ID: 1162727911

View in Genome Browser
Species Human (GRCh38)
Location 19:12701030-12701052
Sequence CTACAAACGGGGAGGTGGGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 299
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 276}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162727911_1162727934 24 Left 1162727911 19:12701030-12701052 CCCCCCCACCTCCCCGTTTGTAG 0: 1
1: 0
2: 0
3: 22
4: 276
Right 1162727934 19:12701077-12701099 CTGCCAGGAGGGCAAGTGGACGG 0: 1
1: 0
2: 3
3: 47
4: 401
1162727911_1162727925 12 Left 1162727911 19:12701030-12701052 CCCCCCCACCTCCCCGTTTGTAG 0: 1
1: 0
2: 0
3: 22
4: 276
Right 1162727925 19:12701065-12701087 GGCCCCACCCACCTGCCAGGAGG 0: 1
1: 0
2: 9
3: 61
4: 533
1162727911_1162727924 9 Left 1162727911 19:12701030-12701052 CCCCCCCACCTCCCCGTTTGTAG 0: 1
1: 0
2: 0
3: 22
4: 276
Right 1162727924 19:12701062-12701084 GGTGGCCCCACCCACCTGCCAGG 0: 1
1: 1
2: 4
3: 44
4: 372
1162727911_1162727932 20 Left 1162727911 19:12701030-12701052 CCCCCCCACCTCCCCGTTTGTAG 0: 1
1: 0
2: 0
3: 22
4: 276
Right 1162727932 19:12701073-12701095 CCACCTGCCAGGAGGGCAAGTGG 0: 1
1: 0
2: 2
3: 37
4: 342
1162727911_1162727923 -9 Left 1162727911 19:12701030-12701052 CCCCCCCACCTCCCCGTTTGTAG 0: 1
1: 0
2: 0
3: 22
4: 276
Right 1162727923 19:12701044-12701066 CGTTTGTAGGATGAGCATGGTGG 0: 1
1: 0
2: 0
3: 17
4: 264
1162727911_1162727936 28 Left 1162727911 19:12701030-12701052 CCCCCCCACCTCCCCGTTTGTAG 0: 1
1: 0
2: 0
3: 22
4: 276
Right 1162727936 19:12701081-12701103 CAGGAGGGCAAGTGGACGGATGG 0: 1
1: 0
2: 4
3: 24
4: 356
1162727911_1162727926 13 Left 1162727911 19:12701030-12701052 CCCCCCCACCTCCCCGTTTGTAG 0: 1
1: 0
2: 0
3: 22
4: 276
Right 1162727926 19:12701066-12701088 GCCCCACCCACCTGCCAGGAGGG 0: 1
1: 0
2: 6
3: 60
4: 384

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162727911 Original CRISPR CTACAAACGGGGAGGTGGGG GGG (reversed) Exonic
900143619 1:1148826-1148848 CTACAAATGGGGACGAGGTGTGG + Intergenic
900541423 1:3204924-3204946 CTCCGAACGGGGAGCTGGGAAGG + Intronic
901052115 1:6430482-6430504 GGACAGACGGGGAGGTGTGGGGG - Intronic
901765394 1:11496768-11496790 CTGCAGACTGGGAGGTGGGAAGG + Intronic
902428178 1:16341516-16341538 CTTGAACCTGGGAGGTGGGGAGG + Intronic
902590444 1:17470035-17470057 CTTGAACCTGGGAGGTGGGGCGG + Intergenic
902925325 1:19692250-19692272 CTCCATAGGGGGAGGCGGGGAGG - Intronic
902973197 1:20070245-20070267 GGACAAACCCGGAGGTGGGGAGG - Exonic
903218344 1:21855199-21855221 CCACAGAGGAGGAGGTGGGGTGG + Intronic
906232936 1:44180905-44180927 CTCGAAGCGGGGAGGAGGGGAGG + Intergenic
907085485 1:51668731-51668753 CTCCAAACTGGGGGGTGGGCAGG - Intronic
907472749 1:54685096-54685118 CTGCAACCCGGGAGGTGGAGGGG - Intronic
907722353 1:56983796-56983818 GTCCAAACGGGGAGTTGGAGAGG - Intergenic
908611764 1:65868921-65868943 CCACAGACGGGGTGGTGGGAGGG - Intronic
