ID: 1162731968

View in Genome Browser
Species Human (GRCh38)
Location 19:12723737-12723759
Sequence GATAGCTGTTCCCCTCCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 117}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162731968_1162731972 11 Left 1162731968 19:12723737-12723759 CCTGAAGGAGGGGAACAGCTATC 0: 1
1: 0
2: 1
3: 4
4: 117
Right 1162731972 19:12723771-12723793 GCCGTAGGCAAAGTCAGTCCCGG 0: 1
1: 0
2: 0
3: 1
4: 59
1162731968_1162731969 -4 Left 1162731968 19:12723737-12723759 CCTGAAGGAGGGGAACAGCTATC 0: 1
1: 0
2: 1
3: 4
4: 117
Right 1162731969 19:12723756-12723778 TATCTCAACCCACTTGCCGTAGG 0: 1
1: 0
2: 0
3: 5
4: 38

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162731968 Original CRISPR GATAGCTGTTCCCCTCCTTC AGG (reversed) Intronic
901180933 1:7341395-7341417 GACAGCTGTGCCCCACCTCCTGG - Intronic
904300172 1:29549106-29549128 GACACCTGTGCCCCTCCTCCTGG + Intergenic
906274104 1:44503618-44503640 GATAGCTGTTTCTCTCCTGTGGG - Intronic
909867834 1:80696379-80696401 GATGGTTGATCCCCACCTTCTGG + Intergenic
915124529 1:153654387-153654409 TATAGCTGTGGCCCTCCTCCAGG - Intergenic
917736030 1:177921147-177921169 GGCAGCTGCTCCCTTCCTTCTGG + Intergenic
918407411 1:184224457-184224479 GATGGCTGATCAGCTCCTTCTGG - Intergenic
920113515 1:203603560-203603582 GATGGCTGTTCCCCTCCAACAGG + Intergenic
921310423 1:213837126-213837148 GTTAGCTTTTCCCTTCCATCTGG + Intergenic
922803950 1:228376262-228376284 CATAGCTGTCCACTTCCTTCTGG + Intronic
924289097 1:242520036-242520058 CACAGATGTTCCCTTCCTTCTGG + Intronic
1063934546 10:11064085-11064107 GAGACTTGATCCCCTCCTTCTGG + Intronic
1074855119 10:117467631-117467653 GATAATGGTTCCCCTCTTTCAGG + Intergenic
1076420806 10:130330421-130330443 GATTGCTGATCCCCGCCTGCAGG + Intergenic
1077338056 11:2014210-2014232 GAGGGCTGCTGCCCTCCTTCTGG + Intergenic
1077784595 11:5369005-5369027 GATAGTTTTTAGCCTCCTTCTGG + Intronic
1078548820 11:12266569-12266591 GTTAGCTCTTCACCTCCTTGTGG + Intergenic
1080618350 11:33965696-33965718 ATTAGCTGTTGCTCTCCTTCTGG + Intergenic
1082758626 11:57104027-57104049 CAGGGCTGTTCCCCTCCTCCAGG + Intergenic
1082989449 11:59194937-59194959 GAGAGCTGGTCCCCTCCTCAGGG + Intronic
1083125277 11:60559465-60559487 GATAGCGGTTCCATTCCTTTAGG - Intergenic
1085748551 11:79137144-79137166 GATAGCAGTGCTCCTCCCTCTGG - Intronic
1086925039 11:92631059-92631081 GATATTTATTTCCCTCCTTCAGG + Intronic
1087408412 11:97758892-97758914 GCTTGCATTTCCCCTCCTTCAGG - Intergenic
1088964436 11:114703809-114703831 GAAAGCTGTTCCTCTCCTAATGG - Intronic
1090334237 11:125951964-125951986 GATGGCCGTTCACCTCCTGCAGG + Intergenic
1090856214 11:130611121-130611143 GATAGCTCTGCCCCACCTTTGGG + Intergenic
1202821040 11_KI270721v1_random:69392-69414 GAGGGCTGCTGCCCTCCTTCTGG + Intergenic
1095611054 12:44128530-44128552 AATAGCTGACCCTCTCCTTCAGG + Intronic
1096744462 12:53716346-53716368 GCCAGCTCTTCGCCTCCTTCAGG + Exonic
1101362990 12:104045195-104045217 ATCAGCAGTTCCCCTCCTTCTGG - Intronic
1102260881 12:111442639-111442661 GCTGGCTGTCCCCCTCCTCCTGG - Intronic
1103079851 12:118015403-118015425 CCTAGCTGATCCCCTTCTTCGGG + Intronic
