ID: 1162731164

View in Genome Browser
Species Human (GRCh38)
Location 19:12719857-12719879
Sequence CCTGAAGACCCAGCCAGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 387
Summary {0: 1, 1: 0, 2: 2, 3: 40, 4: 344}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162731164 Original CRISPR CCTGAAGACCCAGCCAGAGC AGG Intronic
900179691 1:1305754-1305776 CCTGAAGCCCCACCCAGGGGAGG + Intronic
900403662 1:2483183-2483205 CCTGAGGACTCAGCCAGTGTAGG + Intronic
900549680 1:3247997-3248019 CCTGGAGAGCCCGCCGGAGCCGG + Intronic
901023269 1:6265707-6265729 CCTGAATTCCCAGCCAGGGTGGG - Intronic
901642935 1:10702198-10702220 GATGAAGACCCCGCCAGGGCTGG - Intronic
901863923 1:12091608-12091630 CCTTCACACCCAGCCAGATCAGG - Intronic
902528564 1:17075762-17075784 CCTGAAGGCCCAGCAGGTGCAGG - Exonic
902733564 1:18385460-18385482 GCTGCAGACCAGGCCAGAGCGGG + Intergenic
903215252 1:21840077-21840099 AGGGAAGACCAAGCCAGAGCTGG - Intronic
904200892 1:28818432-28818454 TCTCCAGACCCAGCCAGAGGAGG + Intronic
904348272 1:29888057-29888079 AATCAAGACCCAGCCAGAGGTGG + Intergenic
904623121 1:31787455-31787477 CCCGAAGACCAGGGCAGAGCAGG - Intergenic
904812151 1:33170502-33170524 CCTGAAGACTCAGCGAGGCCAGG - Intronic
904904558 1:33885393-33885415 ACTTAAGACCCAGCCACTGCTGG + Intronic
906200353 1:43956347-43956369 CCTGCAGACCCAGCACCAGCGGG - Exonic
906519823 1:46460389-46460411 CTTGAAGAGCCAGCCAAGGCTGG - Intergenic
907583643 1:55594830-55594852 CCTGATGACCCAGACCGAGTAGG - Intergenic
907824122 1:57999213-57999235 CCTGTAGAACAAGCCAGAGAAGG + Intronic
909367653 1:74846564-74846586 GCAGAAGGCCAAGCCAGAGCAGG + Intergenic
909397028 1:75181674-75181696 CTTGGAGAGCCAGCCAAAGCAGG - Intergenic
909605247 1:77501260-77501282 ACTGAAGACCAGTCCAGAGCTGG + Intronic
909838120 1:80283529-80283551 TCTGAAGACACAGCAAAAGCCGG + Intergenic
914989444 1:152485752-152485774 CCAGGACACCCAGACAGAGCAGG + Intergenic
915238279 1:154501861-154501883 CCTGAAGACCGTGTCGGAGCGGG - Exonic
919861972 1:201745663-201745685 GCTGTATAGCCAGCCAGAGCTGG - Intronic
920869189 1:209779457-209779479 CCTGGAGTCCCAGCCAGTTCTGG + Exonic
921982586 1:221274565-221274587 CCTGAAGCCGGGGCCAGAGCAGG + Intergenic
923033111 1:230265393-230265415 CCTGCAGGCCCAGAGAGAGCAGG + Intronic
923366498 1:233266946-233266968 CCTGAAGAAACAGACAGAGGTGG - Intronic
1063105685 10:2989524-2989546 CCAGAATACACAGACAGAGCTGG + Intergenic
1063608929 10:7546756-7546778 GCAGAAGACCAAGCCAGAGGTGG - Intergenic
1065207739 10:23373179-23373201 CCTGCAGTCCCAGCTACAGCTGG - Intergenic
1067305362 10:45059210-45059232 CCTGAATTCCCAGACAGATCAGG + Intergenic
1069413782 10:68179785-68179807 CCTGTAGACCCAGCCACTGGGGG - Intronic
1070803105 10:79255017-79255039 CCAGAGGACCCAGCCAGCCCGGG - Intronic
1072020878 10:91399588-91399610 CCTGAAGACAAAGCCAGATAAGG + Intergenic
1074112130 10:110430151-110430173 TCAGAAGACTCAGCCACAGCTGG - Intergenic
1074471084 10:113727486-113727508 TCTGTAGATCCTGCCAGAGCTGG - Intronic
1074535525 10:114325927-114325949 GCTGGAGGCCCAGCCAGATCAGG - Intronic
1075554692 10:123421862-123421884 CCTGAAGGCAGAGGCAGAGCTGG + Intergenic
1076028302 10:127135261-127135283 CCTGACCCACCAGCCAGAGCTGG - Intronic
1076680248 10:132168027-132168049 CCTGAAGACCCAGGGAGATTTGG + Exonic
1076706728 10:132306441-132306463 GCTGAAGGCCCAGCCACACCAGG - Intronic
1077010597 11:377549-377571 CCTGGAGCCCCACCCAGGGCTGG + Intronic
1077034714 11:489053-489075 TCTGCAGAGCCAGGCAGAGCCGG - Intronic