910468872 1:87529318-87529340 CTGCTCACGGGGAGGTGTGGAGG - Intergenic
910758907 1:90717034-90717056 CTCCGAACAGGGAGATGGGGTGG + Exonic
911203072 1:95066121-95066143 CAACAATAAGGGAGGTGGGGTGG - Intronic
912069830 1:105795887-105795909 CTGCTCACGGGGAGGTGTGGAGG + Intergenic
912433443 1:109641904-109641926 CTACTAGAGGGGAGGTGGTGGGG + Intergenic
913608682 1:120490103-120490125 CAGCACACAGGGAGGTGGGGAGG - Intergenic
913986748 1:143572573-143572595 CAGCACACAGGGAGGTGGGGAGG + Intergenic
914205149 1:145520348-145520370 CAGCACACAGGGAGGTGGGGAGG + Intergenic
914582515 1:149031735-149031757 CAGCACACAGGGAGGTGGGGAGG + Intronic
914721750 1:150294962-150294984 TTAAAAGCGGGGAGGTGCGGGGG - Intronic
917932041 1:179829169-179829191 CTCCAAGCGGGGAGATGAGGTGG + Intergenic
918843766 1:189582430-189582452 CTAAAGGCGGGGAGGTGGGGGGG - Intergenic
920092469 1:203464348-203464370 GAAAAAAAGGGGAGGTGGGGAGG - Intergenic
921665526 1:217866328-217866350 CTTCACACAGGTAGGTGGGGTGG - Intronic
921705535 1:218318769-218318791 TTTCTAACTGGGAGGTGGGGAGG - Intronic
922201382 1:223404420-223404442 CATCCAATGGGGAGGTGGGGAGG - Intergenic
1063774008 10:9239455-9239477 TCACAAACGGGGAGGTGGAAGGG - Intergenic
1064288233 10:14011338-14011360 CCACAAAGGGGGAGGCAGGGAGG + Intronic
1064702764 10:18038566-18038588 CTTGAACCTGGGAGGTGGGGAGG + Intronic
1068988985 10:63132228-63132250 CTAAAGGCGGGGAGGTCGGGTGG - Intergenic
1069190406 10:65480167-65480189 AAACAAGAGGGGAGGTGGGGTGG + Intergenic
1069957050 10:72058382-72058404 CTTGAACCTGGGAGGTGGGGTGG + Intergenic
1072016273 10:91349843-91349865 CTTAAAAGGGGAAGGTGGGGTGG - Intergenic
1072483837 10:95835089-95835111 CCAAAAGAGGGGAGGTGGGGAGG - Intronic
1072561137 10:96575451-96575473 CTATAAACGGGGGGATGGGGAGG + Intronic
1075051274 10:119184017-119184039 CAACAAAAGGGGAGGGGGGAGGG + Intergenic
1075801333 10:125155755-125155777 CTTCAAAAGATGAGGTGGGGAGG + Intronic
1075906850 10:126089051-126089073 CTGCCAACTGGGAGTTGGGGCGG - Intronic
1076064975 10:127441692-127441714 CTACAGTGGGGGTGGTGGGGGGG - Intronic
1083276447 11:61599700-61599722 CTACAGACGGGGAGGGGAGGAGG + Intergenic
1085080938 11:73633703-73633725 CTACAAAAGGGTAGGAGGGGAGG - Intergenic
1087236041 11:95719746-95719768 CAACAAATGGGGAACTGGGGTGG - Intergenic
1087762803 11:102120282-102120304 ATATTAAAGGGGAGGTGGGGAGG - Intronic
1088056883 11:105593627-105593649 GTAAAAAAGGGGAGGTTGGGAGG - Intergenic
1089296729 11:117473670-117473692 CTACAGATGGGGAGCTGGGCCGG - Intronic
1089334361 11:117712968-117712990 CTGCAAAAGGGGAGTTGGGAAGG - Intronic
1089875656 11:121719232-121719254 ATCCAAACAGGGAGGTGGGAGGG + Intergenic
1091390592 12:123858-123880 ATAAAAATGGGGAGGTTGGGAGG + Intronic
1091527916 12:1323972-1323994 CTAATAACAGGGAGGTGGGAGGG - Intronic
1091750685 12:3019687-3019709 CTACAGAGTGGGAGGTGGTGAGG - Intronic
