ID: 1162720360

View in Genome Browser
Species Human (GRCh38)
Location 19:12658298-12658320
Sequence GGTGGGGGCCATCCGCGTAA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 36
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 31}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162720349_1162720360 10 Left 1162720349 19:12658265-12658287 CCGGCCGACTGGAAAAGTAACCG 0: 1
1: 0
2: 0
3: 1
4: 18
Right 1162720360 19:12658298-12658320 GGTGGGGGCCATCCGCGTAAGGG 0: 1
1: 0
2: 0
3: 4
4: 31
1162720351_1162720360 6 Left 1162720351 19:12658269-12658291 CCGACTGGAAAAGTAACCGGTCC 0: 1
1: 0
2: 0
3: 3
4: 35
Right 1162720360 19:12658298-12658320 GGTGGGGGCCATCCGCGTAAGGG 0: 1
1: 0
2: 0
3: 4
4: 31
1162720357_1162720360 -10 Left 1162720357 19:12658285-12658307 CCGGTCCAGAACTGGTGGGGGCC 0: 1
1: 0
2: 2
3: 9
4: 123
Right 1162720360 19:12658298-12658320 GGTGGGGGCCATCCGCGTAAGGG 0: 1
1: 0
2: 0
3: 4
4: 31

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162720360 Original CRISPR GGTGGGGGCCATCCGCGTAA GGG Exonic