1104631642 12:130407881-130407903 TAGCGGTGTTCCCCTCCTTCCGG + Intronic
1105022417 12:132826032-132826054 TACACCTGTTCCCCTGCTTCAGG + Intronic
1106836166 13:33637295-33637317 GAGGCCTCTTCCCCTCCTTCAGG - Intergenic
1107326089 13:39244539-39244561 GATTGATGTTCTCCTCCTCCTGG - Intergenic
1108023395 13:46152852-46152874 GATAAGGCTTCCCCTCCTTCAGG + Exonic
1108521798 13:51252667-51252689 GATAGCTGTTCTCTTCCTTCAGG + Intronic
1112369981 13:98785685-98785707 GATGGCTGTACCCCTGCTCCTGG + Intergenic
1114524326 14:23358965-23358987 GAGACCTGATCCCCTCCTGCAGG - Exonic
1117280055 14:54230993-54231015 GATTTCTTTTCCCATCCTTCAGG + Intergenic
1118439763 14:65801755-65801777 GCAACCTGTTCCCTTCCTTCTGG - Intergenic
1119117840 14:72043616-72043638 TATAGATGTTTCCCTCCTTTTGG + Intronic
1123740620 15:23280133-23280155 GATAGCTGGACCCCTCCATTTGG - Intergenic
1123746378 15:23322425-23322447 GATAGCTGGACCCCTCCATTTGG + Intergenic
1126415224 15:48411163-48411185 GGTAGCTGATCCCTTCCTTTTGG + Exonic
1130542496 15:84831366-84831388 GATAGCTGTTCCCCTGGTCGTGG + Intronic
1132244216 15:100281590-100281612 CATAGCTGTTACCCTTCTTTTGG - Intronic
1132748579 16:1447086-1447108 GACAGCTGTGCCCCTGCTGCAGG - Exonic
1136590822 16:31216654-31216676 CCTTCCTGTTCCCCTCCTTCAGG - Intronic
1137800212 16:51256023-51256045 CATAGCTGTTCTGCTCCTCCAGG - Intergenic
1140225920 16:73077037-73077059 GGTAACTATTCCCCTCCTTTGGG + Intergenic
1142995414 17:3757193-3757215 GAGAGCTGAGCCCCTCCATCTGG + Intronic
1144456405 17:15422549-15422571 CGTAGCAGTTCCCTTCCTTCTGG - Intergenic
1145753015 17:27368633-27368655 GAAACCTGTTCCCTGCCTTCAGG - Intergenic
1151176084 17:72289216-72289238 GAAAGCTGTTCCACAGCTTCAGG + Intergenic
1156380966 18:36560689-36560711 GAGAGGTGTTACCCTCCTTTTGG - Intronic
1160026732 18:75224354-75224376 GATGTCTGTTCCTCACCTTCAGG + Intronic
1162731968 19:12723737-12723759 GATAGCTGTTCCCCTCCTTCAGG - Intronic
1164989129 19:32672131-32672153 GATGGCCGTTCCCGCCCTTCCGG + Intronic
1167368429 19:49066461-49066483 GGTCTCTGTTCCCCTCCCTCTGG + Intergenic
1167690246 19:50980628-50980650 GATCTCTGTTCCCCTCTCTCTGG - Intronic
1167760920 19:51448383-51448405 GCTAGCAGTTCTCCTCCTTGGGG + Intergenic
1168614996 19:57830365-57830387 GACAACTGTTCTCCGCCTTCTGG - Exonic
925641634 2:5990882-5990904 GATTCCTGTTGACCTCCTTCAGG - Intergenic
926230025 2:10995444-10995466 GATAGTGGGTCCCCACCTTCTGG - Intergenic
931047354 2:58370643-58370665 GATAGATGTTCCTCTCCTGAAGG - Intergenic
932968529 2:76508876-76508898 GATAGCTGTTTCCCAACTTTTGG + Intergenic
944927950 2:204484785-204484807 GAAAGCTGCTCCCCTTATTCTGG - Intergenic
1170739401 20:19041725-19041747 CATAGCTGTTTACCTCCATCTGG - Intergenic
1179557745 21:42191207-42191229 GACAGCTGTTCCCTACCTTCAGG - Intergenic
1181620972 22:24090991-24091013 GCTAGCTGTTTCCTTCCTTCAGG + Intronic
1182919183 22:34063997-34064019 CATTGCTCTTCCCCACCTTCAGG + Intergenic
1183303228 22:37068851-37068873 CCTAGCTCTTCCCTTCCTTCTGG - Intronic
953689589 3:45106717-45106739 GGTAGTTGTTCCCCTGCTTCTGG + Intronic
954130991 3:48560889-48560911 GACAGTTTTCCCCCTCCTTCGGG + Intronic
955538263 3:59947720-59947742 CATAGGTGTTCCCCATCTTCTGG + Intronic