1091754075 12:3040518-3040540 CAGGAAACGGGGACGTGGGGAGG + Exonic
1091966472 12:4746452-4746474 ATATAATCTGGGAGGTGGGGTGG + Intronic
1091974405 12:4812960-4812982 AAACAAAAGGGGAGGTGGGCAGG - Exonic
1094746081 12:33345990-33346012 CTACAATGGGGGAAGTGAGGAGG - Intergenic
1095876142 12:47080864-47080886 CAAAAGACGGGGAGGTGGCGGGG - Intronic
1100701612 12:97154610-97154632 CTAAAAAGTGGGAGGTGAGGTGG - Intergenic
1101352579 12:103945769-103945791 CTTTTAACGGGGAGGTGGGGTGG - Intronic
1101940308 12:109094964-109094986 AAAAAAGCGGGGAGGTGGGGGGG - Intergenic
1103633894 12:122286433-122286455 CTTGAACCTGGGAGGTGGGGAGG + Intronic
1103720730 12:122974096-122974118 CTGCAAACGGAGAGGGGGTGAGG + Intronic
1105587635 13:21759725-21759747 GTACAAAGAGGGAGGTGCGGTGG - Intergenic
1108118644 13:47159941-47159963 CTTCAATCGGGGAGGCGGGGAGG + Intergenic
1109299921 13:60580340-60580362 CTAAAGATGGGGAGGTAGGGAGG + Intergenic
1111838732 13:93423050-93423072 TAACAAACGGGGAGCTGGTGGGG - Intronic
1113393919 13:109926164-109926186 ATACAAGAGGGGAGGTGAGGAGG - Intergenic
1113926979 13:113947087-113947109 CTACAGAAGGTGAGGTGGAGCGG + Intergenic
1114285924 14:21243095-21243117 CTCAAAAAGGAGAGGTGGGGGGG + Intronic
1115149830 14:30271510-30271532 TTACAAAAGGGGAGGGGGAGGGG + Intergenic
1115794280 14:36915728-36915750 TTACTAAAGGGGAGATGGGGTGG - Intronic
1116436124 14:44897244-44897266 CTGAAAACGGGGGGGTTGGGGGG + Intergenic
1116891694 14:50274956-50274978 CTACAGACTGGGAGGGGGGTGGG + Intronic
1117150922 14:52887217-52887239 CTTGAACCCGGGAGGTGGGGAGG - Intronic
1118026452 14:61773787-61773809 CTTGAACCTGGGAGGTGGGGAGG - Intronic
1118767402 14:68919079-68919101 CTACCAAAGGGGAGGAGGGCAGG - Intronic
1119163035 14:72469286-72469308 CTTGAACCCGGGAGGTGGGGAGG - Intronic
1119703782 14:76771781-76771803 CTACACACGGGGTGGCGGGATGG - Intronic
1119780831 14:77275897-77275919 CTACCTACTGGGTGGTGGGGAGG - Exonic
1122281822 14:100628045-100628067 ACACACACGGGGTGGTGGGGTGG + Intergenic
1123054078 14:105561058-105561080 GTGCAAATGGGGAGGTGGTGGGG - Intergenic
1123462295 15:20484157-20484179 CTACCTACGGGGAAATGGGGAGG + Intergenic
1123655764 15:22516237-22516259 CTACCTACGGGGAAATGGGGAGG - Intergenic
1124272984 15:28300155-28300177 CTACCTACGGGGAAATGGGGAGG + Intronic
1124309674 15:28611414-28611436 CTACCTACGGGGAAATGGGGAGG - Intergenic
1124418171 15:29491255-29491277 CTGCTTACGGGGAGGTGTGGAGG - Intronic
1124534149 15:30530172-30530194 CAAAAAACGGGGCGGGGGGGGGG - Intergenic
1124988816 15:34650328-34650350 CAACACATGGGGAGGTGGTGTGG + Intergenic
1126142376 15:45448835-45448857 CTCTAAATGGGGAGGTGGGGAGG - Intergenic
1127191214 15:56532562-56532584 TTAAAAACAGGGAGGTGGGATGG - Intergenic
1127650105 15:60998791-60998813 CTACAGAGGGGTAGGTGGGTGGG - Intronic
1127826329 15:62707220-62707242 CCACAAGCTGGGAGGTGGAGAGG - Exonic
1129269057 15:74409938-74409960 CTACATGCGGGGGGGTGGGTGGG - Exonic
