ID: 1162719070

View in Genome Browser
Species Human (GRCh38)
Location 19:12651129-12651151
Sequence TGCCACGCTCAAGAGTGATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 78}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162719070_1162719078 26 Left 1162719070 19:12651129-12651151 CCACATCACTCTTGAGCGTGGCA 0: 1
1: 0
2: 0
3: 7
4: 78
Right 1162719078 19:12651178-12651200 CATAGAATAGGATTCTAGCTTGG 0: 1
1: 0
2: 0
3: 7
4: 128
1162719070_1162719073 14 Left 1162719070 19:12651129-12651151 CCACATCACTCTTGAGCGTGGCA 0: 1
1: 0
2: 0
3: 7
4: 78
Right 1162719073 19:12651166-12651188 TCACCATTGCCCCATAGAATAGG 0: 1
1: 0
2: 1
3: 8
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162719070 Original CRISPR TGCCACGCTCAAGAGTGATG TGG (reversed) Intronic
900287428 1:1908439-1908461 TGCCACCCTCTGCAGTGATGGGG - Intergenic
900714232 1:4133662-4133684 TCCCCCGCTTAAGAGTGAGGAGG - Intergenic
900974216 1:6007233-6007255 TGCCAGGCTCCAGAGAGGTGGGG + Intronic
902878909 1:19358000-19358022 TGCCAGGCTCAGGAGGGATCAGG - Intronic
914452081 1:147801434-147801456 TGCCATTCTCAACAGTGGTGCGG + Intergenic
918100341 1:181367136-181367158 TGCCACGCAAAAGAGTGTTGTGG + Intergenic
924082292 1:240411918-240411940 TCCGAAGCTCAGGAGTGATGTGG + Intronic
1064528951 10:16287252-16287274 TGACAGTCTCAACAGTGATGAGG + Intergenic
1073578677 10:104644552-104644574 AGCCAGGGTGAAGAGTGATGGGG + Intronic
1077481217 11:2815577-2815599 TGCCAAGCCCAAGAAAGATGAGG + Intronic
1078754875 11:14199788-14199810 TTGCACCCTCCAGAGTGATGGGG - Intronic
1082080105 11:48006253-48006275 TGCCTCTCTCAAGGGTGATTCGG + Intronic
1085346831 11:75773604-75773626 TGCCACTCTCTACAGTGTTGGGG - Intronic
1085485576 11:76860703-76860725 TGCCCCGCCCAAGGGTGAAGAGG + Intergenic
1088456771 11:110041148-110041170 GCCCAAGGTCAAGAGTGATGGGG + Intergenic
1090863276 11:130673145-130673167 AGCCAGACTCCAGAGTGATGTGG - Exonic
1092497156 12:9008121-9008143 TGCCACATACAAGATTGATGAGG + Intronic
1096429030 12:51528079-51528101 TGCCAACCTCAAGAGGGAAGAGG - Intergenic
1102193592 12:111008092-111008114 TGCCACCAGCAAGAGTGAAGAGG - Intergenic
1103481188 12:121250622-121250644 TGCTACGATGAGGAGTGATGTGG - Intronic
1103960045 12:124603775-124603797 TCCCATGCTCAAAAATGATGAGG - Intergenic
1106874234 13:34054618-34054640 TGGGACGCTCAAGCTTGATGCGG - Intergenic
1110188319 13:72700977-72700999 TGCATCTCTCCAGAGTGATGGGG + Intergenic
1111059620 13:82999005-82999027 TGCCACCCAGAAGAGTGATGTGG - Intergenic
1115510603 14:34134456-34134478 AGCCACTCTCAAGATTAATGGGG - Intronic
1122002474 14:98671330-98671352 TGACACGCTCAAGATTCAGGAGG + Intergenic
1122125258 14:99575300-99575322 AGCCACGCTCATGAGTCATGGGG - Intronic
1127030023 15:54851326-54851348 TGCGACGCTCAAGCTTGGTGGGG + Intergenic
1130091205 15:80822867-80822889 TGAAAAGCTCAAGAGTGAGGAGG - Intronic
1138009216 16:53362182-53362204 TGCCAGGCTGAAGGATGATGGGG + Intergenic
1140229680 16:73107572-73107594 TTCCAGGCACAGGAGTGATGTGG - Intergenic
1141353830 16:83324377-83324399 TGCTACTTCCAAGAGTGATGGGG - Intronic
1142530081 17:573505-573527 TGCCAGGCTCAAGAGAAATCTGG + Intronic
1146322375 17:31857075-31857097 TGCCACGGTGAAGTGTCATGAGG - Intronic
1146521727 17:33530649-33530671 TGCCAGGCTCAAGAGAGAGGTGG + Intronic
1146533624 17:33631285-33631307 TGCCACGCTTAAGACTGAGGGGG - Intronic
1150383109 17:64736206-64736228 TTCCACACTCAAGAGTGAAATGG + Intergenic
