ID: 1162727136

View in Genome Browser
Species Human (GRCh38)
Location 19:12696451-12696473
Sequence GTTCTCAGTCCGCCAAAATC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 55}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162727136_1162727139 -9 Left 1162727136 19:12696451-12696473 CCGGATTTTGGCGGACTGAGAAC 0: 1
1: 0
2: 0
3: 12
4: 55
Right 1162727139 19:12696465-12696487 ACTGAGAACGCGGGCCACGTAGG 0: 1
1: 0
2: 0
3: 3
4: 29
1162727136_1162727140 -3 Left 1162727136 19:12696451-12696473 CCGGATTTTGGCGGACTGAGAAC 0: 1
1: 0
2: 0
3: 12
4: 55
Right 1162727140 19:12696471-12696493 AACGCGGGCCACGTAGGCCTTGG 0: 1
1: 0
2: 0
3: 4
4: 25
1162727136_1162727142 10 Left 1162727136 19:12696451-12696473 CCGGATTTTGGCGGACTGAGAAC 0: 1
1: 0
2: 0
3: 12
4: 55
Right 1162727142 19:12696484-12696506 TAGGCCTTGGCCTGCGCGTCTGG 0: 1
1: 0
2: 0
3: 1
4: 66
1162727136_1162727147 29 Left 1162727136 19:12696451-12696473 CCGGATTTTGGCGGACTGAGAAC 0: 1
1: 0
2: 0
3: 12
4: 55
Right 1162727147 19:12696503-12696525 CTGGGTCTGTCTCTGACTCTGGG 0: 1
1: 0
2: 3
3: 58
4: 450
1162727136_1162727143 11 Left 1162727136 19:12696451-12696473 CCGGATTTTGGCGGACTGAGAAC 0: 1
1: 0
2: 0
3: 12
4: 55
Right 1162727143 19:12696485-12696507 AGGCCTTGGCCTGCGCGTCTGGG 0: 1
1: 0
2: 0
3: 7
4: 89
1162727136_1162727146 28 Left 1162727136 19:12696451-12696473 CCGGATTTTGGCGGACTGAGAAC 0: 1
1: 0
2: 0
3: 12
4: 55
Right 1162727146 19:12696502-12696524 TCTGGGTCTGTCTCTGACTCTGG 0: 1
1: 0
2: 2
3: 56
4: 543

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162727136 Original CRISPR GTTCTCAGTCCGCCAAAATC CGG (reversed) Exonic
902116819 1:14128118-14128140 GTGCTCAGTCTGTGAAAATCAGG + Intergenic
904884427 1:33725632-33725654 GATCCCAGCCTGCCAAAATCTGG - Intronic
912228751 1:107767544-107767566 GTCCTCATTCGGCCAAAATCAGG + Intronic
920599612 1:207310808-207310830 GTTTTCAGTGAGCCAAGATCGGG - Intergenic
924197966 1:241628454-241628476 ATCCTCAGTCCCCCAAGATCTGG + Intronic
1063604026 10:7507381-7507403 CTTCTTAGTCTGCCACAATCTGG - Intergenic
1065295449 10:24270061-24270083 GTTCTCAGTCCACCCAAGTCTGG + Intronic
1072489151 10:95886752-95886774 GGTCTCAGTGGGCTAAAATCAGG - Intronic
1074667816 10:115751303-115751325 GTTCTCAGGGAGCTAAAATCAGG - Intronic
1076227519 10:128792177-128792199 GTGCTCAGGCCCCCAAAACCTGG - Intergenic
1076637215 10:131889919-131889941 TTTCTCAGTCTGCAAACATCAGG + Intergenic
1088584558 11:111351118-111351140 GTACTCTCTCCTCCAAAATCTGG + Intergenic
1091848910 12:3679359-3679381 GTTCTCAGTCCCTTAACATCTGG + Intronic
1092201861 12:6589702-6589724 GGTTGCAGTCAGCCAAAATCAGG + Intronic
1104534725 12:129608369-129608391 GTTTTCAGTCTGCAAAAATGAGG + Intronic
1112147544 13:96717926-96717948 GTCCTCAGTGCGCGAAAATCTGG - Intronic
1128957160 15:71960316-71960338 GTTCTGAATTCACCAAAATCTGG + Intronic
1133293234 16:4736470-4736492 CTTCTCAGTGCACCATAATCCGG - Exonic
1139732669 16:68959997-68960019 CTTCTCTGTCCGCCAAATTTAGG - Intronic
1141000103 16:80299870-80299892 GAACTCAGTCCTCCAAAAGCAGG + Intergenic
1141604407 16:85144745-85144767 GCTCTCACTGGGCCAAAATCCGG + Intergenic
1141718807 16:85743333-85743355 GTTTTCAGTGTGCCAAATTCTGG + Intronic