1129539475 15:76338927-76338949 CTCCAAACTGGGAGCTGGGCAGG + Intronic
1131260467 15:90884919-90884941 CTGCAGACGGGGAGGAGGTGGGG - Intronic
1132030086 15:98432127-98432149 CTACAAGGGGGCAGGTGTGGTGG - Intergenic
1132409792 15:101568085-101568107 GTAGAGACGGGGCGGTGGGGGGG + Intergenic
1132465661 16:76357-76379 CCACAAACCAGGAAGTGGGGGGG + Intergenic
1134390603 16:13816605-13816627 GTACATACTGGGTGGTGGGGTGG - Intergenic
1134566158 16:15253549-15253571 CAAGAAACTGGGAGGAGGGGTGG + Intergenic
1134736335 16:16503149-16503171 CAAGAAACTGGGAGGAGGGGTGG - Intergenic
1135597280 16:23754512-23754534 CCAAAGACGGGGAAGTGGGGAGG - Intergenic
1135702408 16:24643711-24643733 CTACTAATGGGGCGGCGGGGAGG - Intergenic
1135771993 16:25224689-25224711 CTGCAAATGGGGAGGGGGGCTGG + Intronic
1136367071 16:29813789-29813811 CTGCCAACTGGGAGCTGGGGTGG - Exonic
1136528504 16:30849440-30849462 CAAAAAACGGGGATGTGGAGTGG - Intronic
1137282805 16:46992557-46992579 CCACCAACGTGGAAGTGGGGGGG + Intergenic
1137446705 16:48536448-48536470 CTAGAAGCAGGGAGGAGGGGAGG + Intergenic
1137597645 16:49735468-49735490 CTGCAGAAGGGCAGGTGGGGTGG - Intronic
1140455650 16:75103987-75104009 ATAAAAGCGGGGTGGTGGGGGGG + Intronic
1140498575 16:75412097-75412119 CTTTAACCTGGGAGGTGGGGAGG - Intronic
1140790499 16:78386629-78386651 CTACAGGCTGGGGGGTGGGGCGG - Intronic
1140980577 16:80105089-80105111 CTGAAAACAGGGAGGTGGTGTGG - Intergenic
1141080996 16:81052320-81052342 CTAAAAGTGGGGAGGTGGGAAGG + Intergenic
1141720213 16:85751500-85751522 CTGCAGACGGCGAGATGGGGCGG - Intergenic
1141838634 16:86559870-86559892 GGAGAAAGGGGGAGGTGGGGGGG + Intergenic
1141980246 16:87545712-87545734 CAACACACGGCCAGGTGGGGTGG + Intergenic
1142403756 16:89874308-89874330 CTAAAGACGGGGGGGTGGCGAGG + Intronic
1142720603 17:1773325-1773347 CTTGAACCTGGGAGGTGGGGAGG - Intronic
1142992068 17:3738173-3738195 CCAAAAACGGGGAGGGGGGGAGG - Intronic
1143124923 17:4635924-4635946 CAAGAAAAGGGGAGGTGGTGGGG + Exonic
1143561781 17:7700856-7700878 CTTGAAACTGGGTGGTGGGGCGG - Intronic
1146054532 17:29574513-29574535 CTAAGGATGGGGAGGTGGGGGGG - Exonic
1146884765 17:36463757-36463779 CTACCTATGGGGTGGTGGGGGGG - Intergenic
1147755305 17:42763301-42763323 CTGCAACTGGGGAGGTGTGGGGG + Intergenic
1148214687 17:45828013-45828035 CTAGAAACGGGGAGGAAGGGAGG + Intronic
1148243699 17:46016453-46016475 CTACACAGTGTGAGGTGGGGAGG - Intronic
1148486014 17:47991424-47991446 CAATAAAAGGGGAGGTGGGGTGG + Intergenic
1149569909 17:57665070-57665092 CCTCTAACTGGGAGGTGGGGAGG + Intronic
1151161864 17:72172654-72172676 CCCCAAACAGGGAGGTCGGGGGG + Intergenic
1151790441 17:76302301-76302323 CTACAGAGGTGGGGGTGGGGTGG - Intronic
1152362849 17:79840347-79840369 CTAGAAACAGGGAGCTGGGAGGG + Intergenic
1152645402 17:81466440-81466462 CAACACAGGGGGCGGTGGGGAGG - Intergenic
1155463523 18:26110194-26110216 CTTCATACGGTGAGTTGGGGAGG + Intergenic