1077057876 11:604360-604382 GATGAAGTCCCAGCCACAGCGGG + Intronic
1077236965 11:1486510-1486532 CCTGAAGACCAAGCCCGGCCCGG - Exonic
1077474864 11:2781543-2781565 CCTGAAGTCCCACACAGGGCTGG + Intronic
1077544798 11:3164753-3164775 CCTGCAGACCCATCAAGACCTGG + Intronic
1078551236 11:12281740-12281762 CCCGAAGTCTCAGCCAGTGCTGG + Intronic
1078726901 11:13940023-13940045 CCAGAGGACCCAGGTAGAGCTGG + Intergenic
1079993788 11:27274104-27274126 CCTGGAGACCAAGCCAGAGATGG + Intergenic
1080409680 11:32011851-32011873 CCTGTGGAGCCAGACAGAGCTGG - Intronic
1080718288 11:34825003-34825025 CCTGAAGAGAAAGCCAGAACAGG - Intergenic
1080990575 11:37529478-37529500 CCTGAAGCAACAGCCTGAGCTGG + Intergenic
1081653983 11:44845140-44845162 ACTGAAGACTCACCCAGAGCAGG + Intronic
1081749452 11:45499459-45499481 TCTGAAGACCCTCCCAGAGAGGG + Intergenic
1081870290 11:46380141-46380163 CCTGAGGACCCCGCCGGACCCGG + Exonic
1083634852 11:64115065-64115087 CCTGAAGTCCCAGCCTGGGAGGG - Intronic
1083668258 11:64286653-64286675 ACAGAAGCACCAGCCAGAGCTGG - Exonic
1083854542 11:65386344-65386366 CCCGAAGACCCAGCGTGGGCAGG + Intergenic
1084575210 11:69984710-69984732 CCTCAGGGCCCAGCCAAAGCTGG + Intergenic
1084941967 11:72617768-72617790 CCTGAAGACCAAGGCAGAGTTGG + Intronic
1085175727 11:74486713-74486735 CCTGATCACGCTGCCAGAGCTGG + Intergenic
1089271630 11:117305526-117305548 CTTGAAAAACCAGCCAGAGGTGG - Intronic
1090356936 11:126146643-126146665 CCTGGAGGCCCAGCCAGGCCTGG - Intergenic
1090590623 11:128263047-128263069 CCTGCAGACATAGCCAGAGTGGG - Intergenic
1091661000 12:2383529-2383551 CCTGAATTCCCAGACAGAGGAGG + Intronic
1091748814 12:3010149-3010171 CCTGACCACCCAGCCCGAACTGG + Intronic
1092935736 12:13362446-13362468 CCTGAGGGCACAGCCAGAGCTGG + Intergenic
1094440643 12:30472133-30472155 CCTGAATTCCCAGCCATAACAGG + Intergenic
1095623200 12:44282976-44282998 TCTGAAGCCACAGCCTGAGCTGG - Intronic
1096585050 12:52614539-52614561 CCAGAAGACAGAGCCAGAGGTGG + Intronic
1097338373 12:58409874-58409896 TCTGATTACCAAGCCAGAGCTGG - Intergenic
1097771934 12:63597095-63597117 CCTGTAGTCCCAGCCTGAGTAGG - Intronic
1100206409 12:92354638-92354660 CCTGAAGCCCCAGTGAGTGCGGG - Intergenic
1100287009 12:93176288-93176310 CCAGAAGACCAAACCAGAGAAGG + Intergenic
1100382474 12:94074466-94074488 CCTCACTACCCAGCCAAAGCGGG + Intergenic
1102011253 12:109619935-109619957 CCTGGAGCCTCAGCCAGAGTTGG + Intergenic
1102339308 12:112109104-112109126 CCTGAAGAACCAGCTAGACTTGG + Intergenic
1102422427 12:112814560-112814582 CCTGGCCACCCAGCCAGACCTGG - Intronic
1104877257 12:132044218-132044240 CCTGAAGACCCTGCAGGAGAGGG + Exonic
1106088168 13:26561379-26561401 CCCAACCACCCAGCCAGAGCTGG - Intronic
1106092150 13:26606028-26606050 CCTGAACAACCCACCAGAGCTGG - Intronic
1106371920 13:29142754-29142776 CCTGAAGGCCCAGGTAGAGCTGG + Intronic
1106480439 13:30133415-30133437 CCTGAAGGCCCAGCCTCTGCTGG + Intergenic
1107175511 13:37394515-37394537 CCTGAGGGCCCAGGCAGGGCTGG - Intergenic
1107787702 13:43971392-43971414 CCTGAGGACCCCGCCGGACCCGG + Intergenic
1111034476 13:82655044-82655066 AATGAAAACACAGCCAGAGCAGG - Intergenic
1111460603 13:88536646-88536668 ACTGGAGACCCAGCAAGTGCTGG + Intergenic
1113017109 13:105840267-105840289 TCTGAGGACACAGCCAGAGGAGG + Intergenic
1113740455 13:112709124-112709146 CCTGAAGACACAGCCAGGAGGGG - Intronic
1114361199 14:21975208-21975230 CCTGTAGTCCCAGCTAAAGCAGG - Intergenic
