ID: 1162733096

View in Genome Browser
Species Human (GRCh38)
Location 19:12730677-12730699
Sequence ATGGCTAAGGGGAGGGAGGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1181
Summary {0: 1, 1: 0, 2: 9, 3: 89, 4: 1082}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162733084_1162733096 27 Left 1162733084 19:12730627-12730649 CCAAGCACACAGCTCCGGCACTA 0: 1
1: 0
2: 1
3: 9
4: 91
Right 1162733096 19:12730677-12730699 ATGGCTAAGGGGAGGGAGGAGGG 0: 1
1: 0
2: 9
3: 89
4: 1082
1162733085_1162733096 13 Left 1162733085 19:12730641-12730663 CCGGCACTAAGTCAAGTTCTTTA 0: 1
1: 0
2: 0
3: 11
4: 138
Right 1162733096 19:12730677-12730699 ATGGCTAAGGGGAGGGAGGAGGG 0: 1
1: 0
2: 9
3: 89
4: 1082

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162733096 Original CRISPR ATGGCTAAGGGGAGGGAGGA GGG Exonic
900863044 1:5246367-5246389 AAGGATAGAGGGAGGGAGGAAGG - Intergenic
900932906 1:5747861-5747883 AAGGGAAAGGGGAGGGAGGCAGG + Intergenic
901137425 1:7007097-7007119 AGGGCCAAGGGGATGGATGATGG + Intronic
901455091 1:9358596-9358618 ATGGCTGGGAGGAGGGAGGCAGG - Intronic
901462865 1:9401915-9401937 GGGGCGAAGGGGAGGGAGGGAGG + Intergenic
901752850 1:11422123-11422145 ATGGCAGAGGGGTGGGAGGCAGG - Intergenic
901836399 1:11926464-11926486 ATGGAAAACGGGAGGGCGGAGGG + Intergenic
902712525 1:18250058-18250080 ATGGAAGGGGGGAGGGAGGAGGG - Intronic
902774252 1:18664445-18664467 CTGGGGAAGGGGAGGGAGGAGGG + Intronic
902982350 1:20134086-20134108 AGGGATCAGGGGAGGAAGGAAGG - Intergenic
903019995 1:20387044-20387066 AGGGCTGAGGGGGAGGAGGAAGG + Intergenic
903116298 1:21181225-21181247 TTGGCTAAGGGGAGTGAGGACGG - Intergenic
903363213 1:22790140-22790162 ATGGGTGAAGGTAGGGAGGAAGG + Intronic
903476038 1:23619713-23619735 AGGGCAGGGGGGAGGGAGGATGG - Intronic
903499841 1:23794892-23794914 GTGGCTAAGGCCAGGAAGGAAGG - Exonic
904036996 1:27564275-27564297 TTGGCTTCGGGGAGGGGGGAAGG + Intronic
904472604 1:30745432-30745454 GGGGCTGAGGGGAGGGAGGGGGG - Intronic
904488964 1:30846612-30846634 ACGGCTGAGTGGAGCGAGGAGGG - Intergenic
904807272 1:33140861-33140883 AAGGAGAAGGGGAGAGAGGAGGG - Intergenic
904988792 1:34574489-34574511 GTGGTTAGAGGGAGGGAGGATGG - Intergenic
904995412 1:34627706-34627728 GTGGGGAAGGGGAGGTAGGAAGG + Intergenic
905010323 1:34742647-34742669 AAGGCTCAGGGGAGAGTGGAAGG + Intronic
905228240 1:36493849-36493871 ATGGATAAGTGGTGGGTGGACGG - Intergenic
905242675 1:36590971-36590993 CTGGGGAAGGGGATGGAGGAAGG + Intergenic
906538488 1:46565907-46565929 AGAGAAAAGGGGAGGGAGGAAGG - Intronic
907190954 1:52648509-52648531 AGGGATAAGGAGAGGAAGGAGGG - Intronic
907326785 1:53643530-53643552 ATGACCATGGGGAGGGAGCAAGG + Intronic
908558183 1:65278964-65278986 ATGGGGAAGGGGATGGAGGAGGG - Intronic
908920809 1:69189240-69189262 GTGGTGAAGGGGAGGGGGGAAGG - Intergenic
909108311 1:71441316-71441338 ATGGCGAAGGGTATGGAAGAAGG - Intronic
909433984 1:75619107-75619129 AGGAAGAAGGGGAGGGAGGAAGG + Intergenic
909897740 1:81094085-81094107 AGGGAGGAGGGGAGGGAGGAGGG + Intergenic
910220998 1:84889357-84889379 AAGGCACAGGGGAGTGAGGATGG + Intronic
910532217 1:88250469-88250491 AAGGAGAAAGGGAGGGAGGAAGG + Intergenic
910842324 1:91572268-91572290 ATGGGTAAGAGGAGGGCGGTGGG + Intergenic
911045963 1:93628564-93628586 ATGTCTAAGGGGAAGAAGAAGGG - Intronic
911151818 1:94603676-94603698 AAGGCTAAAGGGATGGAGAATGG + Intergenic
911542293 1:99172385-99172407 GAGGGTAAGGGGTGGGAGGAGGG - Intergenic
911670068 1:100597809-100597831 CTGGATAAGGGGATGGAGGATGG + Intergenic
911724944 1:101233384-101233406 CTGGGTCAGGGGAGGGAAGAGGG + Intergenic
912308498 1:108595508-108595530 ATGGAGAAAGGGAGGGAGGGAGG + Intronic
912480693 1:109980426-109980448 AAGGCTGAGGGTAGGGAGGGAGG + Intergenic
913181904 1:116330396-116330418 ATGGCTAAGCGGTGTGGGGAGGG + Intergenic
913231899 1:116746878-116746900 AAGGTTTAGGAGAGGGAGGAGGG - Intergenic
913428148 1:118757863-118757885 ATGGATGAAGGAAGGGAGGATGG + Intergenic
913596375 1:120381937-120381959 TTGGGTAGGGGGAGGGGGGAGGG + Intergenic
913964258 1:143362151-143362173 ATGGAAAAGGAGAGGGAAGAAGG - Intergenic
914090895 1:144497038-144497060 TTGGGTAGGGGGAGGGGGGAGGG - Intergenic
914307708 1:146437169-146437191 TTGGGTAGGGGGAGGGGGGAGGG + Intergenic
914918392 1:151831822-151831844 AGGGCCCAGGGGAGGGAGGAGGG + Exonic
915025793 1:152828211-152828233 ATGGCTAAAGATATGGAGGAGGG + Intergenic
915109850 1:153556419-153556441 TTGGCTAAGTAGAGGGAGGAAGG + Intergenic
915156512 1:153881029-153881051 ATGGACAAGGAGAGGGAGGGGGG - Intronic
915345487 1:155195042-155195064 ATGGCAAGGGGGAGGGGGGAGGG - Intergenic
915360463 1:155283547-155283569 ATGGGTGGGGGGAGGGGGGAGGG - Intronic
915385254 1:155485421-155485443 AAGGCTGAGCGGGGGGAGGATGG - Intronic
915642747 1:157241909-157241931 TTGGGTAGGGGGAGGAAGGAGGG - Intergenic
915724927 1:158010719-158010741 CAGGCAAAGGGGAGGGAGGAGGG - Intronic
915911456 1:159918197-159918219 GTGGCTAAGGGGTGGGGTGAGGG - Exonic
916479563 1:165202682-165202704 AAGGCTGAGGGGATAGAGGAGGG - Exonic
916564751 1:165964795-165964817 TTGGGTGAGGGGAGGGGGGAGGG - Intergenic
917638120 1:176956649-176956671 ATGGGTCAGGGGAGGCAGGGAGG - Intronic
917653455 1:177102198-177102220 TTAAATAAGGGGAGGGAGGAAGG + Intronic
917665117 1:177218715-177218737 CTGACTTAGGGGAGAGAGGAAGG + Intronic
918210778 1:182349199-182349221 ATGGCAAAGAGGAGCGTGGAAGG + Intergenic
918469966 1:184861726-184861748 AAGGAGAAGGGGAGGGAGGAAGG + Intronic
918541297 1:185636101-185636123 ATGGATAAATGGAGGGAGGGAGG - Intergenic
918590760 1:186238296-186238318 ATGGAGAAGTGGAGGGGGGAAGG + Intergenic
918833982 1:189435533-189435555 AAGGGGAAGGGGAAGGAGGAAGG + Intergenic
918991395 1:191701187-191701209 AGGGCAAAGGAGAGGGAAGAGGG - Intergenic
919002639 1:191853386-191853408 ATGGGTTGGGGGAGGGGGGAGGG - Intergenic
919061616 1:192641360-192641382 AGGGGAAAAGGGAGGGAGGAAGG + Intronic
919289726 1:195614169-195614191 TTGGGTGAGGGGAGGGGGGAAGG - Intergenic
919501656 1:198344997-198345019 ACAGCTAAGGGGAGGGTAGATGG - Intergenic
919840503 1:201605781-201605803 AGGGCTAAGGAGAGGGGGAATGG + Intergenic
920255614 1:204652225-204652247 AGGGCGAAGGGGAGAGAGGAGGG - Intronic
920365098 1:205444125-205444147 ATGGAAAAGGAGGGGGAGGATGG - Intronic
920585448 1:207154921-207154943 ATAGCTAAGGGTAGGGAGCTGGG + Intergenic
920700588 1:208215529-208215551 ATGGATGAAGGGATGGAGGAAGG + Intronic
921177236 1:212606201-212606223 GGGGCTGAGGGGAGGGAGGCAGG + Intronic
921218457 1:212956317-212956339 AGGGCTAGGGGGCAGGAGGAGGG - Intronic
921303627 1:213773369-213773391 ATGGTTATGGGCAGGGAGAATGG + Intergenic
921515960 1:216092931-216092953 GGGGCTAAAGGGAGTGAGGAAGG - Intronic
921624199 1:217359956-217359978 TTGGGTGAGGGGAGGGGGGAGGG + Intergenic
921655932 1:217737451-217737473 ATCTTTAAGGGAAGGGAGGAGGG + Intronic
921942159 1:220853518-220853540 ATGGGAAAGGGAAAGGAGGAAGG - Intergenic
922110161 1:222548241-222548263 ATGGGTTGGGGGAGGGGGGAAGG - Intergenic
922235671 1:223720875-223720897 ATGGCAAATTGGAGGGAGCATGG - Intronic
922302092 1:224310677-224310699 AGGGCTAAAGGGAGGGAGAAAGG - Intronic
922470181 1:225871910-225871932 ATGGTTTTGGGGAGGGAGCAGGG - Intronic
922507674 1:226135928-226135950 AGCGCACAGGGGAGGGAGGAGGG + Intergenic
922544019 1:226441734-226441756 ATGGAGAAGGCGAGGCAGGAAGG + Intergenic
922945557 1:229510860-229510882 AAGGCTAAGGTGTGGGAGGATGG + Intergenic
923202620 1:231726575-231726597 ATACCTAAGGGCAGGGAAGACGG + Intronic
923327009 1:232888904-232888926 AAGGATAACGGGAGGGAGAAAGG - Intergenic
923401841 1:233623281-233623303 AAGGGTACGGGGAGGGGGGATGG + Intronic
923747833 1:236719090-236719112 ATGGTGAAAGGGAGGGAAGAAGG - Intronic
923977474 1:239280038-239280060 ACGTCTAATGGGAGGAAGGAAGG + Intergenic
924064908 1:240210998-240211020 AGGAAGAAGGGGAGGGAGGAAGG - Intronic
1063353166 10:5374481-5374503 CTTGCTGTGGGGAGGGAGGAAGG - Exonic
1063528204 10:6804288-6804310 GTGGGGTAGGGGAGGGAGGAGGG - Intergenic
1064121424 10:12623080-12623102 ATGGAGGAAGGGAGGGAGGAAGG - Intronic
1064225262 10:13478067-13478089 AGGGGAGAGGGGAGGGAGGATGG + Intronic
1064594126 10:16926104-16926126 ATGGATGAGAGGAGGGAGAAGGG + Intronic
1064695505 10:17961198-17961220 AAGGCTAAGAGAAGGAAGGAGGG + Intronic
1064956983 10:20922282-20922304 ATGGGTAGGGGGATGGAGGGAGG - Intronic
1065310304 10:24409439-24409461 ATTGCTCAGGGGCTGGAGGAAGG + Intronic
1065327609 10:24563064-24563086 ATGGAGAAGGGTGGGGAGGAGGG - Intergenic
1065951636 10:30657771-30657793 ATGGAGAAAGGGAGGGAGGGAGG - Intergenic
1066211507 10:33243876-33243898 ATGGCTAAGGGAGGGAGGGAGGG + Intronic
1066371526 10:34821991-34822013 AAAGAAAAGGGGAGGGAGGAAGG + Intergenic
1066596194 10:37052579-37052601 AGGGAGAAAGGGAGGGAGGAGGG + Intergenic
1066656348 10:37702229-37702251 CTGGCTGAGGACAGGGAGGAGGG - Intergenic
1067217665 10:44316499-44316521 ATGGCTAGTGGGAGGGACCAAGG - Intergenic
1067242874 10:44510893-44510915 ATGGCAAAGGAGACAGAGGAAGG + Intergenic
1067342426 10:45416715-45416737 ATGGATGAAGGGAAGGAGGAAGG + Intronic
1067510651 10:46892410-46892432 GTGGCTGAGGGGAGTGAGGGAGG + Intergenic
1067549986 10:47227442-47227464 ATGGCTAAGAGGTGGGGTGAGGG - Intergenic
1067651605 10:48159452-48159474 GTGGCTGAGGGGAGTGAGGGAGG - Intronic
1067786604 10:49254901-49254923 ATGCCCAAGGGCAGGGAGTAAGG - Intergenic
1068103976 10:52591254-52591276 CTGGCAAAGGGAAGGGAAGATGG - Intergenic
1068830661 10:61491198-61491220 AAGGAGAAGGGAAGGGAGGAAGG + Intergenic
1069224748 10:65929017-65929039 GTGGGTGAGGGGAGGGGGGAGGG - Intronic
1069393656 10:67964727-67964749 ATGGCTTATGGGAGTGAGGAGGG - Intronic
1069824730 10:71248034-71248056 TTGGCAAAGGGGAGAGAGAAGGG - Intronic
1069860814 10:71470446-71470468 ATTGCTAGGGGGTAGGAGGAAGG - Intronic
1069933794 10:71901196-71901218 ATGGGAATGGGGAGGGAAGATGG - Intergenic
1069933801 10:71901215-71901237 ATGGGAATGGGGAGGGAAGATGG - Intergenic
1069933808 10:71901234-71901256 ATGGGAATGGGGAGGGAAGATGG - Intergenic
1070298882 10:75188399-75188421 ACAGCCCAGGGGAGGGAGGAGGG - Intergenic
1070411195 10:76142832-76142854 TTGGGTAGGGGGAGGGGGGAAGG - Intronic
1070493920 10:77003798-77003820 AAGGATAAGGGGAGGGATGATGG + Intronic
1070585430 10:77762457-77762479 CTGGGGAAGGGGAGGAAGGAGGG - Intergenic
1070589972 10:77794622-77794644 ATGGCGGAGGGGCGCGAGGAAGG + Intronic
1070826224 10:79391918-79391940 GTGGCTGAGGGGTGGTAGGAGGG - Intronic
1071132448 10:82410530-82410552 GTGGCTAAGGGGTGGAGGGAAGG + Intronic
1071231951 10:83598225-83598247 ATAGCTAAGGGGAAGGATGTGGG - Intergenic
1071242560 10:83724152-83724174 ATTGCTAGAAGGAGGGAGGAAGG + Intergenic
