ID: 1162720354 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 19:12658281-12658303 |
| Sequence | GTAACCGGTCCAGAACTGGT GGG |
| Strand | + |
| Crispr in exon? | Yes |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 48 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 0, 4: 47} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1162720349_1162720354 | -7 | Left | 1162720349 | 19:12658265-12658287 | CCGGCCGACTGGAAAAGTAACCG | 0: 1 1: 0 2: 0 3: 1 4: 18 |
||
| Right | 1162720354 | 19:12658281-12658303 | GTAACCGGTCCAGAACTGGTGGG | 0: 1 1: 0 2: 0 3: 0 4: 47 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1162720354 | Original CRISPR | GTAACCGGTCCAGAACTGGT GGG | Exonic | ||