1115747447 14:36451980-36452002 ACTGAAGACGGAGCCAGTGCAGG - Intergenic
1116526849 14:45916393-45916415 CTTTAAGCCCCAGCTAGAGCTGG + Intergenic
1116862664 14:50007136-50007158 CCTCAAGCCCCACCCTGAGCAGG + Exonic
1118347734 14:64951892-64951914 CCAGAAGCCACAGCCAGAACAGG + Intronic
1120181919 14:81352564-81352586 CCTGAGGGCCCAGCCACAGGAGG + Intronic
1121223296 14:92302577-92302599 GCTGACGAACCAGACAGAGCAGG + Intergenic
1121584196 14:95051760-95051782 CCTGGAGACCCAGGAAGAGCTGG + Intergenic
1122880389 14:104688191-104688213 CCTGAGGAGCCAGCCAAGGCAGG - Intergenic
1123112798 14:105880969-105880991 GCTGGAGGCCCAGCCAGAGAAGG - Intergenic
1123671745 15:22665228-22665250 CCTGAAGATGCTGGCAGAGCAGG + Intergenic
1124244505 15:28057999-28058021 TGTGAGGACCCACCCAGAGCTGG + Intronic
1124323787 15:28738454-28738476 CCTGAAGATGCTGGCAGAGCAGG + Intergenic
1124527679 15:30471695-30471717 CCTGAAGATGCTGGCAGAGCAGG + Intergenic
1124770980 15:32536007-32536029 CCTGAAGATGCTGGCAGAGCAGG - Intergenic
1127198821 15:56621006-56621028 CCTAGAGAACCAGACAGAGCAGG - Intergenic
1127885030 15:63191009-63191031 ACTGAAGACCAAGTCAAAGCTGG + Intronic
1128450934 15:67805532-67805554 CCTGAAAGCCCAGCCTGTGCAGG + Intronic
1128526179 15:68414001-68414023 CCAGAAGCCCCAGCCAGGGCAGG - Intronic
1129030332 15:72612833-72612855 CTTGAAGACCTGGCCAGAGCTGG + Intergenic
1129209909 15:74062457-74062479 CTTGAAGACCTGGCCAGAGCTGG - Intergenic
1129469083 15:75740366-75740388 CTTAAAGACCTGGCCAGAGCTGG + Intergenic
1129477122 15:75792964-75792986 CTTGAAGACATGGCCAGAGCTGG + Intergenic
1129478218 15:75802210-75802232 CCTGGAGACCCAGGCAGGGCGGG - Intergenic
1130317789 15:82810603-82810625 CCTGAAGATGCTGGCAGAGCAGG + Intronic
1130510884 15:84588188-84588210 CCTGGAGACCCGGGCAGGGCGGG + Intergenic
1130662709 15:85843219-85843241 TCTGATGACCAAGTCAGAGCTGG - Intergenic
1131284333 15:91044603-91044625 CCTGAAGACAGAGGCAGAGGTGG - Intergenic
1133216279 16:4294317-4294339 CCTGCAGAGCCGGGCAGAGCCGG - Intergenic
1133467289 16:6039847-6039869 CCTGAAGGCTCAGCCGGGGCTGG + Intronic
1136460964 16:30409754-30409776 CCAGAAGAGGCAGGCAGAGCTGG - Intronic
1136483369 16:30556244-30556266 GCTGCAGAGCCAGACAGAGCCGG + Intronic
1137773714 16:51039072-51039094 CCTGAGGACCCCCACAGAGCTGG - Intergenic
1138522254 16:57577737-57577759 TATGCAGACCCAGCCACAGCAGG - Intronic
1139956389 16:70695072-70695094 CCTGCAAGGCCAGCCAGAGCAGG - Intronic
1140046409 16:71442738-71442760 CCTCCTGACCTAGCCAGAGCAGG + Intergenic
1140244075 16:73232416-73232438 GCCGCAGACCCAGCAAGAGCTGG - Intergenic
1140584891 16:76277564-76277586 GCTGAAGACCCAGACAGAGCTGG + Intronic
1141383739 16:83600184-83600206 CCGGCTGACCCAGCCAGAACTGG + Intronic
1141774730 16:86115581-86115603 TCTCAAAACTCAGCCAGAGCAGG - Intergenic
1141962033 16:87415280-87415302 GCTCAAGACCCAGCTGGAGCTGG - Exonic
1142852209 17:2709704-2709726 GCTGAAGAGCCTTCCAGAGCTGG + Intronic
1142887334 17:2920922-2920944 TCTGAAGTCCCAGACACAGCAGG - Intronic
1143550528 17:7627718-7627740 CCTGAAGAGCCTGAGAGAGCGGG + Exonic
1145152832 17:20520919-20520941 CGTGAAGACGCAGCTGGAGCAGG - Intergenic
1145258185 17:21339076-21339098 CCTGCAGCCCCAGCCACACCAGG - Intergenic
1145318450 17:21748930-21748952 CCTGCAGCCCCAGCCACACCAGG + Intergenic
1145906818 17:28520914-28520936 GCTGAAGACCCAGCCCCAGGTGG - Intronic
1145972906 17:28967496-28967518 CCTGGACAACCACCCAGAGCAGG - Intronic
1148386871 17:47240327-47240349 CCTGAGGAGGCACCCAGAGCTGG - Intergenic