1071270643 10:84003817-84003839 ATGGGGAAGGTGAGGAAGGAGGG - Intergenic
1071304538 10:84286830-84286852 ATGGAGTAGGGGTGGGAGGAAGG + Intergenic
1071369977 10:84941230-84941252 GTGTCTAAGAGGAGAGAGGAAGG + Intergenic
1071516343 10:86300457-86300479 AGGGAACAGGGGAGGGAGGAAGG + Intronic
1071825531 10:89322069-89322091 TGGGGTAGGGGGAGGGAGGAGGG + Intronic
1072255148 10:93614037-93614059 ATTGCTGAGGGGAGGGATGATGG - Intronic
1073042577 10:100617616-100617638 AGGGCTGCTGGGAGGGAGGAAGG - Intergenic
1073462098 10:103671706-103671728 TTGGCTAAGGGCTGGGAAGACGG + Intronic
1073777082 10:106798429-106798451 GTGGGTGGGGGGAGGGAGGAAGG - Intronic
1073977948 10:109121678-109121700 ATGGAGGAAGGGAGGGAGGAAGG - Intergenic
1074162404 10:110845586-110845608 ATGGGTAGGGGGAGGGAAGGTGG - Intergenic
1074339934 10:112618599-112618621 TTGGCCTAGGGGAAGGAGGAAGG + Intronic
1074538011 10:114342620-114342642 TTGGCTTTGGGGATGGAGGAAGG + Intronic
1074627721 10:115211753-115211775 GTGGGTGAGGGGAGGGGGGAGGG - Intronic
1074708075 10:116153310-116153332 ATGTATAAAGGGAGGAAGGATGG - Intronic
1074723637 10:116285368-116285390 ATGGCCATGGCGAGGAAGGAGGG + Intergenic
1074902718 10:117833027-117833049 GTGGGGAGGGGGAGGGAGGAGGG - Intergenic
1074910968 10:117908486-117908508 CTGCTTATGGGGAGGGAGGAAGG - Intergenic
1074981956 10:118627026-118627048 ATAGCCAGGGGGAGGGAGCAGGG - Intergenic
1075489977 10:122858403-122858425 TTGGGTGAGGGGAGGGGGGAGGG + Intronic
1075814324 10:125253243-125253265 TTGGATGAAGGGAGGGAGGAAGG - Intergenic
1075962426 10:126580880-126580902 ATGGGTAGAGGGAGGGAGGATGG - Intronic
1076409493 10:130235696-130235718 ATGGCTAGGGAGAGGGAGGTGGG - Intergenic
1076478261 10:130767436-130767458 AAGGCTGAGGAGAGGGAGGGGGG - Intergenic
1076566124 10:131400666-131400688 AGTGCAAAGGGGAGGGTGGAGGG + Intergenic
1076734818 10:132453901-132453923 ATGGCTAAGCTGAGTGAGGCAGG + Intergenic
1077031237 11:468896-468918 CTGGGTAATCGGAGGGAGGAGGG + Intronic
1077268567 11:1664602-1664624 AAGGGAAGGGGGAGGGAGGAGGG + Intergenic
1077497166 11:2891954-2891976 GTGGAGAATGGGAGGGAGGAAGG - Intronic
1077522352 11:3043778-3043800 CAGGCCAAGGGGAGGAAGGAGGG + Intronic
1077546914 11:3175904-3175926 GTGGCCAGGGGGAGGGAGAAGGG + Intergenic
1077729580 11:4715609-4715631 ATTTCTGAGGGTAGGGAGGAAGG + Intronic
1078205344 11:9224231-9224253 ATGCCTAAAGGAAGGGAAGAAGG + Intronic
1079104922 11:17564437-17564459 CTGGGTAAGGAGAGGGAGGGAGG + Intronic
1079403015 11:20121409-20121431 AGGAGGAAGGGGAGGGAGGATGG - Intronic
1080030661 11:27657283-27657305 CTGGCTTAGGGGATGGGGGATGG - Exonic
1080101778 11:28467608-28467630 GTGGCAAATGGGAGGGAAGAGGG - Intergenic
1080132517 11:28813689-28813711 ATGGATAGGGGCAGTGAGGAGGG - Intergenic
1080283007 11:30580370-30580392 ATGCCTATAGGGAGGAAGGATGG - Exonic
1080807552 11:35668357-35668379 GTGGATAGGGGGTGGGAGGAAGG - Intronic
1081451724 11:43177323-43177345 ATGGAAAAAGGGAGGCAGGAGGG - Intergenic
1081716798 11:45256232-45256254 GTGGAGAAGAGGAGGGAGGAAGG - Intronic
1081813132 11:45924291-45924313 ACAGCTGAGGGGAGGGGGGAAGG - Intronic
1081875203 11:46403833-46403855 AGGGCCAAGGGGAGTGGGGAGGG + Intronic
1082848335 11:57743982-57744004 GAGGCTTAGGGAAGGGAGGAAGG + Exonic
1082895345 11:58184151-58184173 ATGGCTAAGGCCAAGGAAGATGG + Intergenic
1083187123 11:61024236-61024258 AGGGAGAAAGGGAGGGAGGAGGG - Intergenic
1083328812 11:61887365-61887387 AAGGGTAAGAGAAGGGAGGATGG - Intronic
1083619385 11:64041467-64041489 AGAGCTCAGGGGAGTGAGGAGGG + Intronic
1083887276 11:65579048-65579070 AGGGGGAAGGGGAGGGAGAAAGG - Intronic
1083996490 11:66275620-66275642 ATGGAAGAGGGCAGGGAGGAAGG + Intronic
1084316287 11:68347701-68347723 ACGCCTTAGGGGTGGGAGGAAGG + Intronic
1084740976 11:71139352-71139374 AGGGGTAGGGGGAGGGGGGAGGG + Intronic
1085612512 11:77964714-77964736 AAGGGCAAGTGGAGGGAGGAAGG + Intronic
1085803597 11:79613950-79613972 AAGGCTCATGGGAGGGAAGAAGG - Intergenic
1086417744 11:86606079-86606101 GTAGCTTTGGGGAGGGAGGAGGG - Intronic
1086477834 11:87198542-87198564 AGGGGAGAGGGGAGGGAGGAGGG - Intronic
1086496616 11:87410605-87410627 GTGGCTATGGGGAGGGAGGGAGG - Intergenic
1086734078 11:90283872-90283894 GTGGGTGAGGGGATGGAGGAAGG + Intergenic
1087086817 11:94228008-94228030 AGGGCTTAGAGGAGGGAGAATGG + Intergenic
1088047433 11:105471205-105471227 GTGGCTCAGGGAAGGAAGGAAGG + Intergenic
1088168528 11:106967685-106967707 AAGGCAAAAGGGAGGCAGGAAGG + Intronic
1088735329 11:112723738-112723760 AAGGGTAAGGGGAGGGAGGATGG + Intergenic
1089018854 11:115190401-115190423 GTGGGGAAGGGCAGGGAGGAGGG - Intronic
1089143826 11:116309840-116309862 ATGGCTAAAGGGATGGAAAAGGG - Intergenic
1089164739 11:116466984-116467006 ACGTCCAAGGGGAGGGAGAAGGG - Intergenic
1089396666 11:118140641-118140663 AAGGGGAAGGGGAGGGAAGATGG - Intronic
1089735452 11:120547507-120547529 TCAGATAAGGGGAGGGAGGAAGG + Intronic
1090062362 11:123475162-123475184 CTGGGTACAGGGAGGGAGGAAGG + Intergenic
1090235354 11:125142824-125142846 ATGGACAAGGGGAAGGAGTAAGG + Intergenic
1090836033 11:130454664-130454686 ATGCCTTCTGGGAGGGAGGAGGG + Intronic
1091076268 11:132620511-132620533 AAGGCTAAGGGGAATCAGGAAGG + Intronic
1091193224 11:133711630-133711652 AGTGCTAAGAGCAGGGAGGATGG - Intergenic
1091723567 12:2830534-2830556 ATGGCTTGGGGCAGGGAGGAAGG + Intronic
1092257434 12:6935207-6935229 AGGGCTTGGGGGATGGAGGATGG + Intronic
1092580632 12:9837117-9837139 GAGGCTAAGGGGAGAGAGAATGG - Intronic
1092620905 12:10267074-10267096 AAGGCTACTGGGAGGGGGGAGGG - Intergenic
1092716033 12:11391746-11391768 AGGGATAGGGGGAGAGAGGATGG - Intronic
1092930945 12:13315148-13315170 TTGGCAAAGGGGAGAGAGAATGG - Intergenic
1093001109 12:13997119-13997141 ATGGCTAAGTGGAAATAGGAAGG + Intergenic
1094171261 12:27494813-27494835 AAGGCCAAAGGGAAGGAGGAAGG - Intronic
1094183455 12:27616114-27616136 AGGGAAAAGAGGAGGGAGGAAGG - Intronic
1094244171 12:28268724-28268746 ATGGCATGGGGAAGGGAGGAGGG + Intronic
1094636718 12:32233555-32233577 ATAGGAAAGGGGAGGGAGGGAGG - Intronic
1095206385 12:39443766-39443788 CTGACTCCGGGGAGGGAGGAGGG - Intergenic
1095457275 12:42401501-42401523 GTGGCCATGGGGAGGGGGGAGGG + Intronic
1095770608 12:45952201-45952223 GTGGCTGAGGGGAGGGGTGAAGG - Intronic
1095956438 12:47809040-47809062 AAGGCGAAGGGGAGAGATGAAGG - Intronic
1096127107 12:49128067-49128089 GTGGGTGAGGGGATGGAGGAAGG - Exonic
1096145080 12:49273102-49273124 GTGGGTGAGGGGATGGAGGAAGG + Exonic
1096352364 12:50911123-50911145 ATGGCTAAGAGGAGGAGAGAGGG - Intergenic
1096412404 12:51386892-51386914 AAGGGTCAGGGGTGGGAGGAGGG - Intronic
1096606651 12:52771308-52771330 ATTTCTAAGGAAAGGGAGGAAGG - Intronic
1096809814 12:54162079-54162101 ATGGCAAAGAGAAGGGAGCAGGG + Intergenic
1096855432 12:54478587-54478609 AAGGGAAAGGGGAGGAAGGAAGG - Intergenic
1097107620 12:56634801-56634823 ATAGTTCAGGGGAGAGAGGAAGG + Intronic
1097825645 12:64172448-64172470 AAGGAAAAGAGGAGGGAGGAGGG + Intergenic
1098479746 12:70944328-70944350 ATATCCAAGGGGAGAGAGGATGG - Intergenic
1098579575 12:72083330-72083352 AAAGCTAGGGGTAGGGAGGATGG - Intronic
1099385975 12:82014087-82014109 TGGGGTAGGGGGAGGGAGGAGGG - Intergenic
1099388770 12:82051833-82051855 TGGGGTAGGGGGAGGGAGGAGGG + Intergenic
1099644232 12:85330426-85330448 GTGGAGAAAGGGAGGGAGGAAGG - Intergenic
1099864417 12:88260875-88260897 ACTGATAAGGGGTGGGAGGAGGG + Intergenic
1099925039 12:89006935-89006957 ATTTCTAAAGGTAGGGAGGAGGG + Intergenic
1099941327 12:89192746-89192768 GTGGCTCAGCAGAGGGAGGAAGG + Intergenic
1100401029 12:94230092-94230114 ATGGAGAATGGGAGGGAGGAGGG - Intronic
1100762931 12:97829829-97829851 AAGGATAAAGGGAGGAAGGAAGG - Intergenic
1101308843 12:103557711-103557733 ATGGGGAAGGGGAGACAGGATGG - Intergenic
1102390356 12:112544522-112544544 AGGTCTAAGGGTAGGGAGGAAGG + Intergenic
1102452769 12:113053986-113054008 ATGGATAAGTGGATGGTGGATGG + Intergenic
1102522225 12:113485529-113485551 CTGGCTCAGGGGAGAGAGGGCGG - Intergenic
1102556385 12:113729472-113729494 ATGGTGAAGGTGAGGGTGGATGG + Intergenic
1102677873 12:114670550-114670572 ATTGCTGTGGGGAGGGAGGAGGG - Exonic
1102786115 12:115606343-115606365 AGGGGGAAGGGGAGAGAGGAGGG + Intergenic
1102923282 12:116808747-116808769 ATGGCAAACGGCAGGGAGGAGGG + Intronic
1103048543 12:117759639-117759661 AGGGCTGAGGGGAGGGAGAATGG - Intronic
1103053690 12:117802210-117802232 ACGGCTTGGGAGAGGGAGGAAGG - Intronic
1103222482 12:119257381-119257403 AGGGAGAAGGGGAGGGAAGAAGG + Intergenic
1103393785 12:120592436-120592458 GCGGCTGGGGGGAGGGAGGATGG - Intergenic
1103454642 12:121055396-121055418 ATGGAGGAGGGGAGGGAGGTGGG - Intergenic
1103472988 12:121196844-121196866 ATGGACAAGGGGAGGGGGAATGG - Intergenic
1103582944 12:121929645-121929667 AGGGCTCAGGGGAGGAAGGGAGG - Intronic
1104081416 12:125433661-125433683 ATGGGTGGGGGGAGGGGGGAGGG - Intronic
1104254648 12:127125412-127125434 ATTGCTAATGGGAGGCAGGCTGG + Intergenic
1104295494 12:127508151-127508173 ATGGGTAGGAGGATGGAGGATGG + Intergenic
1104488405 12:129172481-129172503 ATGGTTAAGCTGAGTGAGGAAGG - Intronic
1104618497 12:130291208-130291230 AGGGCTAAAGGAAGGGAGAATGG - Intergenic
1104671165 12:130681484-130681506 AGGGAATAGGGGAGGGAGGAAGG - Intronic
1104714204 12:131005753-131005775 CTGGCTCAGGGGATGGAGCAGGG + Intronic
1105211653 13:18260691-18260713 ATGGATAGAGGGAGGGAGGGAGG + Intergenic
1105234893 13:18541187-18541209 ATGGATAAAGGGAGGCAAGAGGG - Intergenic
1105337152 13:19483919-19483941 TTGGGTAGGGGGAGGGGGGAGGG - Intronic
1105410918 13:20170548-20170570 AGGGGTAAGGGTGGGGAGGAAGG - Intergenic
1106073167 13:26433651-26433673 AGGGCCAGGGGGTGGGAGGAGGG + Intergenic
1106269280 13:28138476-28138498 AGGGGAGAGGGGAGGGAGGAGGG - Intergenic
1106322592 13:28656013-28656035 AGAGCTAGGAGGAGGGAGGAGGG + Intergenic
1106793188 13:33177721-33177743 AGGGAGAAAGGGAGGGAGGAAGG + Intronic
1106900607 13:34351396-34351418 ATGGATTAGCGGAGGGATGATGG + Intergenic
1107746999 13:43520916-43520938 TTAGCTAAGGGAAGGGAGTAAGG + Intronic
1107814533 13:44232481-44232503 AAGGCCAAGGGGAGGGACAAAGG + Intergenic
1107821012 13:44285719-44285741 ATGGCTCAGGGGAGAGCAGATGG - Intergenic
1107996308 13:45864607-45864629 AGAGCTAAGGGGAGGAAAGAAGG - Intergenic
1108687718 13:52835271-52835293 ATGGGGAGGGGGAGGGGGGAAGG + Intergenic
1109350521 13:61174586-61174608 AGGGCTAAGAGAAGTGAGGAAGG + Intergenic
1109374818 13:61478603-61478625 GAGGGTAAAGGGAGGGAGGAAGG - Intergenic
1109400922 13:61827853-61827875 GTGGGTGGGGGGAGGGAGGAGGG - Intergenic
1110011454 13:70339738-70339760 CTGGCAAAGGGAAGGGAAGATGG - Intergenic