1155967018 18:32045475-32045497 CTTGAACCCGGGAGGTGGGGAGG + Intronic
1156651907 18:39235325-39235347 CTGCTCACGGGGAGGTGTGGAGG + Intergenic
1159346737 18:67215871-67215893 CTGCTAGCGGGGAGGTGTGGAGG - Intergenic
1161510731 19:4669844-4669866 CTCCAGACGCAGAGGTGGGGAGG - Intronic
1161678264 19:5665426-5665448 CTACAAAGGGTGCGGTGGTGGGG + Intronic
1161794484 19:6378558-6378580 CCACAATCGGGGCAGTGGGGGGG + Intronic
1162727911 19:12701030-12701052 CTACAAACGGGGAGGTGGGGGGG - Exonic
1162836740 19:13324455-13324477 CAAAAAACGGTGAGGTGGTGAGG + Intronic
1165041920 19:33074538-33074560 CTTGAACCTGGGAGGTGGGGAGG + Intergenic
1167311758 19:48741093-48741115 TCACAAAGGGGGAGGTTGGGAGG - Intronic
926931698 2:18047567-18047589 CTACAAAGTGACAGGTGGGGAGG - Intronic
927491196 2:23522230-23522252 CTTGAACCTGGGAGGTGGGGAGG - Intronic
928623161 2:33111630-33111652 ACAGAAACGGGGAGGTGGAGTGG - Intronic
928793825 2:34992028-34992050 CTGCTCACGGGGAGGTGTGGAGG + Intergenic
928856530 2:35809191-35809213 CTACAAACTGAGGGTTGGGGAGG - Intergenic
929584599 2:43105893-43105915 CAAGAAAGGGGGAGGTGGGGAGG - Intergenic
936886461 2:117317131-117317153 CTTCAAACGTGAAGGTGGGTTGG + Intergenic
938083007 2:128380273-128380295 CCACATCCGGGGAGGTCGGGAGG - Intergenic
938177220 2:129144622-129144644 CTGCTAGCGGGGAGGTGTGGAGG - Intergenic
938960434 2:136335846-136335868 CTACAGACGGGGTGAGGGGGTGG - Intergenic
939629927 2:144517947-144517969 CTCCAAAAGGGGAGGGGAGGGGG - Intronic
940436752 2:153665482-153665504 CTAGATAGGGGGAGGTGGTGGGG - Intergenic
941951421 2:171160580-171160602 CGAGAAGAGGGGAGGTGGGGAGG + Exonic
942708016 2:178799316-178799338 ATACAAACGGGCAGGTTGTGGGG - Intronic
943659889 2:190547948-190547970 ATAAAAAAGGAGAGGTGGGGTGG + Intergenic
945193601 2:207216554-207216576 CCACAAACGTGGGGGTGGAGTGG + Intergenic
1169478097 20:5950439-5950461 CGACAACCGAGGAGGAGGGGCGG - Exonic
1170368225 20:15619878-15619900 CAACCAACTGAGAGGTGGGGAGG + Intronic
1174312127 20:49665412-49665434 CTCAAAAAGGGGGGGTGGGGGGG + Intronic
1175903605 20:62369376-62369398 CTACACACAGGGGGTTGGGGAGG + Intergenic
1176130261 20:63493810-63493832 CCACAAACAGGGAGCAGGGGAGG + Intronic
1178856480 21:36254448-36254470 TTACAAAAGAGCAGGTGGGGAGG + Intronic
1178981648 21:37269603-37269625 GTACAGATGGGGAGGTCGGGTGG + Intergenic
1179543103 21:42096747-42096769 CTGCAAACAGGAAAGTGGGGCGG - Intronic
1184948911 22:47825853-47825875 TTACAAAAGGGGAGTTGGGTTGG - Intergenic
1185052469 22:48561056-48561078 CTTCAAGCTGGGAGGTGGGTGGG + Intronic
952558704 3:34563643-34563665 CTAAAAATGGGGAGGAAGGGAGG + Intergenic
954302100 3:49705517-49705539 CTTCAACTGGGGAGTTGGGGAGG - Exonic
956762927 3:72459475-72459497 CTACAAATGGGGCTGTGGGAAGG + Intergenic
958141718 3:89570914-89570936 CCAGTCACGGGGAGGTGGGGGGG + Intergenic