1148565234 17:48628675-48628697 CCTTAAGACCCAAGCAAAGCAGG + Intronic
1148624987 17:49062439-49062461 CCTGTAATCCCAGCTAGAGCAGG + Intergenic
1148644465 17:49211206-49211228 TCTGAAGCCTCACCCAGAGCCGG - Intronic
1149043302 17:52216213-52216235 TCTCAAGTCCCAGCCAGAGATGG - Intergenic
1149331377 17:55586217-55586239 AGAGAAGAGCCAGCCAGAGCAGG + Intergenic
1149598378 17:57877276-57877298 GCTGAACACCCAGCCAGAGTAGG + Intronic
1150048728 17:61938151-61938173 CTTGAAGACCCAAGCTGAGCTGG + Intergenic
1150266319 17:63834473-63834495 CCTGATGATCCAGCATGAGCAGG + Exonic
1150377415 17:64693345-64693367 CCTGTAGTCCCAGCTAGAGGAGG - Intergenic
1150610250 17:66727768-66727790 CCTGAAGACCCAGCCTTCCCTGG - Intronic
1151265009 17:72948018-72948040 CCTGAAGACCCAGCATGGCCTGG - Intronic
1151964778 17:77425613-77425635 CCTGGAGCCTCAGCCAGAGAGGG + Intronic
1153626111 18:7023657-7023679 CCTGCAGGCTCAGCCAGAGCTGG + Intronic
1156789005 18:40949479-40949501 CCAGAGGACCCAGGCAGAGTTGG + Intergenic
1157807965 18:50672459-50672481 CCTGAACACCCAGGCAGACTTGG + Intronic
1158635485 18:59152591-59152613 CGGGAAGACCCAATCAGAGCTGG + Exonic
1160364557 18:78313207-78313229 CCTGAGGTCGCCGCCAGAGCAGG + Intergenic
1160533352 18:79577959-79577981 CGTGAAGTCCCAGCAAGAGAAGG - Intergenic
1160579348 18:79874845-79874867 CCTGAAGTCCCGGCCTGCGCTGG - Intronic
1160593914 18:79961517-79961539 CCTGAAAAAGCAGCCAGGGCTGG + Intergenic
1161060210 19:2210971-2210993 CCTGAAGGCACAGCCACAACAGG - Intronic
1161280690 19:3443982-3444004 CCTAGAGACCCAGCCAGAGTGGG + Intronic
1161383466 19:3978679-3978701 CCTGAAGTCCCAGCTACAGGAGG + Intronic
1161691488 19:5737436-5737458 CCTGTAGTCCCAGCCACAGCAGG + Intronic
1161762589 19:6185361-6185383 GCTGAAGATCCAGGCAGAGCTGG + Intronic
1162419772 19:10559529-10559551 CCTGCAGGCCCAGGCAGAGAGGG + Exonic
1162731164 19:12719857-12719879 CCTGAAGACCCAGCCAGAGCAGG + Intronic
1163163618 19:15480392-15480414 GCTGGAGACTCAGCCAGGGCAGG + Intronic
1163362961 19:16859624-16859646 CCTGAAGAACAGCCCAGAGCAGG + Intronic
1163410052 19:17148540-17148562 CCTGAAGACAGAGGCAGAGATGG - Intronic
1163449142 19:17365420-17365442 CCGGCAGACCCAGCTAGCGCTGG - Exonic
1163799991 19:19358842-19358864 GCTGAAGACCCCGCCACAGAGGG - Intergenic
1164205331 19:23053661-23053683 CATGAACATCCAGCCAGAGTTGG - Intergenic
1164629507 19:29752841-29752863 CCAGTCGAGCCAGCCAGAGCCGG - Intergenic
1165633062 19:37317899-37317921 TCTGCAGACCCAGCCTGTGCCGG - Intronic
1166305889 19:41936855-41936877 CCTGCAGACAGACCCAGAGCAGG - Intergenic
1167087596 19:47320809-47320831 CCAGAAGACCCAGGCAGTGTAGG + Exonic
1167117221 19:47495369-47495391 GGTGAAGACCCAGCCAGCCCAGG + Intronic
1167476849 19:49706258-49706280 CCTGAAGACCCAGGCAGCGGAGG + Exonic
1167560719 19:50225501-50225523 GCTGGAGACACAGCCCGAGCTGG + Intronic
1167665373 19:50820415-50820437 TGTGGCGACCCAGCCAGAGCTGG + Exonic
925438890 2:3867099-3867121 CCTGTAGCCCCATCCAGAGGTGG + Intergenic
925541679 2:4974262-4974284 CCTGAAGACCCAGACAGGGAGGG - Intergenic
926055610 2:9772223-9772245 CCCAAAGACCCAGCCAAAGCGGG - Intergenic
926633570 2:15158641-15158663 GCTGCAGACCCAGCCAGAGTCGG + Intergenic
926975137 2:18507713-18507735 CCTGTAGTCCCAGCTACAGCGGG - Intergenic
928120953 2:28583094-28583116 CCTCCAGAGCCAGACAGAGCTGG + Intronic
928327703 2:30333257-30333279 GCTGAACGCACAGCCAGAGCAGG - Intergenic
929748122 2:44680513-44680535 CCTGTGGACCCAGGCTGAGCTGG - Intronic