1110231282 13:73170181-73170203 ATGGCTAGGAGGTGGGAGGGAGG - Intergenic
1110329331 13:74252761-74252783 ATGGGGAAGAGAAGGGAGGATGG - Intergenic
1110566646 13:76964012-76964034 TGGGGTAGGGGGAGGGAGGAGGG + Intergenic
1112442924 13:99437793-99437815 TTGGCAGAGTGGAGGGAGGAAGG - Intergenic
1112742638 13:102492585-102492607 TTGGGCAGGGGGAGGGAGGAAGG + Intergenic
1113072909 13:106438823-106438845 ATGGATGGGTGGAGGGAGGAAGG + Intergenic
1113433117 13:110267254-110267276 ATGACCCAGTGGAGGGAGGAGGG + Intronic
1113665288 13:112136797-112136819 ACGACTGAGGGAAGGGAGGAGGG - Intergenic
1114433531 14:22683788-22683810 TGGGGTAGGGGGAGGGAGGAGGG + Intergenic
1114444828 14:22780411-22780433 ATGGGGAATGGGAGGTAGGAGGG - Intronic
1114484379 14:23054373-23054395 AGTGCTGTGGGGAGGGAGGAGGG - Intronic
1114613049 14:24054566-24054588 CTGGCCCAGGGGAAGGAGGAAGG - Intronic
1114618228 14:24079802-24079824 CAGGCTAAGGGGAGGGCAGATGG - Intergenic
1114654512 14:24308026-24308048 AAGTCCAAGGGGAGGGATGAGGG + Exonic
1114972865 14:28056132-28056154 TGGGCTGAGGGGAGGGAGGAGGG - Intergenic
1115545680 14:34462871-34462893 ATGGGTGGGGGAAGGGAGGAAGG - Intergenic
1115657990 14:35462538-35462560 GAGGGGAAGGGGAGGGAGGAAGG - Intergenic
1115860558 14:37681628-37681650 ATGTCTGAGGGCAGGGGGGATGG - Intronic
1116029181 14:39550342-39550364 CGGGGTGAGGGGAGGGAGGATGG - Intergenic
1116133236 14:40887729-40887751 AAGACTCAGTGGAGGGAGGAAGG + Intergenic
1116707973 14:48327719-48327741 GGGGGTAAGGGGAGGGGGGAGGG - Intergenic
1116944712 14:50825856-50825878 ATGGATCAAGGGAGGTAGGAAGG - Intronic
1117749722 14:58908625-58908647 AAGGGTGAGGGGATGGAGGAGGG + Intergenic
1117875290 14:60245760-60245782 ATGATGTAGGGGAGGGAGGAAGG + Exonic
1117968339 14:61228396-61228418 CTTGCTATGAGGAGGGAGGAGGG - Intronic
1118076933 14:62309544-62309566 TTTGCTAAGGGGAAGGAGGGGGG + Intergenic
1118663633 14:68042603-68042625 ATGGGAAAGGGGAGGGAGAAAGG - Intronic
1118986720 14:70761922-70761944 ATTGCTAAGGTTTGGGAGGAGGG - Intronic
1118998783 14:70862089-70862111 AGGGAGAAAGGGAGGGAGGAAGG + Intergenic
1119264963 14:73259171-73259193 ATGGTCCAGGGGACGGAGGAAGG + Intronic
1119685760 14:76630003-76630025 ATGGCTAATGGAAGGATGGAAGG - Intergenic
1119865034 14:77966298-77966320 CAGGCAAAGGGGAGGGAGGCAGG - Intergenic
1120953682 14:90063253-90063275 CTGGCTAATGGGATGGAGGCGGG + Intronic
1121102785 14:91261515-91261537 TTGGATAAGGACAGGGAGGAGGG + Intergenic
1121504760 14:94468366-94468388 GTGGATGAAGGGAGGGAGGAAGG + Intronic
1121571726 14:94951444-94951466 ATGGCTATTGGAAGGGAGGCAGG + Intergenic
1121633160 14:95436111-95436133 ATGGCTGGGGGGAGGGAGATGGG - Intronic
1122002068 14:98666966-98666988 AGGGAGAAAGGGAGGGAGGAAGG - Intergenic
1122048250 14:99038500-99038522 ATAGTTAAGGGGAGGGTGGCTGG - Intergenic
1122083004 14:99279883-99279905 ATGGCTCAGAGGAGGTAGCAGGG + Intergenic
1122453173 14:101828230-101828252 GGGGCTGCGGGGAGGGAGGAAGG + Intronic
1122464062 14:101918486-101918508 AAGGCTGAGGGGTGGGGGGAGGG - Intronic
1122464093 14:101918554-101918576 AAGGCTGAGGGGTGGGGGGAGGG - Intronic
1122743923 14:103887173-103887195 AGAGCAAAGGGGAGGGAGGCAGG - Intergenic
1122958513 14:105083787-105083809 ATGGATGGGTGGAGGGAGGATGG - Intergenic
1123083163 14:105705582-105705604 ATGGGTAGGCGGATGGAGGATGG - Intergenic
1123144293 14:106112990-106113012 ATGCATCAGGGGTGGGAGGAAGG + Intergenic
1123861652 15:24474937-24474959 ACTGCTATGGGGTGGGAGGAGGG - Intergenic
1123917712 15:25049035-25049057 AGGGAGAAAGGGAGGGAGGAAGG - Intergenic
1124167756 15:27343161-27343183 AACACGAAGGGGAGGGAGGAAGG + Intronic
1124647664 15:31450409-31450431 AGGGGGAAGGGGAGGGAGAAGGG + Intergenic
1125254833 15:37751473-37751495 AGAGCAAAAGGGAGGGAGGAAGG + Intergenic
1125404001 15:39334291-39334313 AAGGCTATGGGCAGAGAGGATGG - Intergenic
1126142501 15:45449771-45449793 GAGGGGAAGGGGAGGGAGGAGGG + Intergenic
1127261753 15:57331620-57331642 AGGGCAAAGGGGAGTGAGGCAGG + Intergenic
1127517808 15:59713373-59713395 AAGGGGAAGGGAAGGGAGGAAGG - Intergenic
1128363454 15:66979561-66979583 ATGAGAAAGGGGAGGGAGGAAGG - Intergenic
1128565021 15:68695354-68695376 ATGACAAAGAGGAGGGAAGAAGG - Intronic
1128740981 15:70083538-70083560 TTATCTGAGGGGAGGGAGGAGGG - Intronic
1128762010 15:70223503-70223525 AGGCCTGAGGGGAGGCAGGAGGG - Intergenic
1128777176 15:70329412-70329434 ATGTCCAAGGGGAGGGAGGAGGG - Intergenic
1129442132 15:75588976-75588998 GAGGAAAAGGGGAGGGAGGAGGG + Intergenic
1130284441 15:82543140-82543162 GGGGCTAACGGGAGGGAGTAAGG - Intronic
1130296378 15:82649106-82649128 ATGGCTAAGGGGAGAGGGACAGG + Intergenic
1130746862 15:86663556-86663578 ACAGCAAAGGGGAGGGAGGCAGG + Intronic
1131378267 15:91943234-91943256 AGGGCTGAGGGGAGGGGGAATGG - Intronic
1132019277 15:98346406-98346428 TGGGCTCGGGGGAGGGAGGAGGG - Intergenic
1132198181 15:99929454-99929476 CTGGCTTTGGGGATGGAGGACGG + Intergenic
1132251027 15:100335428-100335450 GGGGCTCTGGGGAGGGAGGAGGG - Intronic
1132689087 16:1174505-1174527 GTGGCCATGGGGAGGGAGGGAGG + Intronic
1132868444 16:2104964-2104986 AGGGCTAGGGGAGGGGAGGAGGG + Intronic
1132868456 16:2104989-2105011 AGGGCTAGGGGAGGGGAGGAGGG + Intronic
1133116076 16:3578718-3578740 GTGGCTCAGGGGAGGTAGGAGGG + Intergenic
1133266561 16:4588117-4588139 ATGGCTGCTGGGATGGAGGAAGG - Intronic
1133574074 16:7070779-7070801 ATGGCTAAGGGGAAGGGGGATGG - Intronic
1133602552 16:7353793-7353815 AGGGCTGAGGGGAGAGAGTATGG + Intronic
1133815411 16:9193798-9193820 CTGGCTTTGGAGAGGGAGGAAGG - Intergenic
1133839415 16:9394476-9394498 AGGGAGAAAGGGAGGGAGGAAGG - Intergenic
1134224697 16:12381286-12381308 ATGGATAATGGGTGGGTGGATGG - Intronic
1134258362 16:12630302-12630324 AAGGCTAGGGGGAGGCTGGATGG - Intergenic
1134293166 16:12920171-12920193 GTGGGTACGGGGAGGGGGGAGGG + Intronic
1134433208 16:14231133-14231155 TGGGGTAAGGGGAGGGGGGAGGG + Intronic
1134493368 16:14712391-14712413 GTGGCTTAGGGCAGGGGGGAGGG - Intronic
1134498749 16:14751515-14751537 GTGGCTTAGGGCAGGGGGGAGGG - Intronic
1134525302 16:14938144-14938166 GTGGCTTAGGGCAGGGGGGAGGG - Intronic
1134547592 16:15122764-15122786 GTGGCTTAGGGCAGGGGGGAGGG + Intronic
1134581824 16:15377570-15377592 GTGGCTTAGGGCAGGGCGGAGGG + Intronic
1134712890 16:16336628-16336650 GTGGCTTAGGGCAGGGGGGAGGG - Intergenic
1134720756 16:16379946-16379968 GTGGCTTAGGGCAGGGGGGAGGG - Intronic
1134779392 16:16882014-16882036 TTCGGTGAGGGGAGGGAGGAGGG - Intergenic
1134946671 16:18331939-18331961 GTGGCTTAGGGCAGGGGGGAGGG + Intronic
1134953930 16:18372054-18372076 GTGGCTTAGGGCAGGGGGGAGGG + Intergenic
1134978633 16:18590106-18590128 AGAGCTAAGGTGAGGGAGGGAGG - Intergenic
1134993654 16:18722497-18722519 ATGGGGAGGGGGAGGGGGGAGGG + Intergenic
1135040425 16:19113851-19113873 CTGCCTTCGGGGAGGGAGGATGG + Intergenic
1135067256 16:19320829-19320851 GTGGCTAAGAGGTGGGAGGCAGG + Intronic
1135077714 16:19408692-19408714 ATGGCTTAGAGAAAGGAGGAGGG - Intergenic
1135118831 16:19747631-19747653 AGGGTGAAGGGGTGGGAGGAGGG - Intronic
1135312753 16:21418932-21418954 GTGGCTTAGGGCAGGGGGGAGGG + Intronic
1135365670 16:21851202-21851224 GTGGCTTAGGGCAGGGGGGAGGG + Intronic
1135446138 16:22519950-22519972 GTGGCTTAGGGCAGGGGGGAGGG - Intronic
1135567825 16:23525420-23525442 ATGGCAAGTGGGTGGGAGGAAGG + Intronic
1135632625 16:24047962-24047984 AAGGGTGAGGGAAGGGAGGAGGG + Intronic
1135728194 16:24873232-24873254 ATGGAGAGAGGGAGGGAGGAAGG + Intronic
1135850739 16:25960891-25960913 ATTGCTAACTGGAGGTAGGAAGG + Intronic
1135892693 16:26371685-26371707 GTGGGGGAGGGGAGGGAGGAAGG + Intergenic
1136037856 16:27554056-27554078 ATGGAAGAAGGGAGGGAGGAAGG + Intronic
1136151896 16:28356650-28356672 GTGGCTTAGGGCAGGGGGGAGGG + Intronic
1136168131 16:28470487-28470509 GTGGCTTAGGGCAGGGGGGAGGG + Intronic
1136194841 16:28644519-28644541 GTGGCTTAGGGCAGGGGGGAGGG - Intronic
1136211183 16:28758633-28758655 GTGGCTTAGGGCAGGGGGGAGGG - Intronic
1136227055 16:28866363-28866385 AGGGCTCAGGGGAGCCAGGATGG - Exonic
1136255903 16:29038584-29038606 GTGGCTTAGGGCAGGGGGGAGGG - Exonic
1136309429 16:29397691-29397713 GTGGCTTAGGGCAGGGGGGAGGG + Intronic
1136322871 16:29499447-29499469 GTGGCTTAGGGCAGGGGGGAGGG + Intronic
1136437555 16:30239415-30239437 GTGGCTTAGGGCAGGGGGGAGGG + Intronic
1136607835 16:31348461-31348483 ATGGGTGATGGGAGGGTGGATGG + Intergenic
1137218675 16:46426530-46426552 AGGGAGAAAGGGAGGGAGGAGGG - Intergenic
1137910064 16:52368893-52368915 ATGGCTAGCTGGAGGAAGGATGG - Intergenic
1138443189 16:57047251-57047273 ATGGTCAAGGTGAGTGAGGATGG + Intronic
1138600538 16:58051522-58051544 AAGGAGAAAGGGAGGGAGGAAGG + Intergenic
1138631230 16:58295629-58295651 ATGGCTGATGGAAGGCAGGAAGG + Intronic
1138761270 16:59547622-59547644 AGGGATATGGGAAGGGAGGAGGG - Intergenic
1138911395 16:61403725-61403747 ACGGCTCAGGGGAGAGATGATGG + Intergenic
1139123414 16:64047841-64047863 ATGGCTGTTGGGAGGAAGGAAGG - Intergenic
1139365980 16:66433907-66433929 GTGGCTAAGGGGAGAGAGCCTGG - Intronic
1139857120 16:69990079-69990101 GTGGCTTAGGGCAGGGGGGAGGG + Intergenic
1140081317 16:71750109-71750131 ATACCAAAGGGGAGAGAGGAGGG + Intronic
1140328251 16:74026958-74026980 ATGAGTAAGGGAAGAGAGGAAGG + Intergenic
1140365592 16:74377903-74377925 GTGGCTTAGGGCAGGGGGGAGGG - Exonic
1140725565 16:77808465-77808487 ATGGAGCAGGGGTGGGAGGATGG - Intronic
1141412710 16:83846284-83846306 CTGGCAAAGGGAAGGGAAGACGG + Intergenic
1141635987 16:85314154-85314176 CTGCCTCAGGGGAGGGAGGCTGG - Intergenic
1142417946 16:89953372-89953394 ATGGCTCCTGGCAGGGAGGAAGG - Intronic
1142709962 17:1717656-1717678 GTGGATAAGGGGATGGAGGAGGG - Intronic
1143008261 17:3851290-3851312 ATGGAGAAGGTGAGGGAAGATGG - Intergenic
1143305123 17:5940488-5940510 TTGTCAAAGGGGAGAGAGGATGG + Intronic
1143450729 17:7035514-7035536 ACGGCTAAGGGAAGAGAGAAGGG - Intergenic
1143481117 17:7227880-7227902 ATGGGGAATGGGTGGGAGGAGGG - Intronic
1143537404 17:7549393-7549415 AAGGCAAGGGGAAGGGAGGATGG + Intronic
1143617861 17:8064275-8064297 ATGGGTCAGGGGAGGGGGGCTGG + Intergenic
1143709374 17:8723710-8723732 ATGGCTGAGGCGGGTGAGGATGG - Intergenic
1143738977 17:8938534-8938556 GAGGATAAGGGGAGGGAGAATGG - Intronic
1144513936 17:15902028-15902050 GGGGCTGAGGGGAGGGAGAATGG - Intergenic
1144582361 17:16466150-16466172 CTGGCTTAGGGGAGGGGGGATGG - Intronic
1145058197 17:19716663-19716685 ATGAGTAAGGGGCAGGAGGAGGG + Intronic
1145212075 17:21021223-21021245 ATGGCTGAGGAGAGAAAGGAGGG + Exonic
1145271564 17:21407556-21407578 ATGGGTAATGGGTGGGTGGATGG - Intronic
1145309778 17:21695004-21695026 ATGGGTAATGGGTGGGTGGATGG - Intronic