1150948935 17:69780016-69780038 GTTCTCAGGCCTTCGAAATCAGG - Intergenic
1155511190 18:26579051-26579073 TTTTTCAGTCCGCCAAATACTGG + Intronic
1162727136 19:12696451-12696473 GTTCTCAGTCCGCCAAAATCCGG - Exonic
1165408170 19:35643117-35643139 GTTCTCAGTCCTCAAAGATCAGG - Intronic
1165700381 19:37932856-37932878 TTTCTCAGTCCGTCAACACCCGG - Intronic
947988364 2:234467695-234467717 GTTCTCAGTCCCCCAACACTAGG + Intergenic
1169603151 20:7285462-7285484 GTTCTCAGTCTGCCAAATAATGG + Intergenic
1176157561 20:63629552-63629574 AGCCTCACTCCGCCAAAATCAGG + Intergenic
1177359857 21:20054502-20054524 GTTCTCAGTCTGCCATACTTGGG - Intergenic
1177750372 21:25275346-25275368 CTTCTCAGTTCTCCAAAATTTGG - Intergenic
1184127028 22:42494691-42494713 GTCCTCAGTCCTCCAAAGTCTGG - Intergenic
949471870 3:4404964-4404986 TTTCTCAGTCTGGCAAAAACCGG - Intronic
949696199 3:6699152-6699174 TTTCTCAATCCACCAAAATCAGG + Intergenic
957454838 3:80428213-80428235 GTTCTCAGACCTCCAAATTCTGG - Intergenic
959131241 3:102358786-102358808 GTTTGCAGTGAGCCAAAATCAGG - Intronic
964549697 3:157873023-157873045 GTTGTCAGTCAGCCAAGATGTGG + Intergenic
968015781 3:195331392-195331414 GTTCTCAGTGAGCCAAGATCGGG - Intronic
970736773 4:19179677-19179699 GTTCTCTGTCCTACAAATTCCGG - Intergenic
976376610 4:84352793-84352815 GTTCTCAGCCCGCCATACTCTGG - Intergenic
994663335 5:102679371-102679393 GTTATCAGTCCTCTAAAAGCTGG - Intergenic
997639276 5:135437973-135437995 GGTCTCAGACAGCCAAAGTCTGG - Intergenic
1003183579 6:3811807-3811829 CTTCCCAGTCCGCCAATATGTGG - Intergenic
1005366596 6:25084359-25084381 GTTCTCAGTCCCGCAAAAGTCGG + Intergenic
1005622448 6:27632525-27632547 GTTCTCAGGCCTTCAAAATCTGG - Intergenic
1005651802 6:27892023-27892045 GCTGTCAGTCCGCCAAATACAGG + Intronic
1006269818 6:32955583-32955605 CTTCTCAGCCCACCACAATCTGG - Intronic
1006454932 6:34126260-34126282 GTTCTCAGTTCTGCAAAATAGGG + Intronic
1007754335 6:44089218-44089240 GATCTCTGTCCGCCAACATAAGG - Intergenic
1011738933 6:90340076-90340098 GTTCTCAGGCCTCCACAATTGGG + Intergenic
1018012440 6:159683832-159683854 GTTCAGATTCTGCCAAAATCTGG + Intronic
1018014517 6:159699888-159699910 GTTCTCAGTGGACCACAATCTGG - Intronic
1023329238 7:39096586-39096608 GTTCTGATTCAGCCAAAATGGGG + Intronic
1023951389 7:44848615-44848637 GTAGTCAGTCCGCCAGAATACGG - Intergenic
1028335603 7:89650584-89650606 GTTTTCATTTCCCCAAAATCTGG + Intergenic
1028625216 7:92870100-92870122 CTTCTCAGCCTCCCAAAATCTGG - Intergenic
1036595479 8:10207976-10207998 GTTCTCAGGGCTTCAAAATCTGG + Intronic
1040982498 8:53257886-53257908 GTGCTCAGTCCCCCAAAATTTGG + Intergenic
1041131735 8:54709106-54709128 ATTCTCAGTCCTCCACAATGGGG - Intergenic
1046603988 8:116350421-116350443 ATGCTCAGTCTGCCAAAATTTGG + Intergenic
1057487688 9:95498900-95498922 CTTCAGAGTCGGCCAAAATCTGG + Intronic
1059282276 9:113145138-113145160 GTTCTCTGTCCTGCAAAACCCGG + Intergenic
1059845845 9:118275855-118275877 GTTTGCAGTGAGCCAAAATCAGG - Intergenic
1060377329 9:123128366-123128388 GTTCTCATTCATCCAACATCTGG - Intronic
1060989748 9:127841612-127841634 GTGCTCAGACCACCAATATCGGG - Intronic
1192785649 X:74332365-74332387 GTTCTCAGTCATGCCAAATCAGG + Intergenic
1200175853 X:154115749-154115771 TTTCTCAGTGCGCCAAACTCAGG - Intergenic