929996330 2:46828397-46828419 CATGAGGACCCAGAGAGAGCTGG - Intronic
931170526 2:59798799-59798821 CTTGCAGACCCAGACAGAGACGG + Intergenic
931554016 2:63479795-63479817 CTGGAAGTCCCAGCCAGAGCTGG + Intronic
932301579 2:70671096-70671118 CCTGAAGACCCTAGCAGACCAGG + Intronic
933985968 2:87592406-87592428 ACAGAAGACAAAGCCAGAGCAGG - Intergenic
934560312 2:95309891-95309913 CATGAAAACTCAGGCAGAGCAGG + Intronic
936023328 2:109012358-109012380 CCTGAAGACAGAGCCACCGCTGG - Intergenic
936040354 2:109145114-109145136 CCTGGAGACACAGACAGAGCCGG - Intronic
936307869 2:111358398-111358420 ACAGAAGACAAAGCCAGAGCAGG + Intergenic
936428158 2:112436623-112436645 CCAGGAGACCCACCCAGACCAGG + Intergenic
937448193 2:121976107-121976129 CCTGGAGTTCCAGCCAGTGCGGG + Intergenic
938600807 2:132837228-132837250 CCTGAGGACACATCCACAGCAGG - Intronic
938890724 2:135702535-135702557 CCTGTAGTCCCAGCTACAGCAGG + Intronic
941674296 2:168327495-168327517 CCTGTAGAACCAGGAAGAGCTGG - Intergenic
942206475 2:173624714-173624736 CCTGGAAACCAAGCCAGAACAGG + Intergenic
942957513 2:181790807-181790829 TCTGAGGGCCCACCCAGAGCGGG + Intergenic
944864566 2:203847908-203847930 CCAGAAGACCCACCAAGAGGAGG + Intergenic
945201422 2:207285485-207285507 CCTTGAGTCCCAGCAAGAGCAGG - Intergenic
945413253 2:209538090-209538112 CGTGAAGACACAGCCAAAGATGG - Intronic
945813346 2:214574241-214574263 CGTGAAGAGCCATGCAGAGCAGG - Intronic
946235338 2:218321489-218321511 CCAGAAAACCCAGACAGACCTGG - Intronic
948385743 2:237579499-237579521 CGTGAAGACAGAGCCAGAGATGG - Intronic
948403539 2:237701533-237701555 CCTGAGCCCCCAGCCTGAGCCGG + Intronic
948729278 2:239952963-239952985 GCTGAAGGGCCACCCAGAGCAGG + Intronic
948764994 2:240215041-240215063 CTTGGAGACCCGGCCAGAGGCGG - Intergenic
948799809 2:240427426-240427448 CATGAGGACCCACCCAGTGCAGG - Intergenic
1168898131 20:1338034-1338056 CAGGAAGACCCAGCCTGACCTGG + Intronic
1169001726 20:2172833-2172855 TCTGAAGACCCTGCCTGGGCAGG - Intronic
1169931983 20:10843471-10843493 CCTGGAAAGGCAGCCAGAGCAGG - Intergenic
1170540937 20:17387439-17387461 ACTGAAGACTCAACCAGGGCTGG + Intronic
1170716707 20:18838040-18838062 TCTGTAAAACCAGCCAGAGCCGG - Intergenic
1171492631 20:25532127-25532149 CCTGCAGTCCCAGCCATGGCAGG - Intronic
1172027200 20:31956708-31956730 CTGGGAGGCCCAGCCAGAGCTGG - Intergenic
1172440913 20:34965919-34965941 CCTGGAGACCCAGCCTGACCTGG - Intergenic
1173479819 20:43390065-43390087 CCTGAAGACTCAGCCAGAGGGGG + Intergenic
1173773040 20:45680389-45680411 GCAGAAGACAAAGCCAGAGCAGG - Intergenic
1174301051 20:49582649-49582671 CGTGAAGACCAAGGCAGAGATGG - Intergenic
1175524889 20:59626844-59626866 GCTGAAGACCAAGGCAGAGCTGG - Intronic
1175920908 20:62450302-62450324 CCTGAAGACCCTGCCAGCCCTGG - Intergenic
1175942422 20:62543601-62543623 CCTGATGCCCCAGCCACAGTTGG - Intergenic
1175963611 20:62649189-62649211 GCTGAAGACCCAAGAAGAGCTGG + Intronic
1176001842 20:62835563-62835585 CCTGAGGACCCAGCTGGAGGGGG + Intronic
1176294105 21:5061420-5061442 CATGAAGACCCCGGCAGGGCTGG - Intergenic
1176374094 21:6078588-6078610 CCAGGAGACCCACCCAGACCAGG - Intergenic
1176656418 21:9592191-9592213 CCTCATGACCCAGGCAGAGATGG + Intergenic
1178121890 21:29477715-29477737 CCTGACCACCCAGCTAGAGCAGG - Intronic
1178485696 21:33019026-33019048 CCTGAAAAACTGGCCAGAGCTGG - Intergenic
1178729456 21:35086317-35086339 TCTGAAGGACCAGCCAGAGGTGG + Intronic
1179391406 21:40995241-40995263 CCTTGAGACCCTGACAGAGCTGG - Intergenic