1145978553 17:28998116-28998138 GAAGCTATGGGGAGGGAGGAGGG + Intronic
1146158388 17:30544010-30544032 ATGACTAAGGATAGTGAGGAAGG + Intergenic
1146584676 17:34071908-34071930 ATGTCTAAGTGGAAGGATGAAGG + Intronic
1146795023 17:35774654-35774676 TTGGCTCAGGGGTGGGAGAAGGG - Intronic
1146820894 17:35982977-35982999 AGGGATGAAGGGAGGGAGGAAGG - Intergenic
1146944546 17:36864754-36864776 AGGGAGGAGGGGAGGGAGGAAGG - Intergenic
1147020022 17:37523806-37523828 ATGACTGAAGGGAGTGAGGAGGG + Intronic
1147204141 17:38824716-38824738 ATGGCTTAGGGTAGGGAGAATGG + Intronic
1147359256 17:39920993-39921015 AAGGCTGAGGGGAGGGGGCAGGG - Intergenic
1147418628 17:40311058-40311080 ATGGCTCAGGGGAGCAAGTATGG - Intronic
1147973771 17:44236001-44236023 TTGGCCAAGGGCAGGGAGGTGGG - Intergenic
1148674221 17:49435671-49435693 AAGGCTGAGGGTAGAGAGGAAGG - Intronic
1149006373 17:51810483-51810505 AGGGCTGAGGGAAGAGAGGAAGG + Intronic
1149187568 17:54017437-54017459 CTGGCAAAGGGAAGGGAAGATGG - Intergenic
1150266652 17:63836539-63836561 ATGGGGAAGGGGAAGGAGAAAGG + Intronic
1150977812 17:70108788-70108810 AAGGAGAAAGGGAGGGAGGAAGG - Intronic
1151214311 17:72567399-72567421 ACAGCTGTGGGGAGGGAGGAAGG - Intergenic
1151268912 17:72978168-72978190 ACGCCTAAGGGCAGGGAAGAGGG - Intronic
1151393527 17:73803941-73803963 ATGGGGAATGGGAGGGAGAAAGG - Intergenic
1151403997 17:73875097-73875119 TTGGCAAGGGGCAGGGAGGAAGG + Intergenic
1151425356 17:74027706-74027728 AGGGCTGAGATGAGGGAGGAAGG + Intergenic
1151698551 17:75730638-75730660 AAGGCTTTGGGAAGGGAGGAAGG - Intronic
1151724787 17:75877681-75877703 ATGGAGATGGGAAGGGAGGAAGG - Intronic
1151875889 17:76868236-76868258 TTGGCTCAGGGGAAGGAGCAGGG + Intergenic
1151956505 17:77382822-77382844 GAGGCAAAGGCGAGGGAGGAGGG + Intronic
1151960532 17:77403182-77403204 AGGGCTTGGGGAAGGGAGGAGGG + Intronic
1152112968 17:78367319-78367341 CCGGCAAGGGGGAGGGAGGAAGG - Intergenic
1152370349 17:79884072-79884094 ATGGCGAAAGGCAAGGAGGAAGG - Intergenic
1152610944 17:81314765-81314787 ATGGCTGAGGCCAGGGAGGTCGG + Intronic
1152615069 17:81334189-81334211 AGGGCAGGGGGGAGGGAGGAGGG - Intergenic
1152859083 17:82685215-82685237 ATGGGGAGGGGGAGGGAGGACGG + Intronic
1153612963 18:6906420-6906442 GTGGCTAAAGGCAGGGAGAATGG - Intronic
1153675314 18:7451805-7451827 TGGCCTAAGGGGAGGGGGGAAGG - Intergenic
1154095775 18:11413744-11413766 AAGGGGAAGGGAAGGGAGGAAGG - Intergenic
1154172151 18:12060239-12060261 CTGGCTAAAGGAAGAGAGGAAGG + Intergenic
1154234188 18:12587991-12588013 AGAGCTGAGGGGAGGGAGTAGGG - Intronic
1155591958 18:27437169-27437191 ATTGCTGTGGGGAGAGAGGAGGG - Intergenic
1156227408 18:35123021-35123043 ATGGCTCACGGCAGGGAGGGAGG - Intronic
1156311713 18:35928781-35928803 ATGGCTTAGGGCTGGGAGGAGGG + Intergenic
1156461903 18:37326020-37326042 AAGGACCAGGGGAGGGAGGAAGG - Intronic
1156546099 18:37965191-37965213 AGGGGAAAGGGGAGGGAGGGAGG - Intergenic
1156733950 18:40229962-40229984 GTGGGTGGGGGGAGGGAGGAGGG - Intergenic
1157120903 18:44910306-44910328 ATGGCGAAGGGGTGAGCGGAGGG + Intronic
1157177584 18:45465557-45465579 ATGGATGAAGGGAGGGAGGGAGG - Intronic
1157233245 18:45939029-45939051 GTGGCTCAGGGAAGGGAGCACGG + Intronic
1157312964 18:46566186-46566208 GGGGCTGAGGGGAAGGAGGAGGG - Intronic
1157340186 18:46771409-46771431 AAGGCTGATGAGAGGGAGGATGG - Intergenic
1157484351 18:48076412-48076434 GAGGGTAAGGGGAGGGAGGTGGG + Intronic
1157613566 18:48974378-48974400 AGAGCAGAGGGGAGGGAGGAAGG + Intergenic
1157811881 18:50703177-50703199 ATGGAGAAGGGGAGTGAGCATGG - Intronic
1158043642 18:53128689-53128711 AAGGATAAGGCTAGGGAGGAAGG + Intronic
1158860782 18:61590186-61590208 ATGAAGAAGGGGAGGGAGGCAGG - Intergenic
1158874390 18:61719159-61719181 ATAGCTTAAGGGAGGGAGAAAGG + Intergenic
1158888499 18:61851371-61851393 ATTGAAGAGGGGAGGGAGGACGG + Intronic
1159379813 18:67642345-67642367 AGAGCTAAGAGGAGTGAGGATGG + Intergenic
1159595156 18:70376146-70376168 CTGACAAAGGGAAGGGAGGATGG - Intergenic
1160203056 18:76810894-76810916 ATAGCTAAGGAGAAGGTGGAAGG - Intronic
1160544970 18:79647215-79647237 AAGGAAAGGGGGAGGGAGGAAGG + Intergenic
1160658699 19:288153-288175 ATAGCGAAGGGCAGGGAGGCTGG + Exonic
1160671778 19:368464-368486 ATGCCTCTGGGGAGGGAGGGAGG + Intronic
1160692630 19:466888-466910 ATGGCTGGGTGGAGGGTGGATGG + Intronic
1160963918 19:1737253-1737275 ATGGCGACGGGGAGGCAGGAAGG + Intergenic
1161207101 19:3047010-3047032 AAAACTGAGGGGAGGGAGGAGGG - Intronic
1161871679 19:6875334-6875356 ATGGTGATGGGGGGGGAGGATGG + Intergenic
1161915298 19:7223903-7223925 GTGGCTTAGAGGAGGGAAGATGG - Intronic
1161932273 19:7348954-7348976 AGGGCTGAGGGGTGGGAGCAGGG + Exonic
1161958012 19:7506904-7506926 ATGGATTAGGAGAGGGGGGAGGG - Intronic
1162406676 19:10479032-10479054 AGGGCTAAGGGGCGGGGGGGCGG + Intergenic
1162500786 19:11052469-11052491 ATGGCCAGGTGGAGGAAGGAGGG - Intronic
1162733096 19:12730677-12730699 ATGGCTAAGGGGAGGGAGGAGGG + Exonic
1163004530 19:14389200-14389222 AGGGGTAGGGGGAGGGAGAAGGG + Intronic
1163025240 19:14507188-14507210 CTGGCATAGGGGAGGGAGGATGG - Intergenic
1163214794 19:15868476-15868498 ATGGATGGAGGGAGGGAGGAAGG + Intergenic
1163238008 19:16040491-16040513 GTGGAGGAGGGGAGGGAGGAAGG + Intergenic
1163295329 19:16408049-16408071 ATGGATAAGGGAAGGGAAGATGG + Intronic
1163383657 19:16985742-16985764 ATGGGTGGAGGGAGGGAGGAAGG + Intronic
1163632240 19:18423434-18423456 TTGGCAGAGGGGAGGGAGGACGG + Intronic
1163703184 19:18797101-18797123 AGGGAGAGGGGGAGGGAGGAAGG - Intergenic
1163779607 19:19239564-19239586 AGGGAGGAGGGGAGGGAGGATGG - Intronic
1164326964 19:24202293-24202315 TTGGGTCAGGGGAGGGTGGAGGG + Intergenic
1164443465 19:28297979-28298001 AGGGCAATGGGGAGGGGGGAGGG - Intergenic
1164680415 19:30130788-30130810 AGGGAGAAGGAGAGGGAGGAAGG - Intergenic
1164750571 19:30651420-30651442 AAAGCAAGGGGGAGGGAGGAAGG + Intronic
1164794455 19:31014807-31014829 ATGGGAAAAGGGAGGGAGGGAGG + Intergenic
1165654385 19:37520540-37520562 ATGGCTAAATGAAGGGAGGATGG + Intronic
1165724172 19:38100986-38101008 ATGGCAGAGGGAAGGGAGCAAGG - Intronic
1165731730 19:38150223-38150245 CTGGTTGAGGGCAGGGAGGATGG + Intronic
1165910286 19:39221805-39221827 AAGGGGAAGGGAAGGGAGGAAGG - Intergenic
1166052754 19:40270169-40270191 AAGGGTAAGGGGAGGTAGGGTGG - Intronic
1166289556 19:41853693-41853715 ATAGCTAAGGGGAGGGAAGAAGG - Intergenic
1166566274 19:43767451-43767473 GTGGCTAAGGGGGCGGGGGATGG - Intronic
1167019626 19:46863562-46863584 ATGGCTCAGAGAAGGAAGGAGGG - Intergenic
1167120039 19:47511369-47511391 AGGGCAGAGGGCAGGGAGGATGG - Intronic
1167122853 19:47529314-47529336 ATGGCCAGGGGGAGGGAAGATGG - Intronic
1167138694 19:47634269-47634291 ATGGCTGGGATGAGGGAGGAAGG + Intronic
1167208415 19:48117847-48117869 AGGGCTGGGGAGAGGGAGGAAGG + Intronic
1167253006 19:48410852-48410874 CTGGGTAGCGGGAGGGAGGAAGG + Intronic
1167303838 19:48695871-48695893 CCGGCAATGGGGAGGGAGGAGGG + Intergenic
1167596468 19:50430919-50430941 GTGGGAAGGGGGAGGGAGGAAGG + Exonic
1167942181 19:52956754-52956776 TAGGCAAGGGGGAGGGAGGAAGG - Intronic
1168268527 19:55236826-55236848 AGGGCACAGGGGTGGGAGGATGG + Intronic
1168348501 19:55662374-55662396 AGGGATGAGGGGAGGGAGGAGGG - Intronic
1168436872 19:56325145-56325167 ATTGCAATGGGGAGGGAAGAAGG - Intronic
1168464866 19:56594530-56594552 ATGGGTAAGGAGAGGGAGGAGGG - Intergenic
1202698029 1_KI270712v1_random:139642-139664 ATGGAAAAGGAGAGGGAAGAAGG - Intergenic
924982301 2:235341-235363 ATGGGTCAGGGGAGGCAGCATGG + Intronic
924982328 2:235420-235442 ATGGGTCAGGGGAGGCAGCATGG + Intronic
924982362 2:235521-235543 ATGGGTCAGGGGAGGCAGCATGG + Intronic
924982442 2:235770-235792 ATGGGTCAGGGGAGGCAGCATGG + Intronic
924982482 2:235893-235915 ATGGGTCAGGGGAGGCAGCATGG + Intronic
924982508 2:235978-236000 ATGGGTCAGGGGAGGCAGCATGG + Intronic
925561736 2:5203571-5203593 GTGGCTAAAGGAAGGGAGGCTGG - Intergenic
926036346 2:9638728-9638750 ATGACTAAGGGGAAGGAGGGCGG - Intergenic
926141761 2:10372255-10372277 GTGGCTAAGGTGGGGGACGAGGG + Intronic
926244574 2:11113502-11113524 AGGAAGAAGGGGAGGGAGGAAGG - Intergenic
926289490 2:11517189-11517211 AAGGCAAAGGGCAGGGAGGCCGG - Intergenic
926382289 2:12302611-12302633 TTGGCTAAGAGGATGGAGAAGGG - Intergenic
926725482 2:15994233-15994255 AAGGGGAAGGGAAGGGAGGAAGG - Intergenic
926753434 2:16217743-16217765 TTGGTCAAGGGGAGGGAGGGAGG + Intergenic
926794595 2:16608473-16608495 ATGGCCAAGTGGAATGAGGACGG + Intronic
926884183 2:17582221-17582243 AGGGGTGAGGGGAAGGAGGAAGG + Intronic
926974050 2:18495497-18495519 AAGGGGAAGGGGAGGAAGGAAGG - Intergenic
927238758 2:20901734-20901756 TTGGCTGAGTGGAGGGAGAAGGG - Intergenic
927859049 2:26548482-26548504 AGGGCTGTGGGGAGGGAGAATGG - Intronic
927941248 2:27104245-27104267 AGGGCCAAGGGCTGGGAGGAGGG - Intronic
928197593 2:29226661-29226683 ATGTTTAAGTGGAGGCAGGATGG + Intronic
928384213 2:30850851-30850873 TGGGGTGAGGGGAGGGAGGAGGG + Intergenic
928945076 2:36764875-36764897 ATGTCAAAGGGGAAGGTGGATGG + Intronic
929097933 2:38281600-38281622 ATGGGTAGGGGCAGGGGGGAGGG + Intergenic
929484114 2:42339572-42339594 AGGGATAAAGGGAGGGAGGAAGG - Intronic
929841099 2:45464182-45464204 ATGGCTAAGGAAAGTGAAGAAGG - Intronic
929856970 2:45645689-45645711 AGAGCAAAAGGGAGGGAGGACGG + Intergenic
929916626 2:46142172-46142194 ATGGCTCAGGGGTGGGTGTAGGG - Intronic
930029724 2:47050783-47050805 ATGGTTAAGGGAGGGGAGAATGG + Intronic
930031764 2:47062481-47062503 ATGTCTAAATTGAGGGAGGAAGG - Intronic
930712177 2:54559310-54559332 ATAGCAAAGGGGAGGAGGGAGGG + Intronic
930752172 2:54944981-54945003 ATGGGGGAGGGGAGGGAGAAAGG - Intronic
930752757 2:54948618-54948640 AAGGTTAAGCAGAGGGAGGAGGG + Intronic
931133390 2:59366219-59366241 AGGGAGAAAGGGAGGGAGGAAGG + Intergenic
931717641 2:65041822-65041844 ATGGCCATGGGGAGAGAGAAAGG - Intergenic
932220792 2:69997509-69997531 TTTGCACAGGGGAGGGAGGAAGG - Intergenic
932330121 2:70894026-70894048 GTGGCTGAGGGGAGGGAGAAAGG + Intergenic
932337982 2:70941930-70941952 AAGGCCAAGGAGAGGGTGGAAGG + Exonic
933099411 2:78233187-78233209 GTGGCTAAAGGAAAGGAGGATGG + Intergenic
933820186 2:86104190-86104212 AGGTGTAAGGGGAGGGTGGAAGG + Intronic
934279283 2:91597422-91597444 ATGGAAAAGGAGAGGGAAGAAGG - Intergenic
934301968 2:91781764-91781786 ATGGATAGAGGGAGGGAGGGAGG - Intergenic
935480558 2:103582984-103583006 AAGGAGAAAGGGAGGGAGGAAGG - Intergenic
935517597 2:104061497-104061519 ATGGGTGGGGGGAGGGGGGAGGG - Intergenic
935656288 2:105426528-105426550 CTGGCTCAGGGAAGGGAGGAGGG - Intronic
936152722 2:110030524-110030546 ATGGCTCAGGGGAGGGCGGGGGG - Intergenic
