ID: 1162736015

View in Genome Browser
Species Human (GRCh38)
Location 19:12747558-12747580
Sequence CTTGGCCTGGATCTTGTGAC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 1, 2: 1, 3: 7, 4: 150}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162736015_1162736019 -10 Left 1162736015 19:12747558-12747580 CCCGTCACAAGATCCAGGCCAAG 0: 1
1: 1
2: 1
3: 7
4: 150
Right 1162736019 19:12747571-12747593 CCAGGCCAAGTATCTGGACCAGG 0: 1
1: 0
2: 0
3: 11
4: 129
1162736015_1162736022 13 Left 1162736015 19:12747558-12747580 CCCGTCACAAGATCCAGGCCAAG 0: 1
1: 1
2: 1
3: 7
4: 150
Right 1162736022 19:12747594-12747616 TGTGCCCACCCACCCAGCACTGG 0: 1
1: 0
2: 2
3: 28
4: 255
1162736015_1162736027 24 Left 1162736015 19:12747558-12747580 CCCGTCACAAGATCCAGGCCAAG 0: 1
1: 1
2: 1
3: 7
4: 150
Right 1162736027 19:12747605-12747627 ACCCAGCACTGGCTCAGCAGAGG 0: 1
1: 0
2: 2
3: 39
4: 346

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162736015 Original CRISPR CTTGGCCTGGATCTTGTGAC GGG (reversed) Exonic
900001667 1:17945-17967 CTTGCTCTGGATCCTGTGGCGGG + Intergenic
903792010 1:25899783-25899805 CTTGGGCTGTATCTTGAGATTGG - Intronic
904330386 1:29754670-29754692 CTTGGCCAGGGTCTGCTGACTGG - Intergenic
905953411 1:41972265-41972287 CATGACATGGATCTTGTTACTGG - Intronic
906713180 1:47947892-47947914 CTAGGCCTGGAGCTTCTGATAGG - Intronic
908948174 1:69525024-69525046 GGTGGCCTGGGACTTGTGACTGG + Intergenic
909027560 1:70500951-70500973 AGTGGCCTGGAACTTGTGATTGG - Intergenic
910653162 1:89591743-89591765 CTTGGCCTATATCCTCTGACGGG - Intronic
914698878 1:150112720-150112742 GGTGGTCTGGAACTTGTGACTGG - Intronic
917678979 1:177347089-177347111 CTTGGCCTGGGTCTGGTCACTGG - Intergenic
917762367 1:178176194-178176216 GTTGGCATGGATGTGGTGACAGG - Intronic
922100671 1:222474988-222475010 CTTGGCCTGGACCGGCTGACTGG + Intergenic
922733953 1:227969687-227969709 CTTGGCCTGGACCGGCTGACTGG - Intergenic
1062848925 10:728611-728633 CGTGGCCTGGTTCGTGTGTCTGG + Intergenic
1063653968 10:7968468-7968490 CTTGTCCTGGATCTTATTCCAGG - Intronic
1067482443 10:46611952-46611974 CTGGGCCTGTTTCTTGTGTCAGG - Intergenic
1067612307 10:47729712-47729734 CTGGGCCTGTTTCTTGTGTCAGG + Intergenic
1071627729 10:87189959-87189981 CTGGGCCTGTTTCTTGTGTCAGG + Intronic
1073136463 10:101223160-101223182 CTTGGCCTGGGTTGTGTGAGGGG - Intergenic
1076612343 10:131734179-131734201 CTTGGCCTGTGTCCTGTGTCTGG - Intergenic
1077882549 11:6362882-6362904 TTTGTCTTGGATCTTGTGACAGG + Intergenic
1079365114 11:19802253-19802275 CTTGGCATGGAGCTTGTGCAAGG + Intronic
1081090651 11:38862010-38862032 ATTGGCCTGGATGTAGTGAAAGG - Intergenic