1179719822 21:43308672-43308694 CAAGGAGACCCAGCCAGAGGGGG - Intergenic
1179749383 21:43459655-43459677 CCAGGAGACCCACCCAGACCAGG + Intergenic
1179863154 21:44202228-44202250 CATGAAGACCCCGGCAGGGCTGG + Intergenic
1180034442 21:45236519-45236541 CCTGAAGACCAAGCAAGGGGTGG - Intergenic
1180219994 21:46352438-46352460 GCAGAGGACCAAGCCAGAGCCGG - Intronic
1180645761 22:17337521-17337543 TCAGAAGACCCTGCCAGAGAGGG - Intergenic
1180972652 22:19823373-19823395 CCTGAAGACGCAGCCAGGCCGGG + Intronic
1181010414 22:20037063-20037085 CGTGAAGACTCAGCCACAGAAGG + Exonic
1181021343 22:20104996-20105018 CCTGCAGACCCCTCCAGAACAGG + Intronic
1181041464 22:20194542-20194564 GCTGAGGACCCAGCCAGGCCAGG - Intergenic
1181088438 22:20455948-20455970 TCTGAAGGCCGAGTCAGAGCAGG - Intronic
1181545507 22:23599950-23599972 CCTGATGTCCCAGGCAAAGCGGG - Intergenic
1182116249 22:27758087-27758109 CCTGAAGCACCAACCAGAGCAGG + Intronic
1184020700 22:41819428-41819450 CCTGAAGGCCCTGCCTCAGCTGG - Intronic
1184550370 22:45201234-45201256 CCAGACGACCCCGCCAGAGAAGG + Intronic
1184748993 22:46473454-46473476 GCTGGAGACGCAGCCAGTGCCGG + Intronic
1185038689 22:48492977-48492999 CCTCTTGACCCAGCTAGAGCTGG + Intronic
949555551 3:5149296-5149318 CTGGAATACCCAGACAGAGCAGG + Intronic
950361951 3:12455901-12455923 CCTGAAGGTCAAGCCAGAGAGGG + Intergenic
950406314 3:12807297-12807319 CCAGAGGACCCAGGCTGAGCAGG - Exonic
950446719 3:13042851-13042873 CAGGAAGACCCAGGGAGAGCAGG + Intronic
950891865 3:16411151-16411173 CCTGAAGTCCCTGTGAGAGCAGG + Intronic
952973655 3:38674580-38674602 CCTGAGGGTGCAGCCAGAGCTGG + Intergenic
953135983 3:40182258-40182280 CCTGAAGACCCCTCCAGTGGAGG + Exonic
954121487 3:48502831-48502853 TCTGGAGACCCAGCCAGGCCAGG + Intronic
954693256 3:52407037-52407059 GGTGAAACCCCAGCCAGAGCCGG + Intronic
961311794 3:126007051-126007073 ACTGAAGAGCAAGGCAGAGCTGG - Intronic
962308795 3:134311685-134311707 CCAGAAGGCCCACCCAGAGGTGG + Intergenic
963197266 3:142546174-142546196 CCTCAAAACACAGACAGAGCAGG - Intronic
964375488 3:156044806-156044828 CCTGAGGACCCAGCCAGGAGCGG - Intronic
967568121 3:190994862-190994884 CCTGAAGAGCATTCCAGAGCAGG + Intergenic
968084905 3:195869897-195869919 GCTGCAGACCCAGCCCGAGGAGG + Intronic
969627583 4:8315581-8315603 TCTGAGGACCCAGCCACAGCAGG + Intergenic
969829808 4:9786158-9786180 GATGGAGACCCAGCCTGAGCTGG + Intronic
969864884 4:10068692-10068714 CCTGATGTCCCAGCCAGAGATGG + Intergenic
971393980 4:26211933-26211955 CCTGAAGACGAAGGCAGAGATGG + Intronic
972382374 4:38531326-38531348 TCTGAGGAACCAGACAGAGCTGG + Intergenic
973249682 4:48047981-48048003 CCTGCAGTGCCAGCAAGAGCTGG + Intergenic
973604083 4:52569742-52569764 CCTGGGGACCCAGCCTGAGGTGG + Intergenic
975335165 4:73168026-73168048 CCTGTAGTCCCAGCTACAGCAGG + Intronic
976858342 4:89630754-89630776 CCTGAAGAGCCAGTCAGGACTGG - Intergenic
979201845 4:117987927-117987949 CCTGAAGCCCCGGCCAGGGGAGG - Intergenic
982413151 4:155102118-155102140 GCTGAAGCCTCTGCCAGAGCTGG + Intergenic
982772296 4:159407921-159407943 CCTCAAGATCCAGGAAGAGCTGG - Intergenic
984823447 4:183904756-183904778 CTTGAAGAACCAGGCAGAGCAGG - Intronic
986270213 5:6223680-6223702 CCGGAAGAACCAGACACAGCAGG + Intergenic
986368007 5:7054514-7054536 CCTGAAGAGCCAGGCAGGGGAGG + Intergenic
987196904 5:15536031-15536053 TCTGAAGCCACAGCCTGAGCTGG - Intronic
988882652 5:35520229-35520251 CCTGGGGCCCCAGCCAGAGGTGG - Intergenic
