GCAGCCTTCCGTGAACGTGCAGG + Intergenic
1170130280 20:13011582-13011604 GCAGCCTACGCTGGACCAGGGGG - Intronic
1172146748 20:32762731-32762753 GCAGCCCTCGAAGCAGCTGGCGG - Intronic
1174910332 20:54601117-54601139 GCAGTCTTAGCTGCTCCTGGAGG - Intronic
1176213147 20:63935338-63935360 GCTTCCTTCTGTGCACCTGCTGG - Exonic
1178927338 21:36786978-36787000 GCATCTTTCAGTGCACTTGGGGG - Intronic
1179119176 21:38527293-38527315 GCAGCCTCAGCTGCAGCTGGGGG + Intronic
1179822687 21:43945899-43945921 GCAGCCCTGTGGGCACCTGGTGG + Intronic
1180160471 21:45996864-45996886 GCAGCCTCAGGTGCAGGTGGGGG + Intronic
1182309934 22:29397400-29397422 TCAGCCTTGGGTCCTCCTGGTGG + Intronic
1182771983 22:32802533-32802555 GCAACTTTCCGTGCACATGGCGG - Intronic
1183200104 22:36380120-36380142 GCAGCCTCCGGGCCTCCTGGGGG - Intronic
1183847380 22:40553552-40553574 CCAGACTTCTGTGCACCTGCAGG - Intronic
1184188998 22:42882469-42882491 GGAGCCATCTGTGCACGTGGCGG - Intronic
1184594277 22:45504386-45504408 GGAGCCTTCGCAGCCCCTGGGGG + Intronic
949891658 3:8737823-8737845 GCAACCTTGGGTGTACCTGCTGG - Intronic
950522347 3:13504766-13504788 GCAGCCTTCAGTGAGCATGGAGG + Exonic
951636465 3:24783948-24783970 GCAGCCTTCAGTAAACCTGCTGG - Intergenic
953283419 3:41580765-41580787 GCATCCTTGTGTGCATCTGGAGG - Intronic
955247712 3:57243536-57243558 GCAGCCTTGGCTGCAGCTGCTGG + Intronic
961894860 3:130158669-130158691 GGAGCTTTGGGTGCACATGGGGG - Intergenic
966762196 3:183428373-183428395 GCCGCCTCCCCTGCACCTGGCGG - Intronic
969747912 4:9088426-9088448 GGAGCTTTGGGTGCACATGGGGG + Intergenic
974077972 4:57184915-57184937 GCTTCCTTGTGTGCACCTGGAGG - Intergenic
974707467 4:65539567-65539589 GCAGATTTTGGTGCAGCTGGTGG - Intronic
974973331 4:68858664-68858686 TCAGCGTTCTGTGAACCTGGAGG - Intergenic
985484055 5:139161-139183 TCATCCTTCGGAGCGCCTGGTGG + Intergenic
985865341 5:2509842-2509864 GGAGCCTTCCCTGCACCTGCTGG + Intergenic
1000243030 5:159426334-159426356 GCAGCCTCAGGTGCTCCTGCTGG - Intergenic
1002185359 5:177452183-177452205 GCAGACTTCGGTCCATCTGCAGG + Intronic
1002292092 5:178206914-178206936 GCAGCCTTAGGGGCAGCTGATGG - Intronic
1006347966 6:33498298-33498320 GCAGCCATGGGTGGTCCTGGAGG - Intergenic
1006400109 6:33812829-33812851 CCAGCCTGCAGGGCACCTGGTGG + Intergenic
1007955656 6:45915591-45915613 ACAGCTTTCTGTGCAGCTGGGGG - Intronic
1012531688 6:100245407-100245429 GGAGCCTTGAGTGGACCTGGTGG - Intergenic
1013951655 6:115789957-115789979 ACAGCCTTGGGTGCCACTGGTGG - Intergenic
1015569194 6:134604373-134604395 GCACCCATGGGTGCTCCTGGAGG - Intergenic
1020325090 7:6968208-6968230 GGAGCTTTGGGTGCACATGGGGG - Intergenic
1021519665 7:21526745-21526767 GCGGCCTGAGGTGTACCTGGGGG - Intergenic
1024230299 7:47358640-47358662 GCAGCCTTGGGTGCACAGAGAGG + Intronic
1024934344 7:54697956-54697978 GCCTCCTTCGGTGCAGCTGCAGG - Intergenic
1029307301 7:99629720-99629742 GCGTCCTCCGGTGCACCTGCAGG - Exonic
1036482188 8:9149555-9149577 GCAGCTTTCAGTGTTCCTGGTGG - Intronic
1037542056 8:19881476-19881498 GCTGCTTTCCGTGCACCTGCCGG + Intergenic
1037714570 8:21386241-21386263 GCAGGGTTCGTTGCACCTGGAGG - Intergenic
1038485902 8:27935110-27935132 GCAGCCTTGGTTGCTTCTGGAGG - Intronic
1039074847 8:33680763-33680785 TTAGCCTTCTGTGCACCTGTTGG - Intergenic
1042480226 8:69294593-69294615 GCAGACTTCGGTGCAGCAGGAGG + Intergenic
1045510764 8:102810609-102810631 CCGGGCTTCGGGGCACCTGGCGG - Intergenic
1049391833 8:142375572-142375594 GCAGCCTTCGGTGCACCTCCCGG + Intronic
1049619718 8:143592570-143592592 CCAGCCCTCGCTGCACCTGAGGG - Intronic
1053302123 9:36959767-36959789 GCAGCCTGTGCTGCAACTGGGGG + Intronic
1056896744 9:90558619-90558641 GCAGCATTCAGTGCATCCGGAGG - Intergenic
1059438352 9:114289418-114289440 GCAGCCTGCCGGGCTCCTGGTGG - Intronic
1060482399 9:124024378-124024400 TCAGCATTCAGGGCACCTGGGGG - Intronic
1060794860 9:126506705-126506727 GCAGCCTGCCTTGCCCCTGGAGG + Exonic
1061478523 9:130884859-130884881 GCAGGCTCAGGTGCACCAGGGGG + Exonic
1062071940 9:134560435-134560457 CCAAGCTTGGGTGCACCTGGAGG + Intergenic
1062122085 9:134839252-134839274 GCAGCTTTCGGCGCCTCTGGGGG + Intronic
1062226734 9:135456525-135456547 GCAGGCTTCAGTGCCCCTGTTGG - Intergenic
1062591399 9:137276381-137276403 CCAGCCCTGGGTGCACTTGGAGG + Intergenic
1189470867 X:41313046-41313068 GCAGCCTTGGTGGAACCTGGAGG + Intergenic