961685207 3:128625171-128625193 TCACCAAGGGGGAGGTGGGGAGG + Intronic
963127411 3:141828066-141828088 CGAAAGATGGGGAGGTGGGGTGG - Intergenic
964876852 3:161377122-161377144 CCACAGACAGGGAGGTGGGGAGG - Intergenic
966593907 3:181710352-181710374 CTACAAAGGGTGGGGTGGGGGGG - Intergenic
968152455 3:196347854-196347876 CTTGAAACGGGGAGGGTGGGGGG - Exonic
968221993 3:196946571-196946593 CAACAGACTGGGAAGTGGGGTGG + Exonic
969232815 4:5843338-5843360 CTACAAAGGGGAAGGTGGATGGG - Intronic
969442250 4:7224326-7224348 CACCAAACAGGGAGGTGGAGTGG + Intronic
969720714 4:8891963-8891985 CTGCAAACGCCGAGCTGGGGAGG - Intergenic
969918244 4:10511069-10511091 CTTGAAGCCGGGAGGTGGGGCGG + Intronic
971813104 4:31453067-31453089 CTACAAAGGGCCAGGTGTGGTGG - Intergenic
973971424 4:56217416-56217438 CCAGAAAGGGGGAGGTGGGGTGG + Intronic
974187975 4:58465100-58465122 CTGCAAGCGGGGAGGTGTGGAGG + Intergenic
974474888 4:62365844-62365866 CTACACATGGGAAGGTTGGGAGG + Intergenic
976022993 4:80653286-80653308 CTAAAAATGGAGAGGTGAGGAGG - Intronic
976399527 4:84592251-84592273 CTTGAAACGGGGAGCGGGGGAGG - Intronic
976512000 4:85921911-85921933 CCACAAATGGGGTGGTGGGGGGG - Intronic
977432746 4:96952796-96952818 GTACACAGGTGGAGGTGGGGTGG + Intergenic
978130921 4:105196308-105196330 CTTCAAGTGGTGAGGTGGGGAGG - Intronic
979406098 4:120312188-120312210 CTACAAACAGAGAAGTGGGAAGG - Intergenic
979431013 4:120630884-120630906 GTACAGATGGGGAGGCGGGGAGG - Intergenic
980052512 4:128052643-128052665 CTTGAACCGGGGAGGCGGGGTGG - Intergenic
980305547 4:131056222-131056244 CTCCAAAAGGGGAGTGGGGGAGG - Intergenic
981738486 4:147977808-147977830 CTCCAAAAGGGGAGGGGGAGGGG - Intronic
982065901 4:151654322-151654344 CTATAAGGGGTGAGGTGGGGGGG - Intronic
982630214 4:157821985-157822007 CTGCTCACGGGGAGGTGTGGAGG + Intergenic
982689501 4:158532079-158532101 TTCCAAAAGGGGAGGAGGGGGGG - Intronic
985269259 4:188178957-188178979 CTGCTTACGGGGAGGTGTGGAGG + Intergenic
985512437 5:320451-320473 CTACACCCGGGGAGGGGCGGTGG + Intronic
985972528 5:3389672-3389694 CTGCAGACTGGGAGGTGTGGAGG - Intergenic
986560102 5:9052038-9052060 CCAGAAAAGGGGAGATGGGGCGG + Intronic
987488863 5:18552078-18552100 CTACTTGCGGGGAGGTGTGGAGG - Intergenic
988349571 5:30084916-30084938 CTACTACTCGGGAGGTGGGGGGG - Intergenic
990227115 5:53667163-53667185 TTACAGAAGTGGAGGTGGGGAGG + Intronic
992967648 5:82019699-82019721 CTACAGATGGGGAGGGAGGGAGG + Intronic
996339222 5:122417729-122417751 GAATAAAAGGGGAGGTGGGGAGG - Intronic
996595544 5:125198234-125198256 CTAAAACTGGGGATGTGGGGCGG - Intergenic
996681149 5:126229082-126229104 CTGCTCACGGGGAGGTGTGGAGG + Intergenic
997904822 5:137806239-137806261 CAGCAAAGGCGGAGGTGGGGGGG - Intergenic
999184554 5:149696933-149696955 CCAAAAGCGGGGAGGAGGGGTGG + Intergenic
1000508010 5:162146076-162146098 CTACAAACTGGGAGTGGTGGTGG - Intronic
1001456521 5:171865423-171865445 CTAAAAACTGGGGGTTGGGGAGG + Intronic