991154550 5:63416093-63416115 CCAGAAGACCCTGCCAGACTAGG - Intergenic
991409851 5:66335059-66335081 CCCAAAGACTCAGCCACAGCAGG + Intergenic
992911358 5:81398874-81398896 CTTTAAGAGCCAGCCAGAGAGGG - Intergenic
995794622 5:115928617-115928639 AGAGAAGATCCAGCCAGAGCAGG + Intergenic
996353591 5:122572994-122573016 TCTGAAGATCCAGCCAAAGTGGG + Intergenic
997602770 5:135151607-135151629 CAACAACACCCAGCCAGAGCAGG - Intronic
999024703 5:148215054-148215076 CCTCAAGACCCAGGCAGAGTAGG - Exonic
999712675 5:154332350-154332372 CCCAAAGACCCAGCCACAGCAGG + Intronic
1000272174 5:159696612-159696634 TCTGGAGAGTCAGCCAGAGCTGG - Intergenic
1001938950 5:175727669-175727691 TCTGAAGGCCCAGCTAGGGCAGG + Intergenic
1002080969 5:176737194-176737216 CACCAAGAGCCAGCCAGAGCAGG - Intergenic
1002088433 5:176790615-176790637 CCTGGACACCCAGTCTGAGCTGG - Intergenic
1002181962 5:177435340-177435362 CCTGCAGGCTCAGCCATAGCAGG - Intronic
1002495558 5:179609093-179609115 CCTGTAGACCCAGCTACTGCCGG + Intronic
1004379108 6:15116925-15116947 AGAGAAGACCCAGCCAGACCTGG + Intergenic
1006061339 6:31422133-31422155 CCTAAAGACCGAGGCAGATCTGG - Intergenic
1006387393 6:33738969-33738991 GCTGAAGGCCCATCTAGAGCAGG + Intronic
1007275595 6:40671269-40671291 GCTGCAGACCCTGACAGAGCTGG - Intergenic
1009933679 6:70206957-70206979 CCTGAAGTCCCAGGAAGACCTGG - Exonic
1012049852 6:94328058-94328080 CCTGAAAACCTTGCCAGAGAGGG + Intergenic
1012578705 6:100836258-100836280 CTTGAAGTCCTAGCCAGAGCAGG - Intronic
1014254173 6:119144996-119145018 CCTGGAGAGCCAGACAGAGAAGG - Intronic
1015263615 6:131266101-131266123 CCTGAAGAGTAAGCCAGAGTTGG - Intronic
1017915667 6:158829887-158829909 CCTGAGGACCCAGTCTGAGTAGG - Intergenic
1018344744 6:162888683-162888705 CCTGCAGACCCAGGCAGGGGAGG - Intronic
1018432187 6:163731010-163731032 GCTGAGGACCCTGACAGAGCCGG + Intergenic
1018433438 6:163741679-163741701 CCTGAAGACACAGCCAGCTGCGG + Intergenic
1019056490 6:169227265-169227287 TCTGTAGAACCAGCAAGAGCTGG - Intronic
1019334191 7:475286-475308 CCTGGGGTCCCAGCCAGGGCGGG - Intergenic
1021598316 7:22340424-22340446 TCTGAAGACCAAACCAGAGAAGG + Intronic
1022056533 7:26741393-26741415 CCTGCAGTCCCAGCCAGTGGAGG + Intronic
1022190453 7:28012625-28012647 CCTTAAGACAAAGCCAGAACTGG + Intronic
1022366248 7:29721245-29721267 CCTGTAGTCCCAGCCTGAGTAGG + Intergenic
1022415554 7:30173792-30173814 CCTGAAGACCCAGCCTCCCCTGG + Intergenic
1022931498 7:35120795-35120817 CCTGTAGTCCCAGCCTGAGTAGG - Intergenic
1023685123 7:42725733-42725755 CCTGGAGACTCATCCACAGCTGG - Intergenic
1024633614 7:51268965-51268987 CCAGAAGACACAGCTGGAGCTGG + Intronic
1025023835 7:55499834-55499856 CCTGCAGAAACAGCCAGACCAGG - Intronic
1025260727 7:57415884-57415906 CTTCCAGTCCCAGCCAGAGCAGG - Intergenic
1026903923 7:74051902-74051924 CCTGAAAACACAGCCACAGAGGG - Exonic
1028197424 7:87923179-87923201 CCTGTAATCCCAGCCAAAGCGGG - Intergenic
1029685010 7:102141266-102141288 ACTGAAGACCCAGGCAGTGGAGG - Intronic
1029811976 7:103058408-103058430 CCTAAAGAGCCAGCAAGAGTGGG + Intronic
1029827388 7:103213286-103213308 CCTGTAGTCCCAGCCTGAGTAGG - Intergenic
1030967585 7:116011925-116011947 CCTGCAGCCTCAGCCAAAGCAGG + Intronic
1032190450 7:129762524-129762546 CCGTAGGACCCAGCCAGTGCGGG + Intergenic
1033725355 7:144110254-144110276 CCTGAAGATCCAGACAAAGGAGG + Exonic
1033729198 7:144157898-144157920 CCTGAAGATCCAGTCAAAGGAGG + Intergenic
1034464583 7:151219120-151219142 CGTGAAGACGCGGCTAGAGCTGG - Exonic
