ID: 1162718551

View in Genome Browser
Species Human (GRCh38)
Location 19:12648388-12648410
Sequence CAGCCTTCGGTGCACCTGGG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 139}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162718541_1162718551 17 Left 1162718541 19:12648348-12648370 CCATTAGTGGCTCCGATACTCCG 0: 1
1: 0
2: 0
3: 0
4: 13
Right 1162718551 19:12648388-12648410 CAGCCTTCGGTGCACCTGGGGGG 0: 1
1: 0
2: 0
3: 12
4: 139
1162718544_1162718551 -9 Left 1162718544 19:12648374-12648396 CCATCGTCCTTCAGCAGCCTTCG 0: 1
1: 0
2: 0
3: 6
4: 113
Right 1162718551 19:12648388-12648410 CAGCCTTCGGTGCACCTGGGGGG 0: 1
1: 0
2: 0
3: 12
4: 139
1162718543_1162718551 -3 Left 1162718543 19:12648368-12648390 CCGCGTCCATCGTCCTTCAGCAG 0: 1
1: 0
2: 1
3: 6
4: 77
Right 1162718551 19:12648388-12648410 CAGCCTTCGGTGCACCTGGGGGG 0: 1
1: 0
2: 0
3: 12
4: 139
1162718542_1162718551 5 Left 1162718542 19:12648360-12648382 CCGATACTCCGCGTCCATCGTCC 0: 1
1: 0
2: 0
3: 1
4: 32
Right 1162718551 19:12648388-12648410 CAGCCTTCGGTGCACCTGGGGGG 0: 1
1: 0
2: 0
3: 12
4: 139
1162718539_1162718551 25 Left 1162718539 19:12648340-12648362 CCCGTTCTCCATTAGTGGCTCCG 0: 1
1: 0
2: 0
3: 8
4: 55
Right 1162718551 19:12648388-12648410 CAGCCTTCGGTGCACCTGGGGGG 0: 1
1: 0
2: 0
3: 12
4: 139
1162718538_1162718551 29 Left 1162718538 19:12648336-12648358 CCGACCCGTTCTCCATTAGTGGC 0: 1
1: 0
2: 0
3: 4
4: 67
Right 1162718551 19:12648388-12648410 CAGCCTTCGGTGCACCTGGGGGG 0: 1
1: 0
2: 0
3: 12
4: 139
1162718536_1162718551 30 Left 1162718536 19:12648335-12648357 CCCGACCCGTTCTCCATTAGTGG 0: 1
1: 0
2: 0
3: 4
4: 51
Right 1162718551 19:12648388-12648410 CAGCCTTCGGTGCACCTGGGGGG 0: 1
1: 0
2: 0
3: 12
4: 139
1162718540_1162718551 24 Left 1162718540 19:12648341-12648363 CCGTTCTCCATTAGTGGCTCCGA 0: 1
1: 0
2: 3
3: 7
4: 63
Right 1162718551 19:12648388-12648410 CAGCCTTCGGTGCACCTGGGGGG 0: 1
1: 0
2: 0
3: 12
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162718551 Original CRISPR CAGCCTTCGGTGCACCTGGG GGG Exonic
901484327 1:9547968-9547990 CAGCCTCCGGGGTAGCTGGGTGG + Intronic
902740437 1:18434165-18434187 CAGCCTTCTTTGCCTCTGGGAGG - Intergenic
903260891 1:22131408-22131430 GTGCCTTAGGTGCACCTGGGAGG + Intronic
904454361 1:30638462-30638484 CAGCCCCAAGTGCACCTGGGTGG - Intergenic
904746428 1:32714068-32714090 CAGCCTTCTGAGTAGCTGGGAGG + Intergenic
908669256 1:66527886-66527908 CAGCCTTCCTTGCAGCTGGATGG - Intergenic
909482920 1:76144587-76144609 CTGCCTTGGCTTCACCTGGGAGG + Intronic