1004657346 6:17676462-17676484 TTAATAACGGGAAGGTGGGGTGG - Intronic
1004811785 6:19270764-19270786 CTGCTCACGGGGAGGTGTGGAGG + Intergenic
1005674580 6:28140915-28140937 GTAGAAACGGGGTGGCGGGGCGG - Intergenic
1005829529 6:29659412-29659434 CTACAGGCATGGAGGTGGGGTGG + Exonic
1006710814 6:36068705-36068727 TTAAAAAGTGGGAGGTGGGGAGG + Intronic
1007013646 6:38441316-38441338 CTACAAATTTGGGGGTGGGGAGG + Intronic
1007078486 6:39082849-39082871 TGAGAAACGGGGACGTGGGGGGG - Intronic
1007234422 6:40380022-40380044 CTTCAAAGGGGGAAGTGGGAGGG - Intergenic
1009690900 6:67031059-67031081 CTGCTCACGGGGAGGTGTGGAGG + Intergenic
1013047766 6:106504725-106504747 ACACAAACGGAAAGGTGGGGAGG + Intergenic
1013700353 6:112761077-112761099 CTAAGACTGGGGAGGTGGGGGGG - Intergenic
1014029223 6:116681612-116681634 CGAGAAACGGTGAGGCGGGGCGG - Intronic
1016172966 6:141041930-141041952 CTACTTACAGGGAGGTGTGGAGG - Intergenic
1017011840 6:150068705-150068727 CTGCAGAGGGCGAGGTGGGGAGG - Intronic
1017075260 6:150612046-150612068 CTAGAAAAGGGGGGGGGGGGGGG - Intronic
1017368573 6:153676063-153676085 CCAAAAACGGGGAGGAAGGGAGG - Intergenic
1018254379 6:161903935-161903957 ATACAAACAGGGAGCTGGGGTGG + Intronic
1019061757 6:169262453-169262475 CTGGAAAGAGGGAGGTGGGGAGG - Intergenic
1019473210 7:1232125-1232147 CTACAAAGACAGAGGTGGGGGGG - Intergenic
1019767963 7:2865391-2865413 CCATAGCCGGGGAGGTGGGGAGG - Intergenic
1022578034 7:31517692-31517714 CTGCTAACGGTGAGGTGTGGAGG - Intronic
1022616564 7:31936984-31937006 CTCCAAATGGGCAGGTTGGGAGG + Intronic
1024354998 7:48405291-48405313 CTACAAATGCCAAGGTGGGGAGG + Intronic
1024387752 7:48773009-48773031 CTGCAAAGTGGGAGATGGGGAGG - Intergenic
1024531780 7:50399819-50399841 CTACAACCGGGGAGGGGAAGGGG - Intronic
1024838639 7:53556469-53556491 CTACAAATGAGGAGGTGGCATGG + Intergenic
1026312330 7:69197265-69197287 CTACAAAGGGCCAGGTGTGGTGG + Intergenic
1026360483 7:69598179-69598201 CTACAACTGGGGAGGGGGCGGGG + Intergenic
1028855137 7:95583069-95583091 CTACAAATCGGGGGCTGGGGTGG - Intergenic
1031322918 7:120355463-120355485 CTTGAACCTGGGAGGTGGGGGGG + Intronic
1031730912 7:125299532-125299554 CTGCTCACGGGGAGGTGTGGAGG - Intergenic
1032107878 7:129050080-129050102 TTAAAAAGGGTGAGGTGGGGTGG + Intronic
1033516367 7:142110810-142110832 CTAAGATGGGGGAGGTGGGGAGG - Intergenic
1035121694 7:156573516-156573538 CTAGAGAAAGGGAGGTGGGGAGG - Intergenic
1035214125 7:157351909-157351931 CTTGAACCCGGGAGGTGGGGAGG + Intronic
1035743777 8:1947209-1947231 GTACACAAGGGGAGGTGAGGAGG + Intronic
1036002486 8:4623557-4623579 CTAAAAACAGGGGGGTGAGGGGG + Intronic
1038098946 8:24350393-24350415 CTTGAAACTGGGAGGTGTGGAGG - Intronic
1038683346 8:29691826-29691848 CTATAAACTGGAAGGTGGGTTGG + Intergenic
1040329231 8:46377466-46377488 ATAAAAACGGGGAGGCAGGGTGG + Intergenic
