ID: 1162731297

View in Genome Browser
Species Human (GRCh38)
Location 19:12720701-12720723
Sequence GGTCCCATTTCCAGAGCTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 1, 2: 3, 3: 16, 4: 193}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162731297_1162731302 5 Left 1162731297 19:12720701-12720723 CCCGCAGCTCTGGAAATGGGACC 0: 1
1: 1
2: 3
3: 16
4: 193
Right 1162731302 19:12720729-12720751 ATTGTAATCCTTCTCTGTCCAGG 0: 1
1: 0
2: 1
3: 34
4: 250
1162731297_1162731303 6 Left 1162731297 19:12720701-12720723 CCCGCAGCTCTGGAAATGGGACC 0: 1
1: 1
2: 3
3: 16
4: 193
Right 1162731303 19:12720730-12720752 TTGTAATCCTTCTCTGTCCAGGG 0: 1
1: 0
2: 2
3: 30
4: 277

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162731297 Original CRISPR GGTCCCATTTCCAGAGCTGC GGG (reversed) Intronic