913496974 1:119436842-119436864 AGGCCTGCGATGCACCTGGGTGG + Intergenic
915524797 1:156468962-156468984 CAGCCTTTAGTTCACCTGGGGGG - Exonic
920570101 1:207009863-207009885 CAGGCTTCGGTGTACAAGGGAGG - Intronic
923261707 1:232273943-232273965 CAGGCTCCTGGGCACCTGGGAGG + Intergenic
1063135235 10:3210445-3210467 CAGCCTGTGGTGCACCTGGTGGG - Intergenic
1064327336 10:14363687-14363709 CAGCCTTGGGTGCCACTGTGGGG - Intronic
1066662420 10:37749442-37749464 CAGCCTGTGGTGCACCTGGTAGG - Intergenic
1070104135 10:73415662-73415684 CAGCCTCCCGTGTAGCTGGGAGG + Intergenic
1073137362 10:101227383-101227405 GGGCCTTCGGGGCGCCTGGGGGG + Exonic
1074536591 10:114332379-114332401 CAACCCTCGGTGCACTTGGAAGG + Intronic
1074981418 10:118622868-118622890 CAGCCTTCTGTGCAGTTAGGGGG + Intergenic
1075494969 10:122912109-122912131 CAGCCTACGGTGCCCAGGGGAGG - Intronic
1075521579 10:123146711-123146733 CACCCTTGGCTGCACTTGGGGGG + Intergenic
1076652478 10:131999364-131999386 CAGCCCTCGGGGCCCCTGGCTGG + Intergenic
1078599174 11:12715472-12715494 TTGCCTTCGTTTCACCTGGGTGG + Intronic
1080615325 11:33940576-33940598 CACCCATCTGTGCTCCTGGGTGG - Intergenic
1084757018 11:71246154-71246176 CAGACTTCCGGGCTCCTGGGAGG - Intronic
1088522310 11:110712573-110712595 CAGCCTGCGGCGCGCCTGGCGGG + Intronic
1091720094 12:2806884-2806906 CAGCCTCCGGAGTAGCTGGGAGG + Intergenic
1103316270 12:120058379-120058401 CAGCCCTCGGTGCATCTCTGCGG + Intronic
1107689030 13:42933622-42933644 CAGCCTTTGGTGCACCCAGGAGG + Intronic
1108467022 13:50726692-50726714 CAGGCATGGGTGCACCTCGGGGG + Intronic
1112926932 13:104687829-104687851 CAGCCACATGTGCACCTGGGTGG - Intergenic
1113693497 13:112328444-112328466 CAGCCTTCAGGGAAGCTGGGTGG + Intergenic
1115376571 14:32683294-32683316 CAGCATTAGATTCACCTGGGAGG - Intronic
1119612390 14:76074625-76074647 TAACCTTCAGTGGACCTGGGTGG + Intronic
1121845587 14:97169513-97169535 AAGCCTTCTGTGCACTGGGGAGG - Intergenic
1123402948 15:20004541-20004563 CAGGGTTCGGTGCAGCTGGCAGG + Intergenic
1123512288 15:21011195-21011217 CAGGGTTCGGTGCAGCTGGCAGG + Intergenic
1126137143 15:45403018-45403040 CAGCCCGAGGTGCCCCTGGGAGG + Exonic
1126284632 15:46996836-46996858 AAGCCTGCGGAGCTCCTGGGAGG - Intergenic
1132367724 15:101269686-101269708 CAGCCCTGGGTGCCTCTGGGTGG - Intergenic
1134116065 16:11549731-11549753 CAGCCCGCTATGCACCTGGGAGG + Exonic
1134687588 16:16169593-16169615 CACCCCTTGGTGCAGCTGGGAGG + Intronic
1135220954 16:20613615-20613637 CAGCCAATGGTGCAGCTGGGAGG + Intronic
1136272596 16:29157548-29157570 CAGCCTGTGGTGCACCTTCGGGG + Intergenic