936191958 2:110340888-110340910 ATGGCTCAGGGGAGGGCGGGGGG + Intergenic
936228292 2:110678171-110678193 CTGGCTCAAGGGAGGGAGGTGGG - Intergenic
936372923 2:111918054-111918076 GTGGCTAAGGGGAGAGGGAATGG - Intronic
936679850 2:114757346-114757368 AGGGAGAGGGGGAGGGAGGAGGG + Intronic
937346746 2:121130672-121130694 CTGGCTGAGAGGTGGGAGGAGGG - Intergenic
937701448 2:124867109-124867131 ATGATGAAAGGGAGGGAGGAAGG - Intronic
938131192 2:128716739-128716761 TTGGATGAGGGGTGGGAGGATGG + Intergenic
938173436 2:129103112-129103134 ATGGCTTGGAGGATGGAGGAAGG - Intergenic
938191414 2:129284946-129284968 AGGGCTTAGGGGAGGCAGCAAGG - Intergenic
938514898 2:131993450-131993472 ATGGATAAAGGGAGGCAGGAGGG + Intergenic
938548890 2:132361313-132361335 GTGGGGAAGGGGAGGGACGAGGG + Intergenic
938823072 2:134978052-134978074 CTGGAGAAGGGAAGGGAGGAAGG - Intronic
939725265 2:145712013-145712035 ATGGCTAGGAGCAGGGAAGAGGG - Intergenic
939795263 2:146635280-146635302 AATGCGAAGGGGAGTGAGGAGGG - Intergenic
940433694 2:153625221-153625243 ATGGCTCAGGGGAGAGTGGGGGG + Intergenic
940491021 2:154360926-154360948 ATGGGGAAGGGGAGTGAAGATGG + Intronic
940660955 2:156544449-156544471 ATGGCTACAGGGAGGGGTGAAGG + Intronic
941046066 2:160677133-160677155 AGGCCTTAGGGGAGTGAGGATGG + Intergenic
942067059 2:172281349-172281371 TTCACTAAGGGAAGGGAGGAAGG - Intergenic
942186630 2:173430244-173430266 ATGGCTAAGGAGAGGCAGTGTGG - Intergenic
942318408 2:174714973-174714995 AGGGCTGAGAGGAGGCAGGAGGG + Intergenic
942592991 2:177565833-177565855 ATGGGTAGGGGCTGGGAGGAAGG + Intergenic
942960986 2:181829654-181829676 ATGGCAAGGGGTTGGGAGGAAGG - Intergenic
943656303 2:190512635-190512657 ATGGTTAAAGGGAAGGAAGAAGG + Intronic
944186825 2:196958172-196958194 TTGGCTAAGGAGAAGAAGGAAGG - Intergenic
944314063 2:198266681-198266703 ATGCCTGAAGGGAGTGAGGATGG + Intronic
944635254 2:201670119-201670141 ATGGAGAGAGGGAGGGAGGAAGG + Intronic
944687180 2:202127960-202127982 AGGGGCTAGGGGAGGGAGGAGGG - Intronic
944839701 2:203613167-203613189 AGGGCTAAGGGTGGGGAGAAGGG + Intergenic
945264971 2:207881916-207881938 AAGCCTAAGGGCAGGCAGGAGGG - Intronic
945463615 2:210141133-210141155 GTGGGGAAGGGAAGGGAGGAAGG - Intronic
945769284 2:214020208-214020230 ATGGCCAAGGGCATGGAAGAAGG - Intronic
946229829 2:218284384-218284406 TTGGCTCAGAGGAGGGAGCAGGG - Intronic
946553085 2:220823842-220823864 AAGAGGAAGGGGAGGGAGGAAGG - Intergenic
946621721 2:221570244-221570266 ATGTTGAAGGGGAGGGAGGGAGG - Intronic
947077746 2:226363986-226364008 AGGGAGGAGGGGAGGGAGGAGGG + Intergenic
947077751 2:226363998-226364020 AGGGAGGAGGGGAGGGAGGAAGG + Intergenic
947077793 2:226364105-226364127 AGGGAGGAGGGGAGGGAGGAGGG + Intergenic
947077799 2:226364117-226364139 AGGGAGGAGGGGAGGGAGGAGGG + Intergenic
947077804 2:226364129-226364151 AGGGAGGAGGGGAGGGAGGAAGG + Intergenic
947077824 2:226364177-226364199 AGGGAGGAGGGGAGGGAGGAAGG + Intergenic
947077841 2:226364213-226364235 AGGGAGGAGGGGAGGGAGGAGGG + Intergenic
947077847 2:226364225-226364247 AGGGAGGAGGGGAGGGAGGAGGG + Intergenic
947077853 2:226364237-226364259 AGGGAGGAGGGGAGGGAGGAGGG + Intergenic
947077859 2:226364249-226364271 AGGGAGGAGGGGAGGGAGGAGGG + Intergenic
947077865 2:226364261-226364283 AGGGAGGAGGGGAGGGAGGAGGG + Intergenic
947077870 2:226364273-226364295 AGGGAGGAGGGGAGGGAGGAAGG + Intergenic
947077884 2:226364309-226364331 AGGGAGGAGGGGAGGGAGGAAGG + Intergenic
947179312 2:227398054-227398076 CTGGACAAGGGGAAGGAGGATGG - Intergenic
947403687 2:229753084-229753106 ATGGCTAACCGGATGAAGGAAGG - Intergenic
947634565 2:231673464-231673486 GTGGGGAAGGGGAGGGAGCAGGG - Intergenic
947744858 2:232502253-232502275 ATGGGGGAGGGGTGGGAGGAGGG + Intergenic
948061345 2:235045037-235045059 ATGGCTGATGGGAGGGACGCAGG - Intronic
948424442 2:237878287-237878309 AGGGCCAGGGGCAGGGAGGAGGG + Intronic
948840066 2:240644501-240644523 ATGCCTGAGGCGAGGGAGCAGGG + Intergenic
948996478 2:241582629-241582651 AGGGCACAGGGGAGGGAAGAGGG + Intergenic
1168904084 20:1390339-1390361 CTGGCCATGGGGAGGGGGGAGGG + Intronic
1169004706 20:2196892-2196914 ATGGAGAAGGGCATGGAGGAGGG + Intergenic
1170607287 20:17883654-17883676 AGGGGCAAGGGGAGGGAGAAGGG + Intergenic
1170705242 20:18738568-18738590 ATGGCCAAGGATAGGAAGGAAGG + Intronic
1170783831 20:19450433-19450455 GTGGCAGAGGGGAGGGAGGTTGG + Intronic
1170926432 20:20728812-20728834 CTGGCAAAGGGGAGGAAGAATGG - Intergenic
1171168671 20:22995881-22995903 ATGGCCAAGCAGAGGGAGGGAGG - Intergenic
1171328517 20:24317539-24317561 AGGGCAAAGGGCAGGGAGCAAGG - Intergenic
1171349672 20:24492766-24492788 AAGGCAAAGGGGAAGGAAGATGG - Intronic
1171877713 20:30593840-30593862 GTGGGGAAGGGGAGGGACGAAGG + Intergenic
1172202397 20:33135714-33135736 ATGGGGAAGGGGAGTGAGGGGGG + Intergenic
1172292132 20:33784120-33784142 ATGGGGAAGAGGAGGGAGAAGGG - Intronic
1172989971 20:39028148-39028170 GTGGCTTAGGGGAGGTTGGAGGG + Intronic
1173635541 20:44553780-44553802 ACGGGTGAGGGGAGGAAGGAAGG + Intronic
1173827044 20:46054816-46054838 AAGGCCAAGGGAAGGAAGGAAGG - Intronic
1174058194 20:47814071-47814093 AGGGCTGAGGGGAAGGAGAATGG + Intergenic
1174066660 20:47870736-47870758 AAGGCAAAGAGGAGGGAGGAAGG + Intergenic
1174130653 20:48341488-48341510 CTGGCTAGGTGGAGAGAGGAAGG - Intergenic
1174516853 20:51099138-51099160 CTGCAGAAGGGGAGGGAGGAGGG + Intergenic
1174595544 20:51680478-51680500 AAGGATAAGGGGAGGGATGGAGG - Intronic
1174745013 20:53053036-53053058 AGGGCTCAGGGAAGGGAGGAAGG - Intronic
1174898635 20:54475877-54475899 GTGGCTCTGGGGAGGGTGGAGGG - Exonic
1174937057 20:54882308-54882330 TTGGGTGCGGGGAGGGAGGAGGG - Intergenic
1175131448 20:56792703-56792725 CTTGCGAAGGGGAGGCAGGAGGG + Intergenic
1175294702 20:57900293-57900315 AAGGTTGAGGGGAGGGAGGGAGG + Intergenic
1175333479 20:58179957-58179979 AGGGCTAGGGGGAAGCAGGACGG + Intergenic
1175565007 20:59967737-59967759 AAGGGGAAGGGAAGGGAGGAAGG - Intronic
1175872544 20:62215272-62215294 AAGCCTTAGCGGAGGGAGGAGGG + Exonic
1175984022 20:62755320-62755342 ATGGATGGAGGGAGGGAGGAAGG - Intronic
1175984136 20:62755659-62755681 ATGGATGGAGGGAGGGAGGATGG - Intronic
1175984161 20:62755733-62755755 ATGGCTGGAGGGAGGGAGGGAGG - Intronic
1175984169 20:62755752-62755774 ATGGCTGGAGGGAGGGAGGATGG - Intronic
1175984182 20:62755791-62755813 ATGGCTGAAGGGAGGGATGGAGG - Intronic
1175984188 20:62755810-62755832 ATGGATGGAGGGAGGGAGGATGG - Intronic
1175984203 20:62755849-62755871 ATGGGTGGAGGGAGGGAGGATGG - Intronic
1176209839 20:63913970-63913992 CTGCCTGAGGGGTGGGAGGATGG - Intronic
1176546533 21:8204703-8204725 ATGGCGAAAGGGAAGGAGGGAGG - Intergenic
1176554427 21:8248894-8248916 ATGGCGAAAGGGAAGGAGGGAGG - Intergenic
1176565484 21:8387750-8387772 ATGGCGAAAGGGAAGGAGGGAGG - Intergenic
1176573349 21:8431918-8431940 ATGGCGAAAGGGAAGGAGGGAGG - Intergenic
1176736411 21:10551286-10551308 TTGGGTAGGGGGAGGGGGGAGGG + Intronic
1176778885 21:13169465-13169487 ATGGATAAAGGGAGGCAAGAGGG - Intergenic
1177164670 21:17586879-17586901 TGGGGTGAGGGGAGGGAGGAGGG - Intronic
1177256776 21:18673405-18673427 ATTGCTAAGGGGTGGCATGATGG + Intergenic
1177447582 21:21217783-21217805 ATGCAGAAGGGGAGGGTGGAGGG + Intronic
1177833566 21:26167248-26167270 GGGAGTAAGGGGAGGGAGGAGGG + Intronic
1177976530 21:27858616-27858638 ATGGATAAAGGGAGGCAGGAGGG - Intergenic
1178072447 21:28983674-28983696 ATGGCTAATTGAAAGGAGGAAGG + Intronic
1178379137 21:32093566-32093588 AGGGGTAAGGGAAGGAAGGAAGG - Intergenic
1178701876 21:34840862-34840884 AAGGCTTAAGGGAGAGAGGAGGG - Intronic
1178857221 21:36260225-36260247 AAGGGGAAGGGAAGGGAGGAAGG + Intronic
1179302516 21:40125055-40125077 ATGACTAGGGTGAGGGAGGGTGG - Intronic
1179378172 21:40870818-40870840 AAGCCTCAGGGGAGGGAGGTTGG + Intergenic
1179429104 21:41306899-41306921 ATGTCAAATGGGAAGGAGGAAGG - Intronic
1179482412 21:41686550-41686572 ATGGAAAAAGGGAGGAAGGAAGG + Intergenic
1179958691 21:44756047-44756069 ATGGAGAAGAAGAGGGAGGAGGG + Intergenic
1180103030 21:45598755-45598777 ATGGCTGCGGCGAGGGGGGAGGG + Intergenic
1180814461 22:18780959-18780981 ATGGATAGAGGGAGGGAGGGAGG + Intergenic
1181200649 22:21215295-21215317 ATGGATAGAGGGAGGGAGGGAGG + Intronic
1181386315 22:22548385-22548407 GTGGCTCAGGGAAGGCAGGAGGG + Exonic
1181389803 22:22571959-22571981 AAGGGGAAGGGAAGGGAGGAAGG + Intergenic
1181877122 22:25948333-25948355 ATGGGTAAGCGGTGGTAGGATGG - Intronic
1181885306 22:26017367-26017389 AAGGAGGAGGGGAGGGAGGAAGG - Intronic
1181958982 22:26609478-26609500 ATGGATAAAGGGATGGATGAAGG + Intronic
1181986391 22:26802702-26802724 TTGGCTGAGGGGAGGAAGGGTGG + Intergenic
1182093026 22:27608962-27608984 ATGGCTAGGAGGAGAGAGGAGGG + Intergenic
1182150274 22:28022645-28022667 AGGGCTCAGTTGAGGGAGGAAGG - Intronic
1182373462 22:29828736-29828758 ATGGGGAAAGGGTGGGAGGAAGG + Intronic
1182442511 22:30372560-30372582 ATGGCTAAGGGGTGCAGGGAGGG + Intronic
1182592678 22:31394192-31394214 CTGGCTTGGGGGAGGGAGGGGGG - Intergenic
1183064799 22:35355380-35355402 AGTGCTAAGGGGAGGGAGGAGGG + Intergenic
1183112001 22:35657281-35657303 ATGGGGAAGGGGTGGGATGAAGG - Intronic
1183153172 22:36053779-36053801 AGGGAGAAGGGAAGGGAGGAGGG - Intergenic
1183153185 22:36053810-36053832 AGGGAGAAGGGAAGGGAGGAGGG - Intergenic
1183438223 22:37807724-37807746 ATGGCAGAGGGGAGGGAAGGGGG - Intergenic
1183474161 22:38026781-38026803 AGGGATGGGGGGAGGGAGGAGGG - Intronic
1183716468 22:39536094-39536116 ATGGGCTAGGGGAGGGAGGGCGG - Intergenic
1184191075 22:42894915-42894937 ATGGGCAAGGGGAGGGAAGGGGG + Intronic
1184209249 22:43025600-43025622 AGTGCTCAGGGGAGTGAGGAGGG - Intergenic
1184424935 22:44403805-44403827 AAGGCTGAGAGGAGGGAGAAGGG + Intergenic
1184852342 22:47128055-47128077 ATGGGTGAGGGGAGGGGGGATGG - Intronic
1184981168 22:48096964-48096986 ATGGCAGGGGGCAGGGAGGAGGG - Intergenic
1185234796 22:49705426-49705448 AAGGCGGAGGGGAGTGAGGAGGG + Intergenic
1185269638 22:49923112-49923134 CTGGGGAAGGGCAGGGAGGAGGG - Intronic
1203226268 22_KI270731v1_random:80140-80162 ATGGATAGAGGGAGGGAGGGAGG - Intergenic
1203251396 22_KI270733v1_random:120965-120987 ATGGCGAAAGGGAAGGAGGGAGG - Intergenic
1203259442 22_KI270733v1_random:166039-166061 ATGGCGAAAGGGAAGGAGGGAGG - Intergenic
1203264560 22_KI270734v1_random:6646-6668 ATGGATAGAGGGAGGGAGGGAGG + Intergenic
949504391 3:4713552-4713574 ATGGGTAGGGGCAGGGAGCAGGG - Intronic
950149623 3:10676495-10676517 ATGGGGATGGGGAGGGAGGAGGG + Intronic
950174488 3:10863238-10863260 AGGGCTAAGTAGAAGGAGGAAGG + Intronic
950505716 3:13393239-13393261 ATGGACAAGGGGATGGAGGTGGG + Intronic