1150773135 17:68058570-68058592 TTCCACACTCAAGAGTGAAATGG - Intergenic
1154398921 18:14016597-14016619 TCCCATCCTCAAGAGTGGTGAGG - Intergenic
1159241266 18:65746753-65746775 TGGCATGGTCATGAGTGATGCGG + Intergenic
1159955095 18:74513455-74513477 AGCCAGGCTCAGGAGAGATGCGG - Intronic
1161633700 19:5373604-5373626 GGCCACACTCAAGAATGAGGTGG - Intergenic
1162577100 19:11505507-11505529 GGCCGCGCTCCAGAGAGATGAGG + Exonic
1162719070 19:12651129-12651151 TGCCACGCTCAAGAGTGATGTGG - Intronic
1163144915 19:15373669-15373691 TGCCACACCCAAGAGGGAGGCGG + Intronic
1164869951 19:31634580-31634602 TGCCAGGCTCAGGAAGGATGTGG + Intergenic
932770432 2:74498091-74498113 AGCCAAGCTCAAGCGCGATGTGG - Exonic
938406902 2:131037760-131037782 TGCCTTGCTCCAGAGTGGTGTGG - Intronic
1173231207 20:41200327-41200349 TGTCATGCTCAAGAGAGATGAGG - Intronic
1175430782 20:58901578-58901600 GGCCACGCTCATTAGTGGTGGGG - Intronic
1178093381 21:29188174-29188196 TGGCAGGCTCAAGACTGAGGAGG + Intergenic
1179256822 21:39723972-39723994 TCCCAGGCTCAAGTGAGATGTGG - Intergenic
1183699913 22:39445461-39445483 TGGAAGGCTCAAAAGTGATGTGG + Intergenic
959753640 3:109869467-109869489 TGGGAAGCACAAGAGTGATGAGG + Intergenic
963024639 3:140907123-140907145 TGCCAGGCTGAAGAGGAATGTGG - Intergenic
969662779 4:8539941-8539963 TGCCACTCTCAAGAGTGTCCGGG + Intergenic
971408891 4:26349105-26349127 TGCCAGGCTCTAGAGTGCAGTGG + Intronic
973872493 4:55180292-55180314 TCCCACTCTCAAAAGTGTTGAGG - Intergenic
979888546 4:126061992-126062014 GGACACGCTCAAGATTGATAAGG + Intergenic
984097153 4:175447770-175447792 AGGCAAGCTGAAGAGTGATGGGG - Intergenic
990101873 5:52201144-52201166 TCCCAGGCCCTAGAGTGATGTGG + Intergenic
992855059 5:80851322-80851344 TGCCATTATCAAGAGTGCTGCGG - Intronic
1000634883 5:163632691-163632713 TACCACACTTAGGAGTGATGAGG - Intergenic
1008329960 6:50232893-50232915 TGCCTAGCACAAGAGTGATGTGG + Intergenic
1008510929 6:52274884-52274906 TGTCATTCTCAAGAGTGATTGGG - Intronic
1010265063 6:73856643-73856665 TGCCACCTTAAAGGGTGATGGGG + Intergenic
1013055571 6:106579524-106579546 TGTCAGGCTCAAAAGTGAAGAGG - Intronic
1013431941 6:110063448-110063470 TGCCAGGCTCCAGGGGGATGGGG + Intergenic
1016523872 6:144977452-144977474 TGCCACACTGAAGCTTGATGGGG - Intergenic
1021676372 7:23084527-23084549 AGGCAAGCCCAAGAGTGATGGGG - Intergenic
1024199480 7:47091153-47091175 TGCCTCACTCAAGGGTGGTGAGG + Intergenic
1029559671 7:101294276-101294298 TGTCACCTTCAAGAGTGATTGGG + Intergenic
1036438475 8:8758395-8758417 TGCCTGACTCAAGAGTGGTGAGG + Intergenic
1037516764 8:19639525-19639547 TGCCCTGACCAAGAGTGATGGGG - Intronic
1041441628 8:57903425-57903447 GGCCACTCTCTACAGTGATGTGG + Intergenic
1045188261 8:99859280-99859302 TGCAACGCACAAGAGGGAAGGGG - Intronic
1045539806 8:103073046-103073068 TACCAAGCTCCAGAGAGATGTGG + Exonic
1046886329 8:119371338-119371360 TGACATTCTCAGGAGTGATGTGG - Intergenic
1050973914 9:11912259-11912281 TGGGACGCTCAAGCTTGATGAGG - Intergenic
1203564049 Un_KI270744v1:78255-78277 TGCCACGCTCAAGTGGGCGGTGG - Intergenic
1185697075 X:2203312-2203334 TCCCACACTCACGAGTCATGTGG + Intergenic
1186851126 X:13581110-13581132 TTCCAAGCTCAGGAGTTATGTGG - Intronic
1194322065 X:92460730-92460752 TGCCAGGCCCAGGAGTAATGAGG + Intronic
1195085159 X:101407122-101407144 TGCCACGCTCATGGGCGAGGTGG + Intronic
1196975507 X:121153900-121153922 AGGCAAGCTCAAGAGTGATTGGG + Intergenic
1201893357 Y:18967385-18967407 TCCCATCCTCAAGAGTGAGGAGG - Intergenic