1140250401 16:73289775-73289797 CACATTTCGGTGCACCTGGTAGG - Intergenic
1141004514 16:80339704-80339726 CATCCTTCCCTGCCCCTGGGAGG - Intergenic
1142076151 16:88119362-88119384 CAGCCTGTGGTGCACGTGCGGGG + Intergenic
1142112807 16:88341239-88341261 CAGCATTCAGTGCACCAGGCGGG - Intergenic
1142561121 17:809553-809575 CAGCCTTCTCTGCATCTGGATGG + Intronic
1143718653 17:8794897-8794919 CAGACTTCCTTGCAGCTGGGTGG + Intergenic
1146323117 17:31862177-31862199 CAGCCTCCCGAGCAGCTGGGTGG - Exonic
1147402893 17:40191651-40191673 CCGCCTTCGACTCACCTGGGAGG + Exonic
1147998765 17:44375702-44375724 CAGCCCCCAGTCCACCTGGGGGG + Exonic
1148232495 17:45945139-45945161 CAGCCTTCGGTGGCACTGGGTGG - Intronic
1150347599 17:64415994-64416016 CAGCCTCCCGAGTACCTGGGAGG - Intergenic
1150456241 17:65308958-65308980 CAGCCATCGTTGCCCCTGGCTGG - Intergenic
1152530962 17:80918845-80918867 GAGCCCTCTCTGCACCTGGGCGG - Intronic
1152639283 17:81442951-81442973 CCACCTTCTGTGCCCCTGGGGGG - Exonic
1156456656 18:37298604-37298626 CAGCCTCCGGAGTAGCTGGGAGG - Intronic
1158616029 18:58987836-58987858 CAGCCTCCTGGGCACGTGGGAGG - Intergenic
1160225785 18:77009715-77009737 CAGCCTCCGGGGCATCTGTGAGG - Intronic
1160409056 18:78662623-78662645 CAGCCTTCCAAGCAGCTGGGAGG + Intergenic
1160734825 19:657752-657774 CGGCCTTCGGTGGCCCTGGAGGG - Intronic
1161718883 19:5892484-5892506 CAGCCTTCGGTGTCCTTGGCTGG + Exonic
1162106220 19:8371345-8371367 CAGTTCTCCGTGCACCTGGGTGG + Exonic
1162718551 19:12648388-12648410 CAGCCTTCGGTGCACCTGGGGGG + Exonic
1163482769 19:17567828-17567850 CAGCCTCCCGAGCAGCTGGGAGG - Intronic
1165359388 19:35326628-35326650 CAGCCTTTCCTGAACCTGGGGGG + Intronic
1166897325 19:46032295-46032317 CAGCCGCAGCTGCACCTGGGAGG - Intergenic
925826396 2:7852380-7852402 CAGCCTTGGGAGAACCTGGGTGG - Intergenic
927533973 2:23837390-23837412 CAGCTGTAGCTGCACCTGGGAGG + Intronic
928062545 2:28129335-28129357 CAGCTTGGGGTACACCTGGGTGG - Exonic
930024170 2:47020372-47020394 TAGCCTTGGGTCCACCTGGCCGG + Intronic
934514443 2:94977409-94977431 GAGCCCTAGGTGCTCCTGGGAGG - Intergenic
934519390 2:95010424-95010446 CAGCATTCGTTACCCCTGGGAGG - Intergenic
934845511 2:97659463-97659485 CAGCCCCCGGTGCTCCTGGTGGG + Exonic
937046990 2:118857111-118857133 CTGCCTTCTAGGCACCTGGGTGG + Intergenic
937236678 2:120435516-120435538 CACCCTTCAGAGCTCCTGGGAGG + Intergenic
940774406 2:157871871-157871893 CAGCCTTTGGTTCAGATGGGAGG - Intronic
941931802 2:170948003-170948025 CAGCCTCCCGAGTACCTGGGAGG - Intronic
946394629 2:219436858-219436880 CAGCCCTCTTTGCCCCTGGGGGG - Intronic