950522432 3:13505101-13505123 ATGACCAAGGGGAGGGAGGGAGG - Exonic
950526915 3:13529577-13529599 ATGGATAAAGGGAGGGATGGAGG - Intergenic
950572390 3:13809467-13809489 ATGGCAGAGGGGAAGGAGGTGGG + Intergenic
951272235 3:20640251-20640273 ATGGCTCACAGGAGGGAGGAAGG + Intergenic
951297196 3:20952468-20952490 GTGGGGAAGGGTAGGGAGGAGGG + Intergenic
952174068 3:30842547-30842569 ATGGAGAAAGGGAGGAAGGAAGG + Intronic
952436962 3:33281185-33281207 AGGGGTAGGGGGAGGGCGGAGGG - Intronic
952759516 3:36901714-36901736 GTGGGGAAGGGGAGAGAGGATGG + Intronic
952767560 3:36968150-36968172 ATGGGGTAGGGGAGGGGGGAGGG - Intergenic
953277302 3:41514774-41514796 AAGGGTGAGGGGTGGGAGGAAGG + Intronic
953338602 3:42115308-42115330 AGGGCAAAGGAAAGGGAGGAAGG - Intronic
953340984 3:42134147-42134169 AAGGGGAAGGGGAGGAAGGAAGG - Intronic
953815994 3:46157226-46157248 ATGGCAGAGGGTAGGAAGGATGG - Intergenic
953936494 3:47048690-47048712 CTGGCGAGGAGGAGGGAGGAGGG - Intronic
954063651 3:48088995-48089017 GTGGCGAGGGGGAGGGCGGAGGG + Exonic
954245154 3:49325644-49325666 GTGGCTGATGGGAGGGAAGAGGG - Intronic
954449361 3:50563363-50563385 GGGTCTCAGGGGAGGGAGGAGGG - Intronic
955029746 3:55204774-55204796 ATGGATAGAGGGAAGGAGGAGGG - Intergenic
955040220 3:55309434-55309456 ATAGCTCAGGGGAGGTAGGGTGG + Intergenic
955845380 3:63157025-63157047 GGGGCTTAGGGGAGAGAGGAGGG + Intergenic
955867071 3:63396400-63396422 ATGTCTAGGGGGAGGAAGGAGGG + Intronic
955895039 3:63689890-63689912 TTGGGTGAGGGGAGGGGGGAGGG + Intergenic
955932903 3:64075831-64075853 AAGGGTAGGGGGAGGGAGGTGGG - Intergenic
956041831 3:65152885-65152907 AGGGCTTAGGGTAGTGAGGAGGG + Intergenic
956532099 3:70231999-70232021 ATGGCTAAGGGGAAGAAGGGTGG - Intergenic
956690720 3:71875616-71875638 CCTGCTAAGGGGAGGGAGGAGGG + Intergenic
956758842 3:72419377-72419399 ATGGATAAGGGGAGAAAGGAAGG + Intronic
956769217 3:72510264-72510286 ATGGAGGATGGGAGGGAGGAAGG + Intergenic
956861295 3:73326644-73326666 ATGGCAGAGGGGAGAAAGGAGGG - Intergenic
957262173 3:77916553-77916575 ATTGCTAGGAGCAGGGAGGAGGG - Intergenic
957859033 3:85919384-85919406 ATGGCTGAAGGAAAGGAGGAAGG + Intronic
958832270 3:99103944-99103966 ATAGCTAAGGGGTGCGAGAATGG + Intergenic
959007978 3:101042205-101042227 ATGGCTACAGAGAAGGAGGAAGG - Intergenic
960128286 3:114024700-114024722 TGGGGTAGGGGGAGGGAGGAGGG + Intronic
960315622 3:116172914-116172936 ATGGCTACTGGGAAAGAGGATGG + Intronic
960902044 3:122563605-122563627 ATGGGTGAGGGGATGAAGGAGGG - Intronic
960993014 3:123323975-123323997 TTTGCTCAGGGGAGGGAGGGTGG + Intronic
961213188 3:125141373-125141395 TTGGCTAAGGGGAGGAGGGTAGG - Intronic
961267260 3:125653595-125653617 ATAGCTAAGGGGAGACAGTAAGG + Intergenic
961367359 3:126408584-126408606 ATGTCCAAGGGCAGGAAGGATGG - Intronic
961467367 3:127089990-127090012 ATGACTGGGGGCAGGGAGGAAGG + Intergenic
961603723 3:128078501-128078523 GTGGCTGAGGAGAGGGAGGGAGG - Intronic
961660268 3:128464929-128464951 AGGGGGAAGGGGAGGGAGGAAGG - Intronic
961740470 3:129030403-129030425 ATGTCTAAAGGCAGGAAGGAAGG + Intronic
962073527 3:132056610-132056632 TTGGGTGAGGGGAGGGGGGAGGG - Intronic
962894731 3:139704151-139704173 GTGGGTAAGGTGGGGGAGGAGGG + Intergenic
963472414 3:145757741-145757763 ATGTCTAAGGATAGGTAGGATGG + Intergenic
963954330 3:151236550-151236572 ATGGCATGGGGGTGGGAGGATGG - Intronic
964763156 3:160153377-160153399 AGGGGCAAGAGGAGGGAGGAAGG - Intergenic
965341626 3:167498430-167498452 ATGGCAAATGGCAGGGTGGAGGG + Intronic
965356567 3:167681499-167681521 ATGGATCAGGGGAGAAAGGAGGG + Intergenic
965701377 3:171461482-171461504 ATGGCTAAGGCGGGAGAAGAAGG - Intergenic
965783034 3:172307826-172307848 TGGGCAAAGGGGTGGGAGGAGGG + Intronic
966461403 3:180180625-180180647 AGGGAGAAAGGGAGGGAGGAAGG + Intergenic
966946322 3:184779451-184779473 AAGGCTAAGGGGAAGGAGCTCGG + Intergenic
967036197 3:185649811-185649833 AGGGCTAAGGGGATGGGTGAGGG + Intronic
967279162 3:187805648-187805670 CTGGCTTGGGGGATGGAGGAAGG + Intergenic
967507200 3:190266016-190266038 ATAGAAAAGGGGAAGGAGGAGGG + Intergenic
968007002 3:195249936-195249958 CTGGCTCTGGGGAGAGAGGATGG - Intronic
968132413 3:196199255-196199277 TGGGCGAAGGGGAGAGAGGAGGG - Intronic
968530199 4:1087212-1087234 ATGGGGTAGGGGAGAGAGGACGG + Intronic
968624736 4:1622036-1622058 AGGGCAGAGGGGAAGGAGGAAGG - Intronic
968935820 4:3609895-3609917 ATGGATGAGTGGATGGAGGATGG - Intergenic
969031472 4:4218471-4218493 ATGGAAAAGGAGAGGGAAGAAGG + Intronic
969315608 4:6379957-6379979 GTGGAGAAGGGGAGGTAGGAGGG - Intronic
969499509 4:7544176-7544198 ATGGATGAAGGGATGGAGGATGG - Intronic
969780149 4:9395020-9395042 ATGGCTGGGGGGAGGCAGAAGGG + Intergenic
970451064 4:16166865-16166887 ATGGCTAAGGAGAAGGTGGGGGG + Intronic
970518367 4:16857909-16857931 TGGGCTGAGGGGAGGGAGGGAGG - Intronic
970689978 4:18611627-18611649 AAGGTGAAAGGGAGGGAGGAAGG + Intergenic
970690142 4:18612087-18612109 AAGGTGAAAGGGAGGGAGGAAGG + Intergenic
970690228 4:18612325-18612347 AAGGTGAAAGGGAGGGAGGAAGG + Intergenic
971494971 4:27254383-27254405 ATGGGTAAGGGGAGATGGGAGGG + Intergenic
972396052 4:38660802-38660824 ATGGTGAAGAGGAGGGAAGAGGG - Intergenic
972712264 4:41609147-41609169 AGGGAAAAGGGGAGGGAGCATGG + Intronic
973779263 4:54272890-54272912 AGGACTCGGGGGAGGGAGGAGGG - Intronic
974671767 4:65039508-65039530 ATCACTGAGGGGTGGGAGGATGG - Intergenic
975012187 4:69370245-69370267 ATGGTGAAGGGGTGTGAGGATGG - Intronic
975160741 4:71121213-71121235 ACAGCCAAGGGGAGGGGGGAGGG - Intergenic
975328580 4:73087974-73087996 AAGGAAAAGGGGAGAGAGGAAGG + Intronic
975340039 4:73229133-73229155 TGGGGTAGGGGGAGGGAGGAGGG + Intronic
976437562 4:85035434-85035456 AAAGCTAAGGAAAGGGAGGAAGG - Intergenic
977497089 4:97790629-97790651 ATGGCCTCGAGGAGGGAGGAGGG - Intronic
977728070 4:100320798-100320820 AAGGAGAAGGGAAGGGAGGAAGG - Intergenic
978145800 4:105369788-105369810 AGGGATAAGAGGAGGGAGAAGGG + Intronic
978279437 4:106992414-106992436 ATGGCCAAGAGGTGGGAAGAGGG - Intronic
978543068 4:109839603-109839625 AAGGGTAGAGGGAGGGAGGAGGG - Intronic
979317513 4:119281977-119281999 ATTGCCAAGGGCTGGGAGGAGGG - Intronic
979548030 4:121959149-121959171 CTGGCTAATGGGAGGTAGGAAGG - Intergenic
980165598 4:129223004-129223026 ATGGCTAAGGGGCTGCAGGTTGG + Intergenic
980399392 4:132259990-132260012 TGGGGTAGGGGGAGGGAGGAGGG + Intergenic
980654803 4:135767512-135767534 AGGGGTAAGGGGAAAGAGGAGGG + Intergenic
980724538 4:136741671-136741693 ATGACTAAGGGAAGTGAGTAAGG + Intergenic
981157280 4:141453922-141453944 ATGGCAAAAGGGAGGGAGGGAGG - Intergenic
981453036 4:144921029-144921051 ATGGCCAAGGGGCGAGAGGCTGG + Intergenic
981495758 4:145390544-145390566 ATGGAGAAGGGGAGAGAGGGAGG + Intergenic
981676636 4:147350366-147350388 ATGGATGGAGGGAGGGAGGAAGG + Intergenic
982219929 4:153115558-153115580 ATGGAGCAGGGGAGGGAGGCAGG + Intergenic
982316527 4:154037546-154037568 ATGGCAAAGGAGAAGGAGGTTGG - Intergenic
982602718 4:157471521-157471543 ATGGCTAAGGTCAGGTAGTAAGG + Intergenic
982742612 4:159073625-159073647 CTGGATTAGGAGAGGGAGGATGG - Intergenic
982908638 4:161112008-161112030 ATTGCTAAGGGGTGTGGGGAGGG - Intergenic
982999551 4:162396808-162396830 ATGGCGTATGGGTGGGAGGAAGG + Intergenic
983317845 4:166154836-166154858 GTGGCTAAGAGGAGAGAGAAGGG + Intergenic
983691058 4:170469620-170469642 AGGGCAGAAGGGAGGGAGGAAGG - Intergenic
983758207 4:171369138-171369160 ATGGTTAAGTGTAGTGAGGAAGG + Intergenic
983846877 4:172531684-172531706 CTGGCTGAGGGGAGAGAGGGTGG + Intronic
983932293 4:173465768-173465790 AGGGGGAAGCGGAGGGAGGAAGG - Intergenic
984070343 4:175103405-175103427 AAGGGAGAGGGGAGGGAGGAGGG + Intergenic
984070364 4:175103458-175103480 AAGGGAGAGGGGAGGGAGGAGGG + Intergenic
984201385 4:176724913-176724935 AGGGGCAAGGGTAGGGAGGATGG + Intronic
984206438 4:176792720-176792742 TCGGGGAAGGGGAGGGAGGAGGG - Exonic
984747130 4:183232432-183232454 AGGGCTCAGAGGATGGAGGAGGG - Intronic
985542208 5:492354-492376 ATGGGGGAGGGGAGGGAGGTAGG + Intronic
985805060 5:2037703-2037725 ATGGGAGAGGGGAGAGAGGAGGG - Intergenic
986021994 5:3812940-3812962 AGGGCTGTGGGGAGGCAGGATGG + Intergenic
986681001 5:10232748-10232770 ATGGCCCAGGGGAGGCTGGAGGG + Intronic
987989173 5:25189091-25189113 ATGGTTTAGAGGAGGTAGGAGGG - Intergenic
988635864 5:32983702-32983724 ATGGCACAGAGAAGGGAGGAAGG + Intergenic
988675360 5:33427850-33427872 CTGGCTATGGGAGGGGAGGATGG + Intergenic
988801198 5:34698154-34698176 AGGGAGGAGGGGAGGGAGGAAGG - Intronic
989004065 5:36790141-36790163 GTGGCTGGGGGAAGGGAGGATGG - Intergenic
989069647 5:37497233-37497255 AAGGGAAAAGGGAGGGAGGAGGG - Intronic
989206570 5:38815311-38815333 AGGGCTTAGGGCTGGGAGGAGGG - Intergenic
989284392 5:39682656-39682678 TGGGGTGAGGGGAGGGAGGAGGG - Intergenic
990241453 5:53820203-53820225 GTGGCTGAGGGGAGGAAGGGAGG + Intergenic
990606018 5:57410893-57410915 ATGGCTAGTGGGAGGGAGCAGGG + Intergenic
991156302 5:63440574-63440596 ATGGCAGAGGGCAGGGAGGTGGG - Intergenic
991229378 5:64313299-64313321 ATGGGTAAAGGGAGAGAGGAAGG - Intronic
991434825 5:66587011-66587033 GGGGCTAAGGGGAGGGGAGATGG + Intergenic
991563693 5:67982525-67982547 TGTGGTAAGGGGAGGGAGGAGGG + Intergenic
992489055 5:77223375-77223397 ATGGGTGGGGGGAGGGGGGAGGG - Intronic
993204587 5:84863344-84863366 AGGGGGGAGGGGAGGGAGGAAGG - Intergenic
993204634 5:84863465-84863487 AGAGGGAAGGGGAGGGAGGAAGG - Intergenic
993374628 5:87135646-87135668 AGGGGAGAGGGGAGGGAGGAGGG + Intergenic
993679168 5:90853866-90853888 ATGGCTAAGGCGGGGTAGAAAGG + Intronic
993899125 5:93572510-93572532 GTGGCTGCGGGGAGCGAGGAGGG - Intergenic
994029796 5:95128661-95128683 CTGGGGAAGGGGAGGAAGGATGG + Intronic
994843804 5:104959220-104959242 AGGGGTAAGGGGAGGGATAAGGG + Intergenic
995327548 5:110908086-110908108 ATGGGGTAGGGGAGGGGGGAGGG + Intergenic
995405111 5:111785896-111785918 ATGGATAGGGAGAGGGAAGAGGG + Intronic
995508800 5:112887205-112887227 ATGGGTAACAGGAGGGTGGAGGG + Intronic
995649524 5:114354308-114354330 ATGGTTAAAGGGAGGTATGATGG - Intergenic
996630601 5:125626782-125626804 TGGGGTAAGGGGAGGGGGGAGGG + Intergenic
996777328 5:127146654-127146676 ATGGGTGGGGGGAGGGGGGAGGG + Intergenic
996929426 5:128868554-128868576 ATGGCTAAGGTGAAGGATGAAGG + Intronic
997411849 5:133696719-133696741 AGGGCTGTGGGGAAGGAGGAGGG + Intergenic
997844685 5:137275964-137275986 AGGGCTCAGGGGAGGCAGGGAGG - Intronic
998540843 5:142980050-142980072 AGGGAGAAGGGGAGCGAGGAAGG - Intronic
999182671 5:149681109-149681131 GTGGAGCAGGGGAGGGAGGAGGG - Intergenic
999692758 5:154162935-154162957 AAGGCTCAGGGGAGGGAAGCGGG - Intronic
