ID: 1162721102

View in Genome Browser
Species Human (GRCh38)
Location 19:12663524-12663546
Sequence CGGCCATGTCCCACCCAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 173}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162721093_1162721102 8 Left 1162721093 19:12663493-12663515 CCATCACCCAGACCTTCCCTGGT 0: 1
1: 0
2: 1
3: 40
4: 361
Right 1162721102 19:12663524-12663546 CGGCCATGTCCCACCCAGGATGG 0: 1
1: 0
2: 1
3: 25
4: 173
1162721091_1162721102 9 Left 1162721091 19:12663492-12663514 CCCATCACCCAGACCTTCCCTGG 0: 1
1: 0
2: 3
3: 28
4: 317
Right 1162721102 19:12663524-12663546 CGGCCATGTCCCACCCAGGATGG 0: 1
1: 0
2: 1
3: 25
4: 173
1162721099_1162721102 -9 Left 1162721099 19:12663510-12663532 CCTGGTTTCAAAGCCGGCCATGT 0: 1
1: 0
2: 0
3: 6
4: 86
Right 1162721102 19:12663524-12663546 CGGCCATGTCCCACCCAGGATGG 0: 1
1: 0
2: 1
3: 25
4: 173
1162721090_1162721102 26 Left 1162721090 19:12663475-12663497 CCAAGTTCAAGGGGTGGCCCATC 0: 1
1: 0
2: 0
3: 4
4: 92
Right 1162721102 19:12663524-12663546 CGGCCATGTCCCACCCAGGATGG 0: 1
1: 0
2: 1
3: 25
4: 173
1162721097_1162721102 -4 Left 1162721097 19:12663505-12663527 CCTTCCCTGGTTTCAAAGCCGGC 0: 1
1: 0
2: 1
3: 9
4: 99
Right 1162721102 19:12663524-12663546 CGGCCATGTCCCACCCAGGATGG 0: 1
1: 0
2: 1
3: 25
4: 173
1162721095_1162721102 1 Left 1162721095 19:12663500-12663522 CCAGACCTTCCCTGGTTTCAAAG 0: 1
1: 0
2: 1
3: 11
4: 207
Right 1162721102 19:12663524-12663546 CGGCCATGTCCCACCCAGGATGG 0: 1
1: 0
2: 1
3: 25
4: 173
1162721098_1162721102 -8 Left 1162721098 19:12663509-12663531 CCCTGGTTTCAAAGCCGGCCATG 0: 1
1: 0
2: 0
3: 5
4: 89
Right 1162721102 19:12663524-12663546 CGGCCATGTCCCACCCAGGATGG 0: 1
1: 0
2: 1
3: 25
4: 173
1162721094_1162721102 2 Left 1162721094 19:12663499-12663521 CCCAGACCTTCCCTGGTTTCAAA 0: 1
1: 0
2: 0
3: 15
4: 228
Right 1162721102 19:12663524-12663546 CGGCCATGTCCCACCCAGGATGG 0: 1
1: 0
2: 1
3: 25
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162721102 Original CRISPR CGGCCATGTCCCACCCAGGA TGG Intronic
900295394 1:1946686-1946708 TGGCCGTGTCCCAGCCAGGGAGG + Intronic
900306224 1:2009921-2009943 CATCCATGTGCCACCCAGGATGG - Intergenic
901462200 1:9398472-9398494 CAGCCAGGTCCCACCCACGAGGG + Intergenic
901853800 1:12031600-12031622 CTGCCCTGCTCCACCCAGGAAGG + Intronic
901927981 1:12579069-12579091 CGGCCCTCTCCCTCGCAGGAAGG - Intronic
902087025 1:13871107-13871129 CAGCCAACTCCCCCCCAGGAAGG - Intergenic
902506652 1:16943097-16943119 CAGCCATGTGCCACCACGGATGG - Intronic
902927446 1:19705600-19705622 TGGCCACATGCCACCCAGGATGG - Intronic
907932466 1:59013452-59013474 CGGCCAGGGCCGGCCCAGGAAGG - Intergenic
