ID: 1162720351

View in Genome Browser
Species Human (GRCh38)
Location 19:12658269-12658291
Sequence GGACCGGTTACTTTTCCAGT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 39
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 35}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162720351_1162720355 -10 Left 1162720351 19:12658269-12658291 CCGACTGGAAAAGTAACCGGTCC 0: 1
1: 0
2: 0
3: 3
4: 35
Right 1162720355 19:12658282-12658304 TAACCGGTCCAGAACTGGTGGGG 0: 1
1: 0
2: 0
3: 7
4: 41
1162720351_1162720359 5 Left 1162720351 19:12658269-12658291 CCGACTGGAAAAGTAACCGGTCC 0: 1
1: 0
2: 0
3: 3
4: 35
Right 1162720359 19:12658297-12658319 TGGTGGGGGCCATCCGCGTAAGG 0: 1
1: 0
2: 0
3: 0
4: 38
1162720351_1162720360 6 Left 1162720351 19:12658269-12658291 CCGACTGGAAAAGTAACCGGTCC 0: 1
1: 0
2: 0
3: 3
4: 35
Right 1162720360 19:12658298-12658320 GGTGGGGGCCATCCGCGTAAGGG 0: 1
1: 0
2: 0
3: 4
4: 31
1162720351_1162720356 -9 Left 1162720351 19:12658269-12658291 CCGACTGGAAAAGTAACCGGTCC 0: 1
1: 0
2: 0
3: 3
4: 35
Right 1162720356 19:12658283-12658305 AACCGGTCCAGAACTGGTGGGGG 0: 1
1: 0
2: 0
3: 3
4: 41

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162720351 Original CRISPR GGACCGGTTACTTTTCCAGT CGG (reversed) Exonic