999704915 5:154263484-154263506 AGGGCTCAGGGGAGGGAGAAGGG + Intronic
999777624 5:154823593-154823615 CTGCCCAAGGGAAGGGAGGAGGG + Intronic
1000019880 5:157309912-157309934 AGGGATCTGGGGAGGGAGGAGGG - Intronic
1000101809 5:158023839-158023861 AGGGCTAAGGGGAGGTATGCAGG - Intergenic
1000612967 5:163395429-163395451 AGGGGGAAGGGGTGGGAGGAGGG + Intergenic
1001089023 5:168723329-168723351 ATGGATGGTGGGAGGGAGGAAGG - Intronic
1001092395 5:168751042-168751064 GAGGCTAGGGGGAGGGAGGCTGG + Intronic
1001191535 5:169637169-169637191 CTGCCCAACGGGAGGGAGGAGGG + Intergenic
1001634314 5:173198824-173198846 AGGGAGAAAGGGAGGGAGGAAGG - Intergenic
1001765377 5:174241882-174241904 AAGGTCAGGGGGAGGGAGGAAGG - Intronic
1002292837 5:178211358-178211380 AGGCCTATGGGGAGTGAGGATGG + Intronic
1002453524 5:179332694-179332716 AGGGCAGAGGGGAGGGAGGGAGG + Intronic
1002808747 6:604730-604752 GTGGCTGAGTGGAGGGAGGCAGG - Intronic
1003064864 6:2895257-2895279 GTGGGTGAGGAGAGGGAGGAGGG + Intronic
1003281500 6:4696115-4696137 GTGGCTGAGGGGAGGGGAGATGG + Intergenic
1003863312 6:10341533-10341555 ATTGCTAAGGAAAGGGAGGAAGG + Intergenic
1004339777 6:14798193-14798215 AAGGGTTGGGGGAGGGAGGAAGG + Intergenic
1004682825 6:17913190-17913212 ATAGCAAAGGGCAGGCAGGACGG + Intronic
1004751301 6:18565463-18565485 ATGAAAAAAGGGAGGGAGGATGG - Intergenic
1004827728 6:19441867-19441889 ATGGATAAAGGAAGAGAGGAAGG + Intergenic
1006077380 6:31542440-31542462 CTAGCTGAGGGGAGGGAGGAGGG + Exonic
1006384195 6:33720122-33720144 ATGGGTGAGGGGAGGGCGGGTGG - Intergenic
1006473279 6:34239997-34240019 AGGGGTAAGGGGAAAGAGGAGGG + Intronic
1006511810 6:34525648-34525670 CTGGCTGGGGGAAGGGAGGAGGG + Intronic
1006717998 6:36132272-36132294 AAGCATAAGGGGAGGGTGGAAGG - Intronic
1006806446 6:36792538-36792560 ATGTGTCACGGGAGGGAGGAAGG + Intronic
1006882793 6:37354325-37354347 GGGGCTCCGGGGAGGGAGGAAGG + Intronic
1007103476 6:39267583-39267605 AGGGCTCATGGGAAGGAGGAGGG - Intergenic
1007116183 6:39344985-39345007 ATGGAAAAGGGGATGGGGGAGGG - Intronic
1007133166 6:39495831-39495853 ATGGGGGAGGGGATGGAGGAGGG + Intronic
1007270888 6:40636160-40636182 ATCCCTACAGGGAGGGAGGAAGG + Intergenic
1007483781 6:42166879-42166901 GGGGCCGAGGGGAGGGAGGATGG - Intronic
1007514374 6:42399706-42399728 ATGGGGAAGGAGAGGGAGTAGGG + Intronic
1007643297 6:43360920-43360942 ATGGCTGGGGGTAGGGTGGAGGG + Intronic
1007741045 6:44009636-44009658 AGGGAGAAAGGGAGGGAGGAAGG + Intergenic
1007762097 6:44139224-44139246 ATGGAGAAGGGGAGGGATGAAGG - Intronic
1008050967 6:46899802-46899824 ATGGCAATGGGGAGGGAAGGAGG + Intronic
1008949629 6:57141873-57141895 AGGGCTGAGGGGAGGAAGGTTGG + Intronic
1009508168 6:64512477-64512499 ATGGCCCAGGGGAAGGGGGAGGG + Intronic
1010682263 6:78810637-78810659 ATGGGTAAAGAGAGGAAGGAAGG - Intergenic
1011331537 6:86212628-86212650 TGGGGTAGGGGGAGGGAGGAGGG + Intergenic
1011445248 6:87432457-87432479 ATGGAGAGGGGGAGGCAGGAGGG - Intronic
1011621008 6:89242612-89242634 ATGGAAAAGGGAAGGAAGGAAGG + Intergenic
1012420336 6:99057708-99057730 ATTGCTAAAGAAAGGGAGGAAGG - Intergenic
1012818288 6:104052894-104052916 ATGAGTAGGGGGAGGAAGGAAGG + Intergenic
1013381898 6:109581288-109581310 ATGGCTAAGCTTAGTGAGGAAGG + Intronic
1014002475 6:116380259-116380281 ATGTCTAGGTGGAGGGAAGAGGG + Intronic
1014002538 6:116380937-116380959 CTGGCTAAGGTGAAGAAGGAAGG - Intronic
1014307897 6:119765394-119765416 TTGGATAAGGGGAAGGAGGGTGG + Intergenic
1014538732 6:122648942-122648964 ATGGCCATGGGGAGGCATGAAGG - Intronic
1014623994 6:123703674-123703696 ATGTCTATGGGAAGGCAGGAAGG + Intergenic
1015153086 6:130060831-130060853 CTGGCTCAAGGGAGGGAGCAAGG - Intronic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015592368 6:134834073-134834095 GTGGGTTAGGGGAGGGAGGGAGG + Intergenic
1015645222 6:135379961-135379983 AGGGTGAAGGGGAGGGAGGGAGG - Intronic
1015742026 6:136467059-136467081 ATGGCTATGGGCTGGGAGTAGGG + Intronic
1016123972 6:140376451-140376473 AGGGCTAGAGGGAGGGAGGGAGG - Intergenic
1016124003 6:140376566-140376588 AGGGCTAGAGGGAGGGAGGGAGG - Intergenic
1017156196 6:151324551-151324573 ATTGCTTGGGGCAGGGAGGAGGG - Intronic
1017163913 6:151390767-151390789 TTGGGGGAGGGGAGGGAGGAGGG - Intronic
1017491138 6:154946208-154946230 GTGGGGAAGGGGAGGGTGGAAGG - Intronic
1017502211 6:155036164-155036186 ATGAATAAAGGAAGGGAGGAGGG + Intronic
1017627084 6:156359629-156359651 CTGGCAAAGAGGAGGGAAGATGG - Intergenic
1017813248 6:157999389-157999411 CAGGCTAAGGGGAGGGAGACAGG - Intronic
1017869697 6:158476535-158476557 ATCTCGAAGGCGAGGGAGGATGG - Intronic
1017986519 6:159447598-159447620 GTGGTTCAGGGGAGGGAGCAGGG - Intergenic
1018029946 6:159834011-159834033 CTGTCTTAGGGTAGGGAGGAGGG - Intergenic
1018423277 6:163658547-163658569 AAAGGGAAGGGGAGGGAGGAAGG - Intergenic
1018757971 6:166865920-166865942 ATGGAGAAGGGGAGGGAAGGAGG + Intronic
1019703615 7:2487280-2487302 ATGGGTGGGGGGAGGGAGGGAGG + Intergenic
1019740014 7:2668086-2668108 CTGGCTAGGGGGAGGGGGGTAGG + Intergenic
1020173393 7:5863416-5863438 ATGGCACAGGAGAGGGAAGAGGG + Intergenic
1020782243 7:12532081-12532103 CTGGCAAAGGGAAGGGAAGATGG + Intergenic
1021315537 7:19144126-19144148 GTGGCGAAGGGGAGGGAGAAAGG + Intergenic
1021320477 7:19204179-19204201 CTGGCTATGGGGAAGGAGGTGGG - Intergenic
1021331627 7:19345581-19345603 CAGGCTAAGGGAAGGAAGGAAGG - Intergenic
1022311456 7:29200369-29200391 GTGGATAGAGGGAGGGAGGAGGG - Intronic
1022525208 7:31032715-31032737 ATGTGTAAGGGAAGGGAAGAAGG + Intergenic
1022634359 7:32118117-32118139 AGGGCTAAGGAGAGAGTGGAGGG + Intronic
1022701046 7:32761238-32761260 AAGGCTGAGGGGAGGGATCAAGG - Intergenic
1022786133 7:33639232-33639254 ATGGCTGGGGAGAGGGAGGAGGG + Intergenic
1023419262 7:39961777-39961799 TGGGGTAGGGGGAGGGAGGAGGG - Intronic
1023470738 7:40515473-40515495 AGCGATAAGGGGAGGGAAGAAGG - Intronic
1023729069 7:43173260-43173282 ATGGCTAAGCAGAGGAAGAATGG + Intronic
1023911143 7:44557680-44557702 AAGGGGAAGGGGAGGGAGGAAGG + Intergenic
1024217119 7:47256928-47256950 ATGGAGACGGTGAGGGAGGAGGG + Intergenic
1024380953 7:48695317-48695339 AGGGAAGAGGGGAGGGAGGAAGG + Intergenic
1024471373 7:49771053-49771075 AGGGCAAAGGGAAGGAAGGAAGG + Intergenic
1024495159 7:50037768-50037790 TGAGCTGAGGGGAGGGAGGAAGG - Intronic
1025673199 7:63627374-63627396 AGGTAGAAGGGGAGGGAGGAGGG + Intergenic
1025762414 7:64406981-64407003 TGGGGTAGGGGGAGGGAGGAGGG + Intergenic
1026123240 7:67556097-67556119 AAGGAGAAAGGGAGGGAGGAAGG - Intergenic
1026133194 7:67636985-67637007 AAGGAGAAGGGGAGGAAGGAAGG - Intergenic
1026618914 7:71933167-71933189 CTGGCAAAGAGGAGGGAAGATGG - Intronic
1026834829 7:73631738-73631760 AGGGAGAAGGGGAGAGAGGAAGG - Intergenic
1026998012 7:74631824-74631846 AGGGGTAACGGGAAGGAGGATGG - Intergenic
1027141692 7:75662073-75662095 AAGGTGGAGGGGAGGGAGGAGGG + Intronic
1027159769 7:75793785-75793807 AAGGGGAAGGGGAGGAAGGAAGG + Intergenic
1027504470 7:78998412-78998434 AGGACTCAGGGGAGGGAGGGGGG - Intronic
1027533581 7:79367140-79367162 ATGGGTAAGTGGAAGGAAGAGGG - Intronic
1027542470 7:79485116-79485138 TGGGGTAGGGGGAGGGAGGAGGG - Intergenic
1028456487 7:91043650-91043672 ATGACGAAGGGGAAGGAGGCAGG - Intronic
1028872710 7:95786761-95786783 GGGGCCAAGGGGAAGGAGGATGG - Intronic
1029085346 7:98007028-98007050 ATGGCACAGGAGAGGGAGGGGGG - Intergenic
1029628873 7:101737821-101737843 AGGGAGGAGGGGAGGGAGGAAGG + Intergenic
1030098339 7:105921437-105921459 TGGGTTGAGGGGAGGGAGGAGGG + Intronic
1031493668 7:122420905-122420927 CTGGGGAAGGGGAGGGAGGATGG + Intronic
1032086433 7:128886379-128886401 CTGGCTGAGGGGAGGGAGGTGGG + Intronic
1032476220 7:132213229-132213251 ATGTCTAAGGGGAGGCAGGATGG + Intronic
1032840364 7:135708361-135708383 CTGGCGAAGGGGAGGCAGGGGGG + Intronic
1033418198 7:141182848-141182870 ATGGCTAAGGAAACGGTGGAAGG - Intronic
1034008645 7:147504075-147504097 ATGGCAGAAGGGAGGGAGTATGG - Intronic
1034273845 7:149815609-149815631 AAGGCCATGGGGTGGGAGGAGGG + Intergenic
1034412095 7:150947123-150947145 AAGGGGAAGGGGAGGGGGGAGGG + Intronic
1034918836 7:155062283-155062305 CAGGAGAAGGGGAGGGAGGAGGG + Intergenic
1035025071 7:155819908-155819930 TTGGGTAAGGGGAGGGAGGAGGG + Intergenic
1035214931 7:157358461-157358483 ATGGGTCTGGAGAGGGAGGAAGG - Intronic
1035260402 7:157658350-157658372 AAGGCACAGGGGAGGGAGAAAGG + Intronic
1035417472 7:158702471-158702493 ATCCCGAAGGGGTGGGAGGAGGG - Intronic
1035435850 7:158858824-158858846 AGGGGAAAGGGGAGGGGGGAGGG - Intronic
1035553339 8:545563-545585 AAGGCTGAGGGGAAGGTGGAGGG + Intronic
1035789258 8:2288895-2288917 ATGGCTAAGGAGAGAGAGCAAGG - Intergenic
1035803547 8:2432810-2432832 ATGGCTAAGGAGAGAGAGCAAGG + Intergenic
1036504249 8:9340940-9340962 TTGGGGAAGGGGAGGGAGAAAGG + Intergenic
1036505040 8:9347462-9347484 AAGGGGAAGGGAAGGGAGGAGGG + Intergenic
1036658872 8:10694980-10695002 ATGGATAAGTGGAAGGATGATGG + Intronic
1036661617 8:10712961-10712983 ATGGCTTAGGAGAGGGCCGAGGG - Intergenic
1037373028 8:18200534-18200556 AAGGGTAAAGGGTGGGAGGATGG + Intronic
1038067074 8:23974369-23974391 GTGGGGGAGGGGAGGGAGGAGGG + Intergenic
1038150959 8:24942146-24942168 AAGGAGAAGGGGAGGGAGGTGGG - Intergenic
1038327165 8:26579788-26579810 GTGACTCTGGGGAGGGAGGATGG + Intronic
1038637667 8:29300584-29300606 ATATCCAAGGGGAGAGAGGAAGG - Intergenic
1038761042 8:30384482-30384504 AGGGGAGAGGGGAGGGAGGAAGG + Intronic
1039099373 8:33924487-33924509 AGGGCAAAGGAGAGGGAAGAAGG - Intergenic
1039359917 8:36864920-36864942 AAGGAAAAGGGCAGGGAGGAGGG - Intronic
1039366877 8:36937618-36937640 TGTGCTCAGGGGAGGGAGGAGGG + Intergenic
1039720113 8:40154271-40154293 ATAGATAGGGGAAGGGAGGAGGG + Exonic
1041005649 8:53494948-53494970 AAGGCCTAGAGGAGGGAGGAGGG + Intergenic
1041495004 8:58476587-58476609 ATGGCTAAGGGGAGAAAGGGAGG - Intergenic
1041517821 8:58721195-58721217 ATGGCTTAGTGGAAGGAGCAAGG + Intergenic
1041725000 8:61010038-61010060 ATGGGAATGGGGAGGGAGTAGGG + Intergenic
1041866565 8:62581728-62581750 ATGGATGGAGGGAGGGAGGAAGG - Intronic
1042654583 8:71082133-71082155 ATGGCTAGGGAGATGAAGGAGGG + Intergenic
1042864507 8:73345517-73345539 ATGTGTTAGGGGTGGGAGGAGGG - Intergenic
1043119402 8:76303724-76303746 ATGGAGAAAGGGAGGAAGGAAGG + Intergenic
1043243489 8:77967407-77967429 ATGGAAAAGAGGTGGGAGGAGGG + Intergenic
1044192504 8:89335697-89335719 CTGGGTCAGGGGAGGGAGGTGGG - Intergenic
1044547644 8:93477329-93477351 AGGGCCAAGGGGAGTGAGGTGGG - Intergenic
1044619116 8:94172000-94172022 CGGGAGAAGGGGAGGGAGGAGGG - Intronic
1044678690 8:94755380-94755402 CTGGTTAAGGGAAGGGAGGGTGG + Intronic