1041167506 8:55103589-55103611 CTAAAAATGGGGAAGCGGGGAGG - Intronic
1041714815 8:60923334-60923356 TTGCAAACTGGGCGGTGGGGGGG + Intergenic
1044456037 8:92393931-92393953 CTGCTCACGGGGAGGTGTGGAGG - Intergenic
1045219582 8:100185394-100185416 CTATAAATTGGGAGGTGAGGTGG - Intronic
1045581284 8:103483191-103483213 CTTCAGTCGGGGAGTTGGGGAGG + Intergenic
1048063844 8:130948296-130948318 ATACAATCGGGTAGGTGGGATGG + Intronic
1048193379 8:132310480-132310502 CTACAGGAGGAGAGGTGGGGTGG + Intronic
1048194058 8:132317684-132317706 CTACAAGAGGAGAGGTGGGGTGG - Intronic
1049814733 8:144592873-144592895 CTGCACAGGGCGAGGTGGGGAGG + Intronic
1050377842 9:4991693-4991715 CTAGAAAAGGAGATGTGGGGTGG - Intronic
1051269965 9:15346010-15346032 CTAACAAGGGGGAGGTGTGGGGG - Intergenic
1053137576 9:35661054-35661076 CTACTTCCTGGGAGGTGGGGCGG + Exonic
1055960695 9:81817688-81817710 CTTGAAACTGGGAGGCGGGGGGG + Intergenic
1056404497 9:86260938-86260960 CTTGAACCTGGGAGGTGGGGAGG - Intergenic
1056715531 9:89025294-89025316 CTACAAGCCTGGAGGTGGGGTGG - Intronic
1057318103 9:93984567-93984589 TAAGAAAGGGGGAGGTGGGGAGG + Intergenic
1058065148 9:100540507-100540529 CTGCTAGCGGGGAGGTGGGGAGG - Intronic
1058337545 9:103850925-103850947 CTCCAAAAGTGGAGATGGGGAGG - Intergenic
1060215897 9:121738027-121738049 CTTCCAACCTGGAGGTGGGGAGG + Intronic
1061237213 9:129350142-129350164 AGATAAACGGGGAGGGGGGGCGG + Intergenic
1061370021 9:130192876-130192898 CCGCACACTGGGAGGTGGGGAGG - Intronic
1061591337 9:131599626-131599648 CCACAAAGGGGAAGGTGGGACGG + Intronic
1185872035 X:3672680-3672702 CCACAAACTGGGGGTTGGGGTGG + Intronic
1186366156 X:8895828-8895850 CCACAAACTGTGAGGTGGTGTGG - Intergenic
1187158953 X:16746667-16746689 CTTGAACCTGGGAGGTGGGGAGG - Intronic
1187509636 X:19906037-19906059 AAAAAAACGGGGAGGGGGGGCGG + Intergenic
1187940445 X:24375855-24375877 CCACAGACAGGGAAGTGGGGAGG + Intergenic
1189344199 X:40228157-40228179 CCACAGACAGGGAGGTGGGGTGG + Intergenic
1189786911 X:44567156-44567178 CTACATACGGGGAAGGGTGGAGG + Intergenic
1190658064 X:52629532-52629554 CTTGAACCGGGGAGGAGGGGAGG + Intergenic
1190939874 X:55029951-55029973 CCACAAAAGGGGTGGGGGGGTGG - Intronic
1196031204 X:111096805-111096827 CTAGAAAAGGGGAGGGGGTGTGG + Intronic
1196892056 X:120300680-120300702 CTAAAAACGGCCAGGTGCGGTGG - Intronic
1197083479 X:122446167-122446189 ATAGAAACTGGTAGGTGGGGAGG + Intergenic
1197628781 X:128833843-128833865 CAGCAAAATGGGAGGTGGGGTGG + Intergenic
1200383513 X:155865354-155865376 CTGCTCACGGGGAGGTGTGGAGG + Intergenic
1200860366 Y:7985110-7985132 CTTGAAACCGGGAGGTGGGGAGG - Intergenic
1201959360 Y:19661658-19661680 CTACAAACCGGGGCGGGGGGCGG + Intergenic
1202242433 Y:22785571-22785593 CTGCTCACGGGGAGGTGTGGAGG + Intergenic
1202395418 Y:24419320-24419342 CTGCTCACGGGGAGGTGTGGAGG + Intergenic
1202475367 Y:25250772-25250794 CTGCTCACGGGGAGGTGTGGAGG - Intergenic