912550710 1:110483614-110483636 GGCCCATGTCCCACCCAGGCAGG + Intergenic
912554779 1:110508163-110508185 CGGCCTTGTCACAGGCAGGAGGG + Intergenic
919484318 1:198127986-198128008 CTCCCATTTCCAACCCAGGAAGG + Intergenic
922616048 1:226961705-226961727 GGGCCCTGTCCCACCCTGGAAGG - Intronic
923193501 1:231642324-231642346 CGGCCTTGGCCAACCCAGAAAGG + Intronic
1064259596 10:13774534-13774556 AGGACATGTCCCAGGCAGGAAGG + Intronic
1064367986 10:14725544-14725566 CAGCCATGTGCAAACCAGGAAGG - Intronic
1066218612 10:33313790-33313812 CGGACATGGTCCACACAGGACGG + Intronic
1066761271 10:38755663-38755685 GGACCATGTCCCACCCAGAATGG - Intergenic
1066783686 10:38979327-38979349 ATTCCATGTTCCACCCAGGAAGG - Intergenic
1066960319 10:42216759-42216781 GGACCATGTCCCACCCAGAATGG + Intergenic
1067233597 10:44428248-44428270 AGGCCCTTTCCAACCCAGGAGGG - Intergenic
1067348813 10:45457147-45457169 CAGCCATGTGCCACCCTGGCCGG - Exonic
1068460320 10:57321462-57321484 CGGCCTTGGCCAGCCCAGGAAGG - Intergenic
1068631789 10:59305759-59305781 AGGCTCTCTCCCACCCAGGAGGG - Intronic
1070467322 10:76736650-76736672 AAGCCATGACACACCCAGGAAGG + Intergenic
1070664934 10:78336225-78336247 AGACCATGTCCCACACAGCACGG + Intergenic
1071759332 10:88583082-88583104 CAGCCTTGTCCCACACAGCAAGG + Exonic
1072278445 10:93845130-93845152 TGGCCTTGGCCAACCCAGGAAGG - Intergenic
1074099773 10:110345662-110345684 CAGCCATTCCCCACTCAGGAAGG - Intergenic
1077053688 11:579544-579566 GGGCCACGGCCCATCCAGGAGGG - Intronic
1077126747 11:942859-942881 CAGCCTTGTCCCAGCCTGGAGGG + Intronic
1077303776 11:1858825-1858847 TAGCCGTGTCCCACCCAGCACGG + Intronic
1077326202 11:1965164-1965186 GGGCCCTGGCCCACCCAGGATGG + Intronic
1079330378 11:19528069-19528091 CTGCCATGTACCACACAGCAGGG - Intronic
1081572530 11:44300663-44300685 TGGCCCTGTCCCACCTGGGAGGG - Intronic
1083822986 11:65182979-65183001 TAGCCGAGTCCCACCCAGGATGG - Intronic
1084537490 11:69765809-69765831 AGGCTCTGTCCCACCCGGGACGG + Intergenic
1089928759 11:122287474-122287496 AGGCGATGTCCCTCCCAGAATGG - Intergenic
1202809183 11_KI270721v1_random:20343-20365 GGGCCCTGGCCCACCCAGGATGG + Intergenic
1091771069 12:3151627-3151649 GCGCCATGTCCCACCAAGCATGG - Intronic
1092350574 12:7752479-7752501 CGGCCTTGGCCAACCCAGAAAGG + Intergenic
1096428358 12:51522957-51522979 GGGCAAAGTCCCAACCAGGAAGG + Intergenic
1096617846 12:52844402-52844424 GGGCCATTTCCCCTCCAGGAGGG - Intronic
1097680876 12:62647797-62647819 TGTCCAAGTCCCACCCAGGCTGG - Exonic
1100114109 12:91281876-91281898 TGGCCATGTGCAAGCCAGGAAGG - Intergenic
1101321084 12:103673677-103673699 CTTGCTTGTCCCACCCAGGAGGG - Intronic
1103927062 12:124429083-124429105 CGGCCCTGCTCCAGCCAGGAGGG + Intronic
