ID: 1162731380

View in Genome Browser
Species Human (GRCh38)
Location 19:12721090-12721112
Sequence CGCCCTCGGCGGACAGGCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 88}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162731366_1162731380 22 Left 1162731366 19:12721045-12721067 CCAGGTGGAGCCCCTGAGGCCGC 0: 1
1: 0
2: 0
3: 16
4: 276
Right 1162731380 19:12721090-12721112 CGCCCTCGGCGGACAGGCGGAGG 0: 1
1: 0
2: 0
3: 6
4: 88
1162731372_1162731380 3 Left 1162731372 19:12721064-12721086 CCGCGGTGGCCGCATGACGACGG 0: 1
1: 0
2: 0
3: 3
4: 20
Right 1162731380 19:12721090-12721112 CGCCCTCGGCGGACAGGCGGAGG 0: 1
1: 0
2: 0
3: 6
4: 88
1162731370_1162731380 11 Left 1162731370 19:12721056-12721078 CCCTGAGGCCGCGGTGGCCGCAT 0: 1
1: 0
2: 0
3: 8
4: 97
Right 1162731380 19:12721090-12721112 CGCCCTCGGCGGACAGGCGGAGG 0: 1
1: 0
2: 0
3: 6
4: 88
1162731369_1162731380 12 Left 1162731369 19:12721055-12721077 CCCCTGAGGCCGCGGTGGCCGCA 0: 1
1: 0
2: 1
3: 20
4: 148
Right 1162731380 19:12721090-12721112 CGCCCTCGGCGGACAGGCGGAGG 0: 1
1: 0
2: 0
3: 6
4: 88
1162731365_1162731380 23 Left 1162731365 19:12721044-12721066 CCCAGGTGGAGCCCCTGAGGCCG 0: 1
1: 0
2: 1
3: 33
4: 286
Right 1162731380 19:12721090-12721112 CGCCCTCGGCGGACAGGCGGAGG 0: 1
1: 0
2: 0
3: 6
4: 88
1162731375_1162731380 -6 Left 1162731375 19:12721073-12721095 CCGCATGACGACGGGAACGCCCT 0: 1
1: 0
2: 0
3: 2
4: 17
Right 1162731380 19:12721090-12721112 CGCCCTCGGCGGACAGGCGGAGG 0: 1
1: 0
2: 0
3: 6
4: 88
1162731371_1162731380 10 Left 1162731371 19:12721057-12721079 CCTGAGGCCGCGGTGGCCGCATG 0: 1
1: 0
2: 1
3: 5
4: 125
Right 1162731380 19:12721090-12721112 CGCCCTCGGCGGACAGGCGGAGG 0: 1
1: 0
2: 0
3: 6
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162731380 Original CRISPR CGCCCTCGGCGGACAGGCGG AGG Intronic
902332214 1:15736180-15736202 CGCCCTCGGCTGGCAGGTGTGGG + Intergenic
903986884 1:27234965-27234987 CGCCCGCGGAGGGCAGGGGGCGG - Intronic
904253002 1:29237864-29237886 CGCCCCGGGCGGCCGGGCGGGGG + Intronic
904600657 1:31670973-31670995 CCCACTCGGGGGACAGGTGGAGG - Intronic
912878927 1:113390319-113390341 GGCCCCCGGCGGGCAGGAGGCGG - Intergenic
913209508 1:116571068-116571090 CGCCCTGGGCTGGCAGCCGGCGG + Intergenic
920676575 1:208042392-208042414 CGCCCTCAGAGGACAGGCATCGG + Intronic
1077122121 11:914391-914413 TGCCCACGGCAGACAGGCAGTGG - Intronic
1077281419 11:1747904-1747926 CGCCATCGGGGGAGAGGCCGAGG + Exonic
1077412505 11:2410255-2410277 AGGCCTCCGGGGACAGGCGGGGG - Intronic
1081812872 11:45923080-45923102 CGCCCTCGACGGAGACCCGGGGG + Exonic
1083048212 11:59755258-59755280 CGCCCCGGGCGGCCGGGCGGTGG + Exonic
1084978196 11:72814641-72814663 CGCACTCGGGTCACAGGCGGAGG - Intronic
1085035660 11:73298299-73298321 TGCCCTGGGCAGACAGGCAGAGG + Exonic