1168972087 20:1937906-1937928 CAGGCTTCGGAGCATCGGGGAGG - Exonic
1169430035 20:5528256-5528278 CAGCCTCCAGAGCAGCTGGGAGG - Intergenic
1172875943 20:38164497-38164519 CAGCCTTTGGTGCATCTGTGAGG - Intronic
1173254066 20:41380954-41380976 CAGCTTTGGGTGGTCCTGGGAGG - Intergenic
1176185356 20:63775487-63775509 CAGCCCCCCGTGCACCTGAGAGG + Intronic
1176240131 20:64072087-64072109 CAGCCTTGGGTGAGCCTGTGCGG + Intronic
1179215620 21:39364794-39364816 CAGCCTCCCGAGCAGCTGGGAGG + Intergenic
1179982622 21:44904195-44904217 CAGCCTTCAGCCCCCCTGGGCGG + Intronic
1180850498 22:19017075-19017097 CAGCCTCCGGAGTAGCTGGGAGG - Intergenic
1181909510 22:26227524-26227546 CAGCCTTCTGAGTAGCTGGGGGG + Intronic
1181936398 22:26441985-26442007 CAGCCTCCGGAGTAGCTGGGAGG - Intronic
1182309935 22:29397401-29397423 CAGCCTTGGGTCCTCCTGGTGGG + Intronic
1182470341 22:30544410-30544432 CAGGCTTCGGAGCATCGGGGAGG - Intronic
1182840017 22:33381843-33381865 CAGCCATCCATGCCCCTGGGAGG + Intronic
1183556967 22:38536095-38536117 CAGCCTCCCGAGCAGCTGGGAGG - Intronic
1183748769 22:39707291-39707313 CAGGCTTTGGTGAGCCTGGGAGG - Intergenic
1184679641 22:46063385-46063407 CAGCCCTCTGTGAACCTGGCAGG - Intronic
1185159052 22:49211830-49211852 CAGCCTTCGGTGTACACAGGCGG - Intergenic
949540572 3:5028983-5029005 CAGCCTTCCGAGTAGCTGGGAGG + Intergenic
950749021 3:15114206-15114228 CAGCCCTCCCTGCATCTGGGAGG - Intergenic
951544409 3:23810576-23810598 CAGGGTCCGGTGCACCTGTGCGG + Intronic
952607110 3:35161665-35161687 CAGCCTTCTGAGTAGCTGGGAGG - Intergenic
953494831 3:43377203-43377225 CAGCCTTCTGAGTAGCTGGGAGG + Intronic
961601686 3:128067130-128067152 CAGCCTGCTGGGCACCTGGTCGG + Exonic
962252372 3:133843696-133843718 CAGCCTTCTTTGCAGCTGGGCGG + Intronic
962627110 3:137236554-137236576 AAGCCTACAGTGCACCTGCGAGG + Intergenic
974973330 4:68858663-68858685 CAGCGTTCTGTGAACCTGGAGGG - Intergenic
982290908 4:153781594-153781616 CAGCTTGCAGTGCACCTGTGAGG - Exonic
985484056 5:139162-139184 CATCCTTCGGAGCGCCTGGTGGG + Intergenic
988379374 5:30480805-30480827 CAGCCATGGAAGCACCTGGGAGG - Intergenic
994406653 5:99353117-99353139 CAGCTGCAGGTGCACCTGGGAGG + Intergenic
998394434 5:141809535-141809557 CAGCTGTTGGTGCAGCTGGGTGG + Intergenic
1001126390 5:169023511-169023533 CAGACTTCTGTGGACCTAGGAGG + Intronic
1002316375 5:178346898-178346920 CAGCCTTGGGTTGGCCTGGGAGG + Intronic
1006457781 6:34141883-34141905 CAGCCTCAGGTTCATCTGGGAGG + Intronic
1007952464 6:45884554-45884576 CAGCCTTCCTTGCACTAGGGTGG - Intergenic