1103981708 12:124741109-124741131 CGGCCATGGCCCTGCAAGGAGGG + Intergenic
1104044809 12:125154246-125154268 CGCTCATGTCTCACCCAGGCTGG + Intergenic
1105604180 13:21913250-21913272 CAGCCAGGCCCCAGCCAGGAGGG + Intergenic
1117733368 14:58745909-58745931 CAGCAATGTCCCAGCCATGAAGG - Intergenic
1119007413 14:70944229-70944251 AGCCCATGTGCCAGCCAGGAGGG + Intronic
1123054120 14:105561165-105561187 CTGCCATCTCCCTCCCAGGAGGG + Intergenic
1123078703 14:105681582-105681604 CTGCCATCTCCCTCCCAGGAGGG + Intergenic
1202902423 14_GL000194v1_random:51388-51410 CCTCCTTGTCCCACCCTGGAGGG - Intergenic
1202931977 14_KI270725v1_random:45955-45977 GGACCATGTCCCACCCAGAATGG - Intergenic
1123625030 15:22221403-22221425 CGGCCACATCTCACCCAGGCAGG + Intergenic
1124037752 15:26071753-26071775 GGGCCATGTGCCTCCCAGGAGGG + Intergenic
1126088939 15:45034776-45034798 CGGCCTTGGCCAACCCAGAAAGG - Intronic
1127470309 15:59284112-59284134 CTGCCATGTCCCCACCAGGGTGG + Intronic
1129699575 15:77759951-77759973 CAGCCAGGGCCCACCCCGGAGGG + Intronic
1131176440 15:90212231-90212253 CTGCCCTGTCCCTCCCTGGAGGG - Intronic
1131902092 15:97099042-97099064 CAGCCATCTGCCAACCAGGAAGG + Intergenic
1132087923 15:98923124-98923146 TGGCTATGTCTCTCCCAGGAGGG - Intronic
1132657759 16:1048470-1048492 CAGCCAGGTCCCATCCAGGGTGG + Intergenic
1132786015 16:1657304-1657326 CTTCCATGTCCCACACAGAAGGG - Intronic
1133527421 16:6619145-6619167 CTGACATGTTCCAGCCAGGAAGG + Intronic
1133933347 16:10250014-10250036 CGGCCATCTCCAACCCAGGAAGG + Intergenic
1134967729 16:18504988-18505010 CGGCCATTTCCCATCCATGGGGG - Intronic
1136613742 16:31382752-31382774 GGGCCATGTCCCTCCCTAGAGGG - Exonic
1137423192 16:48353773-48353795 CTGCCCTGTTCCACCCAGCAGGG + Exonic
1137442458 16:48508644-48508666 CGGCCTTGGCCAACCCAGAAAGG - Intergenic
1141157141 16:81605260-81605282 CTGCCATGTGTCACCCAAGAAGG - Intronic
1141669272 16:85483291-85483313 CTCCCATGACCCACCCAGGCAGG - Intergenic
1142246493 16:88972550-88972572 CTGCCATGACTGACCCAGGAGGG + Intronic
1142403319 16:89872564-89872586 CGGCCTGGCCCCTCCCAGGATGG - Intergenic
1142743125 17:1942074-1942096 CACCCCTGGCCCACCCAGGAGGG - Intronic
1143116874 17:4585927-4585949 GGGCCATCTCCCACCCTGGATGG - Intronic
1148323421 17:46770696-46770718 CGGCCAACTCCCTCCCAGAAGGG + Intronic
1150775771 17:68080599-68080621 CGGCCTTGGCCAGCCCAGGAAGG - Intergenic
1151417035 17:73973311-73973333 CAGCCATGTTCCTCCCAGCAGGG + Intergenic
1151520895 17:74628815-74628837 TGGCCAAGAACCACCCAGGACGG + Intergenic
1152348641 17:79770413-79770435 GGGACATGTGCCCCCCAGGATGG - Intergenic
1152699892 17:81813572-81813594 CGGCCACGGCCCTCCCAGCAAGG + Exonic
1160331817 18:78000141-78000163 CTCCCATCTCCCATCCAGGAGGG + Intergenic