1090662205 11:128890621-128890643 CGCCCTGCACGGACAGGAGGCGG - Intergenic
1103943362 12:124512845-124512867 GGCCCTCGGCCGAGAGGCGTGGG - Intronic
1107141128 13:36999444-36999466 TGCCCTCGGCGCCCAGTCGGTGG + Intronic
1108122838 13:47208406-47208428 CCCCCTCCGCAGACAGGAGGAGG + Intergenic
1108688905 13:52845751-52845773 CGAGCTCCGCGGACAGGCTGGGG - Intronic
1112692925 13:101916738-101916760 CGCCCTCGGGGCAGAGGAGGGGG + Intronic
1113835378 13:113325485-113325507 AGCCCTCGGAGGCCAGGCGCAGG + Exonic
1119437992 14:74610688-74610710 CGCCCGCGGTGGGCAGGGGGTGG + Intronic
1123630597 15:22257756-22257778 CCCGCGCGGCGGACGGGCGGCGG - Intergenic
1129450236 15:75647549-75647571 CGGCGAGGGCGGACAGGCGGAGG + Intronic
1132342899 15:101089164-101089186 CACCCCCGGCGGGCAGGCAGAGG + Intergenic
1133336954 16:5012448-5012470 CGCCCTCAGGGGGCAGGTGGTGG + Intronic
1136526559 16:30834866-30834888 CGCCCTCGGGGCACAGGTAGTGG + Exonic
1142231305 16:88901473-88901495 GGCCCTCGGCTGCCAGGTGGGGG + Intronic
1142742989 17:1941586-1941608 GCCCCTCGGGGGCCAGGCGGTGG + Intronic
1144656889 17:17042604-17042626 GGCCCGCGGCGGCCGGGCGGCGG + Intronic
1144756571 17:17683237-17683259 TGCCCTGGGAGGAGAGGCGGGGG + Intronic
1144867334 17:18345049-18345071 TGCCCTTGGCGGACAGGAGGAGG - Intronic
1146439062 17:32877351-32877373 CGCCCCCTGGGGACAGGCGCTGG + Intergenic
1148262034 17:46192890-46192912 GGCCCTCGGCGCCCAGGCCGGGG - Intronic
1148493467 17:48037809-48037831 CGGCGGCGGCGGGCAGGCGGCGG - Intronic
1150692680 17:67378598-67378620 CGCCCTCTGCGGTCAGGTAGGGG + Intronic
1152463961 17:80455359-80455381 CGACCTCGGCGGACAGGGGAGGG + Intergenic
1152542054 17:80981477-80981499 CGGCCGCGGCGGCCACGCGGTGG - Intergenic
1152571371 17:81122671-81122693 CGCTCTCTGCGGCCCGGCGGGGG - Exonic
1157298052 18:46459949-46459971 CGTCCTCGGTGGACCCGCGGCGG - Exonic
1160387744 18:78506759-78506781 CGCCGTCCGCAGACGGGCGGTGG + Intergenic
1160674776 19:384151-384173 CGCCCTCGCAGGACAGGCTGTGG - Intergenic
1161077211 19:2291629-2291651 CGGGCACGGCGGTCAGGCGGCGG + Exonic
1161397883 19:4054395-4054417 CGGCCGCGGCGGAGAGGAGGAGG - Exonic
1162731380 19:12721090-12721112 CGCCCTCGGCGGACAGGCGGAGG + Intronic
1162810943 19:13164059-13164081 GGCCCTGGGTGGACAGGCCGAGG - Intergenic
1166364993 19:42273830-42273852 CGCTCTCGGGGGGCAGGTGGCGG - Intronic
1166511552 19:43412634-43412656 AGCCCTCGGGGGACAGACGGGGG + Intronic
1167638257 19:50667409-50667431 CCCCCTCGGAGGACGGGCCGGGG - Exonic
1167748785 19:51367849-51367871 CGCCCCAGGCGGGCAGGCAGGGG - Intronic
1168459131 19:56539005-56539027 CGGCCTCGGGTGACATGCGGGGG + Exonic
925364681 2:3303781-3303803 CGCCCTCTGCTGGCAGACGGCGG + Intronic
927159245 2:20242431-20242453 CGCTCTCGGCGGACGGGGCGGGG + Intergenic
945450142 2:209984880-209984902 TGCCCTCGGCGGCCAGGCCCTGG - Exonic
946367026 2:219254531-219254553 CGGCCCCGGCAGACAGGCTGCGG - Intronic
