ID: 1162720353

View in Genome Browser
Species Human (GRCh38)
Location 19:12658280-12658302
Sequence AGTAACCGGTCCAGAACTGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 64}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162720349_1162720353 -8 Left 1162720349 19:12658265-12658287 CCGGCCGACTGGAAAAGTAACCG 0: 1
1: 0
2: 0
3: 1
4: 18
Right 1162720353 19:12658280-12658302 AGTAACCGGTCCAGAACTGGTGG 0: 1
1: 0
2: 0
3: 1
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162720353 Original CRISPR AGTAACCGGTCCAGAACTGG TGG Exonic