1160563958 18:79775518-79775540 CCGCTCTGCCCCACCCAGGACGG - Intergenic
1161055873 19:2190418-2190440 CAGCCCAGTCCCACTCAGGAGGG - Intronic
1162721102 19:12663524-12663546 CGGCCATGTCCCACCCAGGATGG + Intronic
1162797930 19:13096106-13096128 GGGCCAAGTCACACCCTGGAGGG - Exonic
1163031328 19:14546015-14546037 CGGGCGTGACCCAGCCAGGAAGG - Intronic
1164436862 19:28237829-28237851 TGCCCTTGTCCCACCCAGCAAGG - Intergenic
1164852505 19:31496278-31496300 CGGCTCTGTCCCACGGAGGATGG - Intergenic
924969245 2:109138-109160 CTGCTGGGTCCCACCCAGGACGG + Intergenic
925157113 2:1657072-1657094 GGGGCAGGTCCCAGCCAGGAGGG - Intronic
926134282 2:10325750-10325772 CGGGCTTCTCCCAGCCAGGAAGG - Intronic
928701593 2:33903930-33903952 CGGCCTTGGCCAGCCCAGGAAGG + Intergenic
931108530 2:59084495-59084517 TGGCCATCTGCCAGCCAGGACGG - Intergenic
934324579 2:92000340-92000362 GGACCATGTCCCACCCAGAATGG - Intergenic
934462955 2:94231039-94231061 GGACCATGTCCCACCCAGAATGG - Intergenic
934504248 2:94879012-94879034 CCTCCTTGTCCCACCCTGGAGGG + Intergenic
936531014 2:113277281-113277303 GGGCCATGGCCCAACTAGGAGGG - Intronic
939281701 2:140073738-140073760 CGGCCTTGGCCAACCCAGAAAGG - Intergenic
939716780 2:145594042-145594064 CACACAAGTCCCACCCAGGAGGG + Intergenic
940945771 2:159615948-159615970 CCCCCACCTCCCACCCAGGACGG + Intronic
942303631 2:174585869-174585891 AGGCCATGACCGACCCAGGTGGG + Intronic
947188183 2:227472833-227472855 CGCCCACGTCCCACCCACGAAGG - Intronic
947717492 2:232349238-232349260 CGGCCATGGCCCAGACAGGTGGG - Intergenic
948401978 2:237691679-237691701 CGGGCAGGTCCCCCCCCGGAGGG + Intronic
948727954 2:239946205-239946227 TGGCCAGGTGCCACCTAGGAGGG - Intronic
1171988422 20:31676847-31676869 ATGAAATGTCCCACCCAGGAAGG - Intronic
1173226199 20:41163653-41163675 CTGCCCTGTCCAACCCAAGATGG - Intronic
1173491239 20:43484190-43484212 TAGCCATGTGGCACCCAGGATGG + Intergenic
1175388360 20:58611460-58611482 CAGCCACGTCCCAGCCAGGCAGG - Intergenic
1175933599 20:62504985-62505007 CCACCAAGTCCCACCCAAGATGG - Intergenic
1176189326 20:63800505-63800527 CGGCCTTGGCCATCCCAGGAAGG - Intronic
1176231786 20:64036617-64036639 CTGCTGTGTCCCACCCAGGTGGG - Intronic
1176594005 21:8674093-8674115 GGACCATGTCCCACCCAGAATGG - Intergenic
1176621791 21:9066155-9066177 CCTCCTTGTCCCACCCTGGAGGG - Intergenic
1176916463 21:14631650-14631672 CCACCATGCCCCACCCAAGATGG + Intronic
1180276859 22:10651221-10651243 GGACCATGTCCCACCCAGAATGG - Intergenic
1180584079 22:16870125-16870147 GGACCATGTCCCACCCAGAATGG - Intergenic
1180861899 22:19088173-19088195 AGGCCAAGTCCCACTAAGGAAGG + Intronic
1181804393 22:25366263-25366285 GGGGCATGTTCCACCGAGGATGG + Intronic