946403069 2:219478961-219478983 TGCCCTCAGAGGACAGGAGGTGG + Intronic
947731329 2:232433162-232433184 CGCCCTCGGCAGTCAGGAGCAGG + Intergenic
947919138 2:233854355-233854377 CCCTCCCGGCGGACCGGCGGGGG + Intronic
1170906652 20:20521367-20521389 CGCCTTTGGTGGACAGGAGGGGG - Intronic
1173336098 20:42113471-42113493 CGCCCTCAGCTGACAGGGGCTGG + Intronic
1174579596 20:51562410-51562432 CGCCCTCGGCGCACAGGTAGCGG - Intronic
1175993630 20:62802384-62802406 CGCCCTGGGTGGGCAGGCGGGGG - Intergenic
1176567866 21:8396375-8396397 GGCCCTCGGAGGAGGGGCGGCGG - Intergenic
1178451899 21:32709435-32709457 CGCCCAGGGTGGAAAGGCGGTGG - Intronic
1180014682 21:45074524-45074546 CGCGCCCGGCGGGCCGGCGGGGG + Intronic
1180650353 22:17370759-17370781 CGCACTCGGCGGCCAGGCATCGG + Intronic
1180703236 22:17793094-17793116 CGCCCACGGCCGCCAGGCAGGGG + Intronic
1183530993 22:38353312-38353334 CGCCCGCGGCGGCCACACGGGGG - Intronic
1185340800 22:50290176-50290198 CGTCCTCGTAGAACAGGCGGAGG + Exonic
968382372 4:107687-107709 CGCCCTCGGCGACCGCGCGGGGG - Intergenic
968659893 4:1794562-1794584 CGCCCTCGGCCCCCAGGCAGGGG - Intronic
969379075 4:6782691-6782713 CGCCCTCCGCGGAGTGGCGCTGG + Intronic
969588588 4:8108680-8108702 CGGCCTCGGGGGACTGGAGGCGG - Intronic
969588692 4:8109112-8109134 TGCACTCAGGGGACAGGCGGTGG - Intronic
969625396 4:8302386-8302408 CTCCCTCAGGGGACAGGCAGAGG - Intronic
977257516 4:94757724-94757746 CGCACTCCGCACACAGGCGGCGG + Intergenic
977894009 4:102344593-102344615 CGGCCTCGGAGGAGTGGCGGAGG - Exonic
982612712 4:157596759-157596781 TGCCCTCGGCGGGCAGGGGCAGG + Intergenic
983254148 4:165379316-165379338 CGCCCGCGGCGGGCATGAGGCGG + Exonic
1019594589 7:1852488-1852510 CTCCCTGGGCGGAGAGGCTGGGG + Intronic
1035741491 8:1931156-1931178 GGCTCTCGGCGCACATGCGGAGG - Intronic
1036182907 8:6600359-6600381 AGCCCTCAGCGCACAGGTGGAGG + Intronic
1049199142 8:141331427-141331449 CTCCCGCGGAGGACAGGAGGAGG - Intergenic
1052048527 9:23821682-23821704 CGAGCTCCGCGGAGAGGCGGTGG + Intronic
1053482227 9:38424202-38424224 CGCCCTCGGCTCCCAGGCAGCGG + Exonic
1057786052 9:98087940-98087962 GGCGATCGGCGGACAGGCGCAGG + Exonic
1057869923 9:98709424-98709446 AGCGCTCGGCGGAGCGGCGGCGG - Intergenic
1059491181 9:114668474-114668496 AGCCCTCAGAGGACAGGAGGTGG - Intergenic
1060811494 9:126613445-126613467 CTACCTCGGCCGACAGTCGGGGG + Intergenic
1061261421 9:129482772-129482794 CGCCAGCGGCGGCCGGGCGGAGG + Intergenic
1061321781 9:129835457-129835479 CGCGCTTGACTGACAGGCGGCGG + Exonic
1061369556 9:130190855-130190877 GGCCCTGTGCTGACAGGCGGGGG - Intronic
1062507667 9:136886455-136886477 CGCACGCGGCGGAGCGGCGGCGG + Intronic
1190152299 X:47958460-47958482 CCCCCTGGGCAGACTGGCGGTGG - Intronic
1196645776 X:118116531-118116553 AGCACCCGGCGGACAAGCGGCGG - Intronic