ID: 1162720359

View in Genome Browser
Species Human (GRCh38)
Location 19:12658297-12658319
Sequence TGGTGGGGGCCATCCGCGTA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 39
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 38}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162720351_1162720359 5 Left 1162720351 19:12658269-12658291 CCGACTGGAAAAGTAACCGGTCC 0: 1
1: 0
2: 0
3: 3
4: 35
Right 1162720359 19:12658297-12658319 TGGTGGGGGCCATCCGCGTAAGG 0: 1
1: 0
2: 0
3: 0
4: 38
1162720349_1162720359 9 Left 1162720349 19:12658265-12658287 CCGGCCGACTGGAAAAGTAACCG 0: 1
1: 0
2: 0
3: 1
4: 18
Right 1162720359 19:12658297-12658319 TGGTGGGGGCCATCCGCGTAAGG 0: 1
1: 0
2: 0
3: 0
4: 38

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162720359 Original CRISPR TGGTGGGGGCCATCCGCGTA AGG Exonic