1183167744 22:36160383-36160405 GGGCCATGTCTCACGCAGGCTGG + Intronic
1184538931 22:45107010-45107032 CGGCCATCTGCAAACCAGGAAGG + Intergenic
950638730 3:14334150-14334172 CGGCCAGGTACCCCACAGGATGG + Intergenic
951024915 3:17818103-17818125 CGGCCTTGGCCATCCCAGGAAGG + Intronic
952278875 3:31904074-31904096 CTGACAGGTCCCAGCCAGGATGG + Intronic
952903969 3:38127648-38127670 AGGCCTTGTGCCACCCAGGTTGG - Intronic
953726987 3:45408269-45408291 TGGCCATGGCACACCCAGGTGGG - Intronic
955535797 3:59922384-59922406 CGTCCATGTTCTTCCCAGGAAGG - Exonic
956965608 3:74455850-74455872 TGGCCCTGCCCCACCCAGGAGGG + Intronic
957371429 3:79300162-79300184 CGGCCTTGGCCAGCCCAGGAAGG - Intronic
957556355 3:81767805-81767827 CGGCCTTGGCCAGCCCAGGAAGG + Intergenic
957830080 3:85505094-85505116 CGGCCTTGGCCAGCCCAGGAGGG + Intronic
958810804 3:98858342-98858364 CGGCCTTGGCCAGCCCAGGAAGG + Intronic
961179658 3:124866687-124866709 CTGCCATATCCCAGCCAGAAAGG - Intronic
961463772 3:127069172-127069194 GGGCCCTGTCCCACCCATGTTGG + Intergenic
961468761 3:127098152-127098174 CTGCCAGGTGCCACACAGGAGGG - Intergenic
969254951 4:5995247-5995269 TTTCCATGTCCCACCCAGGGAGG + Intergenic
969419561 4:7084226-7084248 CGGTCATGTCTCTCCCAGTATGG + Intergenic
969425223 4:7120384-7120406 CATCCATGTCCCAGTCAGGAAGG + Intergenic
974987822 4:69051470-69051492 GGGCAATTTCCTACCCAGGAGGG - Intronic
978042878 4:104092006-104092028 GCTCCATGTCACACCCAGGAGGG - Intergenic
979308263 4:119173723-119173745 CGGCCTTGTCCAGCCCAGAAAGG - Intronic
979445724 4:120808984-120809006 CGGCCTTGTCCAGCCCAGAAGGG + Intronic
979620348 4:122791475-122791497 TAGCCATGTGTCACCCAGGATGG - Intergenic
980941855 4:139282176-139282198 CGGCCATGTGCCACACTGAAAGG - Intronic
983230713 4:165126355-165126377 CGGCCTTGGCCAACCCAAGAAGG + Intronic
984241879 4:177227944-177227966 TGGCCTTGGCCCGCCCAGGAAGG + Intergenic
985540590 5:485725-485747 GGGCCTCGGCCCACCCAGGACGG - Intronic
985571248 5:646699-646721 CGGCCCTGCCCCTCCCATGAGGG - Intronic
986125428 5:4879304-4879326 CGGCCCTGTCACCCTCAGGAGGG - Intergenic
988201829 5:28078070-28078092 CGGCCTTGGCCAGCCCAGGAAGG + Intergenic
988589271 5:32534879-32534901 AGGCCATGTCCAGGCCAGGAAGG + Intronic
991256591 5:64621195-64621217 CAGCCCTGTCCTACACAGGATGG + Intergenic
991400200 5:66244040-66244062 CGGCCCTGGCCCACTCAGGAAGG - Intergenic
995146996 5:108797459-108797481 CAGCCAATGCCCACCCAGGAAGG - Intronic
996585945 5:125088646-125088668 CGGCCTTGGCCAACCCAGAAAGG - Intergenic
999282666 5:150375413-150375435 CGGCCCAGTGCCACCCGGGAAGG + Exonic
999723664 5:154417477-154417499 CTGCAATGTTCCCCCCAGGACGG - Exonic
1003179501 6:3779909-3779931 TTCCCATGTCCCACCCAGTAAGG - Intergenic