1035047913 7:155981257-155981279 CCTGAAGGCAAAGCCAGACCAGG + Intergenic
1035335240 7:158123837-158123859 CGTGCTGACCCAGGCAGAGCTGG + Intronic
1035380123 7:158432707-158432729 CCTGAAGACGCAGCCTGGCCCGG + Intronic
1035388950 7:158492221-158492243 CCTGCAGCTCCTGCCAGAGCCGG - Intronic
1035592289 8:825097-825119 ACTGCAGACCCTGCCAGAGGAGG + Intergenic
1035758480 8:2051691-2051713 CCTTCAGAGCCAGCCAGTGCCGG - Intronic
1035826306 8:2647640-2647662 CCTAAACACACGGCCAGAGCTGG - Intergenic
1037604546 8:20426082-20426104 ACTGAAAACCAAGCCATAGCAGG - Intergenic
1038423985 8:27452833-27452855 CAGGAAGCCCAAGCCAGAGCTGG + Intronic
1038903987 8:31876796-31876818 CTTGTAGAACCAGCCAGAGGTGG + Intronic
1039930902 8:41987720-41987742 TGTAAAGGCCCAGCCAGAGCAGG - Intronic
1040636738 8:49284036-49284058 CCTGAAGACCTAGTCTGGGCTGG - Intergenic
1041176543 8:55202932-55202954 CCTGTGGATCCAGCCACAGCTGG + Intronic
1045546853 8:103137310-103137332 GCTGAAGTTTCAGCCAGAGCTGG - Intronic
1045993171 8:108333922-108333944 CCTCATTACCCAACCAGAGCAGG - Intronic
1046687677 8:117245237-117245259 AGTGAAGACGCAGCCAAAGCTGG + Intergenic
1048535777 8:135292808-135292830 CTTGAACCCCCAGCCAGTGCTGG + Intergenic
1049024938 8:139981843-139981865 TATCAAGACACAGCCAGAGCTGG + Intronic
1049064091 8:140299268-140299290 CATGAAAACCCCGACAGAGCGGG + Intronic
1049337789 8:142095799-142095821 CCCAGAGACCCAGCCTGAGCAGG + Intergenic
1049686286 8:143940524-143940546 CCGGAGGCCCCAGCCAGCGCAGG - Intronic
1052990029 9:34513732-34513754 CCCTGAGGCCCAGCCAGAGCTGG + Intronic
1053166760 9:35849921-35849943 TCAGAAGACCCAGACAGAGCTGG + Intronic
1053167240 9:35853443-35853465 CCTGGAACCCAAGCCAGAGCTGG - Intronic
1053556120 9:39138677-39138699 CAGGAAGACCCAGACAGAGAAGG - Intronic
1053820238 9:41958927-41958949 CAGGAAGACCCAGACAGAGAAGG - Intronic
1054110514 9:61102616-61102638 CAGGAAGACCCAGACAGAGAAGG - Intergenic
1054610343 9:67228509-67228531 CAGGAAGACCCAGACAGAGAAGG + Intergenic
1056162039 9:83906388-83906410 CCTGGAGAACCTGCCAGAGGAGG - Intronic
1056358290 9:85825081-85825103 CCTGGAGATCCTGCCAGAGGAGG + Intergenic
1056791259 9:89626829-89626851 CCTCGGGTCCCAGCCAGAGCGGG - Intergenic
1057736499 9:97666817-97666839 CCTGAAGATCCAGAAAGAGCTGG + Exonic
1057842704 9:98499370-98499392 CCAGAAGAGCCAGCCAGGACTGG - Intronic
1058459310 9:105168164-105168186 GCTCAAGACCCAGGAAGAGCTGG + Intergenic
1060831450 9:126720199-126720221 CCTGAGGACCTGGCCAGAGGAGG - Intergenic
1061010164 9:127950011-127950033 CCTGAAGTCACAGACAGAGCTGG - Intronic
1061763666 9:132868147-132868169 CCTGAAAGCCCAGCCAGAATAGG - Intronic
1062026445 9:134342805-134342827 CCTGCTGAGCCAGCCAGAGCAGG - Intronic
1062234702 9:135502277-135502299 CCAGAAGGCCCAGCCCGATCCGG - Intronic
1062400553 9:136370781-136370803 CCTGCAGACCCCGCCAGGCCAGG + Intronic
1203634133 Un_KI270750v1:95673-95695 CCTCATGACCCAGGCAGAGATGG + Intergenic
1186360415 X:8835698-8835720 CCTGCACACCCAGCCAGAAGTGG - Intergenic
1187274454 X:17805748-17805770 CCTGACTACTCAGCCAAAGCAGG + Intronic
1191846208 X:65549967-65549989 CCTGAAGACCCAGACACAGGAGG + Intergenic
1192577520 X:72255005-72255027 CCTGAATCCCCCGCCAGAGCGGG - Intronic
1194813223 X:98412007-98412029 CCTGAAGACCCAACCACAGGTGG + Intergenic
1194941057 X:100010510-100010532 CCTGTAGTCCCAGCCAGTGAGGG - Intergenic
1198209666 X:134505377-134505399 CAGGAAGACCCAGACAGAGAAGG - Intronic
1201368829 Y:13238157-13238179 CAGGAAAACCCAGCCTGAGCAGG + Intergenic