955824790 3:62934530-62934552 GATGTCTGCTCCCCTACTTCAGG + Intergenic
957805325 3:85140883-85140905 ATTAGCTGTTCTCCTCCTTAGGG + Intronic
960161318 3:114352911-114352933 CATAGCTGTTGCCTTCCTCCTGG - Intronic
961358286 3:126352333-126352355 GAGCGCTGTTCCCCTCCACCAGG - Exonic
962026761 3:131555958-131555980 GATAGTTATTCCCCTTCTGCAGG + Intronic
962098575 3:132317459-132317481 GAGAGCTGCACCCCTCCTCCTGG + Exonic
963305073 3:143642396-143642418 TAAAGCTGTTCCCCTCCTCTAGG + Intronic
969338600 4:6526876-6526898 GATGGCTGTCCCCCTCCTCAGGG - Intronic
971840173 4:31841564-31841586 GAAAGATGTTCCCATCCTTGAGG - Intergenic
975735031 4:77372730-77372752 GATAGTAATTCCCCTCCTACTGG + Intronic
981014482 4:139959634-139959656 GTAAGCTGTTCACTTCCTTCAGG - Intronic
981583931 4:146279680-146279702 GATAGCTCTGCACTTCCTTCAGG + Intronic
981648412 4:147026929-147026951 GAGAGCTCTTGCCCTACTTCTGG - Intergenic
985683939 5:1271857-1271879 GAAAGGTGTCCCCCTCCTTTAGG - Intronic
985814203 5:2114640-2114662 GTAAGCTGTTCCCCTCCAACAGG + Intergenic
991718856 5:69477107-69477129 GATTCCTCTGCCCCTCCTTCTGG + Intergenic
992524150 5:77590400-77590422 GCAAGCTGTATCCCTCCTTCTGG - Intronic
993421039 5:87701083-87701105 GATGGCTGTTCCCCTCCCCTTGG + Intergenic
996028261 5:118675927-118675949 GATTGCTCTTCCTCTCCATCTGG + Intergenic
999953754 5:156677893-156677915 GATAGGTGTTTCACTCTTTCTGG - Intronic
1001021033 5:168182797-168182819 GATCCCTGTTCCTCCCCTTCAGG + Intronic
1001042607 5:168347657-168347679 GATTGCTCTTCACCTTCTTCAGG - Intronic
1001254320 5:170171906-170171928 GCTGGCTGGTCCCCTCCCTCAGG - Intergenic
1004828690 6:19452696-19452718 GGTAGCTGTTCCCCAGCCTCAGG - Intergenic
1005417604 6:25618383-25618405 GGTAGCTGTACTCTTCCTTCAGG + Intronic
1006955973 6:37872285-37872307 GATTGCTGTTCAGCGCCTTCAGG + Intronic
1007290368 6:40781221-40781243 GAGAGCTGTCCCCCTCCATGGGG + Intergenic
1017584887 6:155909649-155909671 GAGAACTGTAACCCTCCTTCTGG + Intergenic
1018070648 6:160161569-160161591 GAAAGCTGCCTCCCTCCTTCCGG - Intergenic
1019158521 6:170054412-170054434 GAAAGTTGTTCCTGTCCTTCTGG - Intergenic
1027141950 7:75663889-75663911 GGTAGCTGTTCCCCTGCTAGAGG - Intronic
1034155391 7:148952223-148952245 CATAGCTATTTCCCTCCTCCAGG + Intergenic
1036926372 8:12909724-12909746 CAAGGCTGTTCCCCTCCTCCAGG + Intergenic
1037423684 8:18731354-18731376 GTTTGCTGTTTCCATCCTTCTGG - Intronic
1039489612 8:37937604-37937626 GATTGCTGTTCCCCTCATCTTGG + Intronic
1040611683 8:48990560-48990582 GATTGCTCTTTCCCTCCTTTTGG - Intergenic
1047380326 8:124356024-124356046 TACTGCTATTCCCCTCCTTCAGG - Intronic
1049012130 8:139894274-139894296 CAAAGCTGTTTCCCTCCTTGCGG + Intronic
1050001148 9:1078041-1078063 GATAACTATTCCCCTTCTTGGGG - Intergenic
1052087381 9:24284206-24284228 GCTTCCTGTTTCCCTCCTTCTGG - Intergenic
1059495571 9:114706421-114706443 CATAGCTGTTGCCCTCTTCCAGG + Intergenic
1060248706 9:121968292-121968314 GACAGATGTTTTCCTCCTTCAGG + Intronic
1062152583 9:135029483-135029505 CATAGCTGCACCCCTCCTTGTGG - Intergenic
1186998613 X:15151315-15151337 AATAACTGTAACCCTCCTTCTGG - Intergenic
1197356715 X:125444739-125444761 GATAGCTGCTCCCTTCCCCCAGG - Intergenic