1004501838 6:16216765-16216787 CGGCCTTGGCCAGCCCAGGAAGG - Intergenic
1004861428 6:19807385-19807407 CGGCCTTGTCCAGCCCAGAAAGG + Intergenic
1007115251 6:39338884-39338906 GAGCCATCTCCCACCCAGGATGG + Intronic
1007268151 6:40612616-40612638 CTGCCTTGTCCCACCCATCAGGG + Intergenic
1012169814 6:96003103-96003125 TGGCCAGGTCCCACTCACGAAGG + Intergenic
1016255993 6:142106097-142106119 TAGCCATGTGGCACCCAGGAAGG + Intergenic
1019287107 7:229094-229116 GGGAAATGTCCCACCCAGGAGGG + Exonic
1019749359 7:2719072-2719094 CGGCCACCACCCACCCAGAAGGG - Intronic
1022226979 7:28373210-28373232 GGGGCATGTCCCTCCCATGACGG + Intronic
1025208999 7:57009903-57009925 CGGCCCCTCCCCACCCAGGAGGG + Intergenic
1025662950 7:63566953-63566975 CGGCCCCTCCCCACCCAGGAGGG - Intergenic
1026997565 7:74628199-74628221 AGCCCATGCCCCACCCCGGAGGG - Intergenic
1028303347 7:89229145-89229167 CGGCCTTGGCCAGCCCAGGAAGG + Intronic
1028822266 7:95226008-95226030 TGGCCATGTCGCTGCCAGGAAGG - Exonic
1032985421 7:137331735-137331757 CTGCCTGGTCCCACCCAGGTTGG - Intronic
1034967167 7:155398566-155398588 CGGCCTTGGCCAGCCCAGGAAGG + Intergenic
1035494522 7:159311515-159311537 TAGCCATGTGGCACCCAGGAGGG - Intergenic
1035727174 8:1831885-1831907 CGGCCATGTGCCACCCTCCAGGG - Intronic
1037597065 8:20363205-20363227 TCGCCATGTCTCACCCAGGCTGG + Intergenic
1039249898 8:35651174-35651196 GGAACATGTCCCACCCAGAATGG - Intronic
1046637219 8:116683353-116683375 CGGCCATCTGCAAGCCAGGAAGG - Intronic
1049799322 8:144510474-144510496 CAGCAAGGTCCCACCCAGGGAGG - Exonic
1052313380 9:27092597-27092619 CGGCCTTGGCCAGCCCAGGAGGG - Intergenic
1053940150 9:43239708-43239730 GGACCATGTCCCACCCAGAATGG - Intergenic
1058037666 9:100270777-100270799 CGGGCATGTACCACCAAGGCTGG - Intronic
1060822345 9:126668838-126668860 CTGCCAAGCACCACCCAGGAGGG - Intronic
1061370308 9:130194030-130194052 GGGCCAGGTCCGCCCCAGGAGGG + Intronic
1062238825 9:135525254-135525276 GGGGCATCTCCCACCCAGGTAGG - Intronic
1062250836 9:135592733-135592755 CCTCCTTGTCCCTCCCAGGAAGG - Intergenic
1062688380 9:137828054-137828076 CGTCCACGTCCCTCCCACGATGG - Intronic
1203744974 Un_GL000218v1:36569-36591 CCTCCTTGTCCCACCCTGGAGGG - Intergenic
1203565132 Un_KI270744v1:82915-82937 CCTCCTTGTCCCACCCTGGAGGG + Intergenic
1203624141 Un_KI270749v1:154328-154350 GGACCATGTCCCACCCAGAATGG - Intergenic
1186839763 X:13473754-13473776 CAGCCATGTCCCTCCCTGTACGG - Intergenic
1188390788 X:29616631-29616653 CATCCATGTCCCTACCAGGAGGG + Intronic
1189896890 X:45665186-45665208 CGGCCTTGGCCAGCCCAGGAAGG + Intergenic
1199483649 X:148325363-148325385 CGGCTCTGTCCCACGGAGGATGG + Intergenic
1201158309 Y:11151608-11151630 CCTCCTTGTCCCACCCTGGAGGG - Intergenic