1044949654 8:97423296-97423318 ATGGATCAGGGCAGGGAGGAGGG - Intergenic
1045035490 8:98173445-98173467 ATGGCTGACTGGAGGGAGGAAGG + Intergenic
1045071530 8:98510398-98510420 ATGGGTGAGGGTAGGGAGCAGGG - Intronic
1045155288 8:99462149-99462171 AGGGAGAAAGGGAGGGAGGAAGG - Intronic
1045669143 8:104527682-104527704 TGGGGTAAGGGGAGCGAGGAGGG + Intronic
1045850832 8:106696821-106696843 GTGGCTAAGGGGTGGGGTGAGGG - Intronic
1045978793 8:108159806-108159828 TTGGGTAGGGGGAGGGGGGAGGG + Intergenic
1046065098 8:109186883-109186905 ATGGCTCAGGAGAGGCAGAATGG - Intergenic
1046248892 8:111603756-111603778 TTGGCAAAGGGAAGGGAAGATGG + Intergenic
1046259472 8:111747734-111747756 TGGGGTAGGGGGAGGGAGGAGGG - Intergenic
1046927660 8:119809548-119809570 ATGGTTAAGCTTAGGGAGGAAGG - Intronic
1047136878 8:122089355-122089377 ATGGGTAAGGGAGTGGAGGAGGG + Intergenic
1047367240 8:124222697-124222719 ATGGCTGGGGGGAGGGCGGGGGG + Intergenic
1047402987 8:124561716-124561738 AGGGCAAAGGGTCGGGAGGAGGG - Intronic
1047458725 8:125041241-125041263 CTGGCAAAGGGGAGTGAGGGAGG + Intronic
1047525033 8:125625897-125625919 AAGGATAAAAGGAGGGAGGAGGG - Intergenic
1047544546 8:125803057-125803079 ATGGCCATGGTGGGGGAGGATGG + Intergenic
1047930751 8:129726369-129726391 ATGGAAGAGGGGAGGCAGGAGGG + Intergenic
1047987047 8:130246163-130246185 GGGGCGAAGGGGAGGGAGGTAGG - Intronic
1048348270 8:133594982-133595004 ATGGCTAAAGAGAGAGAGGAAGG - Intergenic
1048447904 8:134505660-134505682 CTGGCTCTGGGGATGGAGGAAGG + Intronic
1048863881 8:138744774-138744796 ATAGCTAAGAGAAGGGAGAAAGG - Intronic
1048989605 8:139753431-139753453 GTGAATAAAGGGAGGGAGGAAGG - Intronic
1049371963 8:142272265-142272287 GTGGCTAGGTGGAAGGAGGAAGG - Intronic
1049475936 8:142797012-142797034 ATGGATGGAGGGAGGGAGGAAGG + Intergenic
1049495086 8:142926317-142926339 AAGGCATAGAGGAGGGAGGACGG - Intergenic
1049521185 8:143092206-143092228 ATGGTTGAGGGGAGAGAGCAGGG + Intergenic
1050003150 9:1099669-1099691 ATAGCTATGAGGAGGGGGGATGG + Intergenic
1050008876 9:1164322-1164344 ATGAAAAAAGGGAGGGAGGAAGG - Intergenic
1050772805 9:9224302-9224324 ATGTGTATGGGGAGGGAGAAAGG + Intronic
1051718076 9:20006331-20006353 GTGGGTGAGGGGAGGGGGGATGG + Intergenic
1052604540 9:30682074-30682096 ATGGGTTGGGGGAGGGGGGAGGG + Intergenic
1052642346 9:31184989-31185011 ATGGCAAAAGGGAGGGTGGGAGG + Intergenic
1052864475 9:33456758-33456780 ATGGCTGTGGGGAGGGAGAAGGG + Intergenic
1053054707 9:34987778-34987800 AAGGGGGAGGGGAGGGAGGAGGG - Intergenic
1053063370 9:35048737-35048759 ATGGCTTAGATCAGGGAGGAAGG - Intergenic
1053217942 9:36288439-36288461 AGGGCTGAGGTGAGGGATGAAGG + Intronic
1053493814 9:38533781-38533803 ATGGCTAATGAGAGTGAGGGAGG - Intergenic
1053507711 9:38658134-38658156 ATGGCTTAGAGGAGGTGGGAGGG + Intergenic
1053575094 9:39351539-39351561 ATGATTAAGGTGAGTGAGGAAGG + Intergenic
1053752011 9:41266612-41266634 GTGGGGAAGGGGAGGGACGAGGG - Intergenic
1053839600 9:42179474-42179496 ATGATTAAGGTGAGTGAGGAAGG + Intergenic
1054096659 9:60910222-60910244 ATGATTAAGGTGAGTGAGGAAGG + Intergenic
1054118062 9:61185848-61185870 ATGATTAAGGTGAGTGAGGAAGG + Intergenic
1054257532 9:62830942-62830964 GTGGGGAAGGGGAGGGACGAGGG - Intergenic
1054333781 9:63784780-63784802 GTGGGGAAGGGGAGGGACGAGGG + Intergenic
1054589693 9:66996716-66996738 ATGATTAAGGTGAGTGAGGAAGG - Intergenic
1054720500 9:68598726-68598748 ATGGCTATGAGGAGGGGGTAGGG + Intergenic
1054771834 9:69090557-69090579 CTGGGTTGGGGGAGGGAGGAAGG + Intronic
1054872997 9:70066505-70066527 AGGGCGAAGGGGAGGTAGGGGGG + Intronic
1054986239 9:71264778-71264800 ATGCTTAAGGTGAGGGAGGGTGG - Intronic
1055642775 9:78333432-78333454 AGCTCTAAGAGGAGGGAGGAGGG - Intergenic
1056032449 9:82567222-82567244 AGGGATGAAGGGAGGGAGGAGGG + Intergenic
1056077781 9:83059231-83059253 ATGGCTGAGAGCAGGGATGAAGG - Intronic
1056388314 9:86117471-86117493 AGGGATGAGGGGAGGTAGGAAGG + Intergenic
1056789738 9:89617769-89617791 AGGGCTGTGGGGAGGGAGGTAGG + Intergenic
1057175375 9:92993606-92993628 TGGGGTAAGGGGAGGGAGGAGGG - Intronic
1057272582 9:93659195-93659217 ATGGCTAAGGTGAGGTGGCAGGG - Intronic
1057781208 9:98051983-98052005 ATGGCTAATGGCAGTTAGGAGGG - Intergenic
1058058803 9:100474092-100474114 AAGGCTGAGGGGAGGGAGGGCGG + Intronic
1058330145 9:103750470-103750492 AGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1058961166 9:109994104-109994126 GCAGCTAAGGGGAGGGAGGACGG + Intronic
1059125687 9:111682651-111682673 ATTGTTGAGGGGAGGAAGGAAGG + Intergenic
1059252207 9:112895734-112895756 ATGGATAATGGGTGGGTGGATGG - Intergenic
1059341236 9:113598680-113598702 ATGAGTAAGGGGAGGCAGGGAGG - Intergenic
1059371521 9:113843400-113843422 ATGCGGAAGGAGAGGGAGGAAGG - Intergenic
1059745821 9:117200222-117200244 TTGGGTAGGGGGAGGGGGGAGGG - Intronic
1060114825 9:120931619-120931641 CTGGCTTAGGGCAGAGAGGAAGG - Intergenic
1060205793 9:121682138-121682160 ACGGGCTAGGGGAGGGAGGAGGG - Intronic
1060397457 9:123326207-123326229 ATGGCTATGGTGGGGGAAGATGG - Intergenic
1060404091 9:123364556-123364578 GTGGGGATGGGGAGGGAGGAGGG + Intronic
1060405001 9:123368726-123368748 TGGCCTAAAGGGAGGGAGGATGG - Intronic
1060769519 9:126321779-126321801 ATGGCTGAGAGGAGGATGGAGGG + Intergenic
1060801278 9:126547360-126547382 ATGACCAAGGGAAGGCAGGAGGG - Intergenic
1061245111 9:129397571-129397593 ATGGATAAGGGGATGGTTGAAGG + Intergenic
1061355035 9:130098214-130098236 ATTCCTAAGGGGAGGTGGGAAGG + Intronic
1061526675 9:131170981-131171003 ATGACTGAGGGCAGGGAGGGTGG - Intronic
1061726511 9:132584854-132584876 ATGGAGAAGGGGGAGGAGGAAGG + Intronic
1061890780 9:133618002-133618024 ATGGCCAATGGGAGGGAGGGAGG + Intergenic
1061911778 9:133728840-133728862 GTGGCTAGAGGGAGGGAGGGAGG + Intronic
1062159514 9:135072410-135072432 GGGGCTAAGGGGAAGGAGGTTGG - Intergenic
1062201236 9:135303911-135303933 ATGGATAAATGGAGGGTGGATGG + Intergenic
1062259586 9:135654797-135654819 TTGGGAAAGGGGCGGGAGGAAGG - Intergenic
1062362608 9:136194757-136194779 AAGGGGAAGGGGAGGGAAGAGGG - Intergenic
1062532228 9:137007018-137007040 AAGGCTAAGGGGAAGGGGGCCGG + Intergenic
1062631503 9:137465098-137465120 AGGGCTCAGGGGACGGAGGCTGG + Intronic
1202804194 9_KI270720v1_random:35189-35211 ATGGTTGTGGGGTGGGAGGAGGG + Intergenic
1203467798 Un_GL000220v1:104116-104138 ATGGCGAAAGGGAAGGAGGGAGG - Intergenic
1203475623 Un_GL000220v1:148092-148114 ATGGCGAAAGGGAAGGAGGGAGG - Intergenic
1203492345 Un_GL000224v1:118994-119016 GTGGGGAAGGGGAGGGATGAGGG + Intergenic
1203358693 Un_KI270442v1:191237-191259 TGGGGTGAGGGGAGGGAGGAGGG + Intergenic
1203504968 Un_KI270741v1:60866-60888 GTGGGGAAGGGGAGGGATGAGGG + Intergenic
1185583090 X:1226126-1226148 ATGGGTGGGTGGAGGGAGGAAGG + Intergenic
1185611438 X:1395700-1395722 ATGGGTAATGGGTGGGTGGATGG + Intergenic
1185611529 X:1396204-1396226 ATGGGTAATGGGTGGGTGGATGG + Intergenic
1185756923 X:2659753-2659775 AGGGGGAAGGGGAGGGGGGAGGG - Intergenic
1185867546 X:3637043-3637065 AAGGGAAAGGGAAGGGAGGAAGG + Intronic
1187279916 X:17850353-17850375 ATGGCTGAGGAGAGGGTGAAGGG + Intronic
1187402807 X:18976790-18976812 AGGGATCAGGAGAGGGAGGAGGG - Intronic
1187407460 X:19016686-19016708 ATGGGTGGGGGGAGGGGGGAGGG - Intronic
1187444225 X:19346210-19346232 AGGGAGAAGGGGAGGGAGAAGGG + Intronic
1187731942 X:22264282-22264304 CTGGAGAATGGGAGGGAGGATGG - Intergenic
1188110053 X:26186194-26186216 TGGGGTAAGGGGAGGGGGGAGGG + Intergenic
1188125480 X:26363091-26363113 ATGTGTAAGGGAAGGAAGGATGG - Intergenic
1188360912 X:29252115-29252137 TGGGGTAAGGGGAGGGGGGAGGG + Intronic
1188553514 X:31386226-31386248 TGGGGTGAGGGGAGGGAGGAGGG + Intronic
1188740209 X:33769136-33769158 AGGGAAAAGGGAAGGGAGGAGGG + Intergenic
1188839018 X:34991966-34991988 TGGGGTAAGGGGAGGGGGGAGGG + Intergenic
1189701148 X:43717022-43717044 GTGGTTAAGGTGAGGCAGGATGG + Intronic
1190189494 X:48265315-48265337 ATGGCTAAGCTTAGTGAGGAAGG - Intronic
1190286725 X:48966405-48966427 ATGGGCAAGGGAAGGGAAGAGGG - Intronic
1190561947 X:51694974-51694996 ATGGGGAAGGGGAAGGAGAAGGG + Intergenic
1190595472 X:52049158-52049180 GTGGGTAGGGGGAGGGGGGAGGG + Intergenic
1190613352 X:52204915-52204937 GTGGGTAGGGGGAGGGGGGAGGG - Intergenic
1190644261 X:52510255-52510277 ATGGAGAGGGGGAGGAAGGAAGG - Intergenic
1190658254 X:52631816-52631838 ATGGCTAAGCTTAGTGAGGAGGG - Intergenic
1190660187 X:52646834-52646856 ATGGCTAAGCTTAGTGAGGAAGG + Intronic
1190663396 X:52675978-52676000 ATGGCTAAGCTTAGTGAGGAAGG - Intronic
1190676027 X:52782504-52782526 ATGGCTAAGCTTAGTGAGGAAGG + Intronic
1191579839 X:62748200-62748222 ATGGGTGGGGGGAGGGGGGAGGG + Intergenic
1193089264 X:77476613-77476635 TTGGGTAGGGGGAGGGGGGAGGG + Intergenic
1193801547 X:85942901-85942923 AGGGGTGAGGGGAGGGGGGAGGG - Intronic
1194348513 X:92796029-92796051 AGGGGGAAGGGGAGGGGGGAAGG + Intergenic
1194984287 X:100473361-100473383 ATGGATGAGGGGTGGGGGGAGGG + Intergenic
1195234922 X:102887828-102887850 AAGGGAAAGGGAAGGGAGGAAGG - Intergenic
1195321288 X:103724002-103724024 AAGACTGAGGGGTGGGAGGAGGG - Intronic
1195375164 X:104219512-104219534 AAGGATAGAGGGAGGGAGGAAGG + Intergenic
1195767175 X:108308117-108308139 GTGGCTGAGGGGATGGAGGATGG - Intronic
1195836844 X:109125236-109125258 ATGGCTAAGGGGAGGAAACTTGG + Intergenic
1195934621 X:110113027-110113049 AAGGCAGAGGGGAGGGAGGGAGG - Intronic
1195965648 X:110427889-110427911 CTGGGTGAAGGGAGGGAGGAAGG - Intronic
1196030575 X:111091712-111091734 ATGGGCATGGGGAGGCAGGAAGG + Intronic
1196091627 X:111750233-111750255 ATTGCTAAGGCCAGGGAGAATGG - Intronic
1196180470 X:112684405-112684427 TGGGCTACGGGGAGGGAGGAGGG - Intergenic
1196305301 X:114095538-114095560 ATGGGGAATGGGAGGGAGGAGGG - Intergenic
1196391014 X:115207432-115207454 GAGGCTAAGAGGTGGGAGGATGG + Intronic
1196491222 X:116269781-116269803 TGGGGTAGGGGGAGGGAGGAGGG - Intergenic
1196782944 X:119399404-119399426 ATGGCTACGTGGAGGCGGGACGG + Exonic
1196898418 X:120360268-120360290 AGGGACAAGGGGAGGGAGAAAGG - Intergenic
1196913226 X:120505531-120505553 AAGGGAAGGGGGAGGGAGGAAGG - Intergenic
1197841397 X:130751200-130751222 GTGGCTAGGGGAAGGGAGGAAGG - Intronic
1197842630 X:130765316-130765338 TTGGCTAGGAGGAGGGAGGGAGG - Intronic
1198058270 X:133017166-133017188 ATGGTTAGGAGGAGGGAGAAAGG - Intergenic
1198756654 X:139989145-139989167 TTGGGTGAGGGGAGGGGGGAGGG - Intergenic
1199433786 X:147789745-147789767 AAGGCCATAGGGAGGGAGGAAGG + Intergenic
1201073155 Y:10168535-10168557 CTGGCTGAGGGTGGGGAGGAGGG + Intergenic
1202109026 Y:21402745-21402767 TGGGGTAGGGGGAGGGAGGAGGG + Intergenic