1009520430 6:64675544-64675566 CAGCCTCCAGAGTACCTGGGTGG + Intronic
1013308480 6:108871817-108871839 CATGCTTCAGTGCACCTTGGAGG - Intronic
1013522331 6:110944563-110944585 CAGCCTTCTGAGTAGCTGGGAGG + Intergenic
1018695580 6:166388794-166388816 CAGCCACCGGAGCCCCTGGGAGG - Intergenic
1020379289 7:7525389-7525411 CAGCCTTCAGTGCACTTGTCAGG - Intronic
1028830793 7:95324615-95324637 ACGCCTTCTGTGCACCTGGTCGG - Exonic
1028941978 7:96531487-96531509 CAGCCTTCTGAGTAGCTGGGAGG - Intronic
1030363862 7:108624476-108624498 CAGCCTCCACTGCACCTGGGTGG - Intergenic
1032494090 7:132348020-132348042 CAGCCTAAGGAGCAACTGGGAGG - Intronic
1032649549 7:133862362-133862384 CAGCCTTCTGAGTAGCTGGGAGG - Intronic
1033319686 7:140328298-140328320 CAGCCTCCCGTGTAGCTGGGAGG - Intronic
1034983036 7:155490497-155490519 CAGCCATGCGTGCAGCTGGGCGG - Intronic
1037450886 8:19014343-19014365 CAGGCTGCGGGGCGCCTGGGGGG - Intronic
1038950138 8:32404948-32404970 CATCCTTAGGAGCAACTGGGAGG - Intronic
1040550987 8:48437464-48437486 CAGCCTCCCGAGCAGCTGGGAGG + Intergenic
1042480227 8:69294594-69294616 CAGACTTCGGTGCAGCAGGAGGG + Intergenic
1043082654 8:75785052-75785074 CAGCTGTGGCTGCACCTGGGAGG + Intergenic
1043437270 8:80246702-80246724 CTGCCTGCAGTGAACCTGGGAGG + Intergenic
1048119518 8:131563807-131563829 CAGCCTTGGGTGCCCATGAGTGG - Intergenic
1049038978 8:140098369-140098391 AAGCCTGCGGAGGACCTGGGCGG - Intronic
1052654339 9:31335545-31335567 CAGCTTCAGTTGCACCTGGGAGG + Intergenic
1053302124 9:36959768-36959790 CAGCCTGTGCTGCAACTGGGGGG + Intronic
1053414572 9:37938977-37938999 CAGATTTCGGAGCAGCTGGGTGG - Intronic
1057141507 9:92729270-92729292 TATCCTTCGGCGCCCCTGGGAGG - Intronic
1058473671 9:105307523-105307545 CAGCCTCCTGAGCAGCTGGGAGG - Intronic
1058509069 9:105696405-105696427 CAGCCTCCGGAGTAGCTGGGAGG + Intronic
1060414182 9:123419150-123419172 CAGCCTTTAGTGAACCTGGTTGG - Intronic
1060442480 9:123654859-123654881 CAGCCGTGGGAGCACCTGTGGGG + Intronic
1061893101 9:133633174-133633196 CAGCCGTCGATGCGCCTTGGAGG + Intergenic
1062039770 9:134398893-134398915 TAGCCCTGGGAGCACCTGGGAGG - Intronic
1062070790 9:134554022-134554044 CAGCCCTCGGGGGGCCTGGGTGG + Intergenic
1062122086 9:134839253-134839275 CAGCTTTCGGCGCCTCTGGGGGG + Intronic
1062662341 9:137644441-137644463 CAGCCTCCCGAGCAGCTGGGAGG + Intronic
1185673339 X:1828762-1828784 CGGCCTTCAGTCCACCTGGGTGG + Intergenic
1185673446 X:1829710-1829732 CGGCCTTCAGTCCACCTGGGTGG + Intergenic
1200230382 X:154441002-154441024 CAGCCTTCTTTGCACTTTGGTGG + Intronic