1081950849 11:47041166-47041188 CTTGGCCTGGATCTTGTGTCAGG + Intronic
1082260739 11:50074851-50074873 CTTGGCCTGGACATGCTGACTGG + Intergenic
1084423071 11:69070510-69070532 CGTGGCCAGCATTTTGTGACAGG + Intronic
1084607939 11:70183472-70183494 CTTGGCCTGGGTCATGTGCCAGG + Intronic
1085837975 11:79976744-79976766 CATGGCCTGGATCCTATGAATGG - Intergenic
1091000793 11:131909652-131909674 CTGGGCCTGGTTCTTGTGCAAGG - Intronic
1091322090 11:134658799-134658821 CTTGGCCAGGAAATTGTGAGGGG + Intergenic
1091374753 12:18067-18089 CTTGCTCTGGATCCTGTGGCGGG + Intergenic
1092490109 12:8937295-8937317 CTTGCCCTGAATCTTGGCACGGG - Exonic
1096946194 12:55412118-55412140 CTTGCCCTGAATCTTGGCACGGG + Intergenic
1103963286 12:124622573-124622595 CTTGGCTTGGCTCCAGTGACAGG + Intergenic
1104001304 12:124862552-124862574 CTTGGCCTGCCTCTTTGGACTGG - Intronic
1108001650 13:45910156-45910178 CCTGGCCTAGATGTTGTGAAGGG - Intergenic
1115182166 14:30641949-30641971 CTGGGCCTTGATATTGTGAGAGG + Intronic
1117470468 14:56039439-56039461 CATTGCCTGGGGCTTGTGACAGG - Intergenic
1117527396 14:56623323-56623345 CTGGGCATGCATCCTGTGACTGG - Intronic
1120534585 14:85678369-85678391 GTGGCCCTGGATCTTGTGAGTGG - Intergenic
1122410638 14:101524261-101524283 CAGGGCCTGGGTCTTGTGGCTGG - Intergenic
1125728799 15:41881684-41881706 CTTGGCCTGGCTCCTGTTGCCGG - Intronic
1132176690 15:99721592-99721614 CCTGGACTGGATCATGGGACAGG - Intronic
1132451842 15:101972995-101973017 CTTGCTCTGGATCCTGTGGCGGG - Intergenic
1132455050 16:17634-17656 CTTGCTCTGGATCCTGTGGCGGG + Exonic
1132519122 16:379342-379364 CTTGGCCTGGATTTGCCGACAGG - Intronic
1132570056 16:640653-640675 CTTGGCTTGGGTCTTGGGACTGG - Intronic
1132680782 16:1140870-1140892 CCTGGCCTGGCTCTTGTCTCTGG + Intergenic
1134043854 16:11087309-11087331 GTGGGCCTGGCTCTTGGGACCGG - Intronic
1134241134 16:12507880-12507902 CTTGGCCTTGACCGTGTGCCTGG - Intronic
1135965212 16:27029818-27029840 CTTGGCATGCCTCTTGTGATAGG + Intergenic
1136989121 16:35141265-35141287 CTCTGCCTGGGTCGTGTGACCGG + Intergenic
1138086850 16:54141302-54141324 CCTGGCCTGGATCTAGAGCCTGG - Intergenic
1143447607 17:7018498-7018520 TTTGGCCTCCATCTTGTGGCAGG - Intergenic
1145879195 17:28341541-28341563 CTGGGCCTGGGTCTTGGAACTGG + Intronic
1150169512 17:62978500-62978522 CTTGGCCTTGACCTCGTTACTGG + Intergenic
1150693179 17:67381855-67381877 CTTTGCCTGCTTCTTGTGCCTGG + Intronic
1152646676 17:81472160-81472182 CCTGGCGTGGGTCATGTGACCGG - Intergenic
1155144756 18:23074087-23074109 CTTGGACTGGTTTTTGTGATGGG + Intergenic
1155522800 18:26685925-26685947 CATGGCCTGGATTTTCTGAAAGG + Intergenic
1157829030 18:50839808-50839830 CTTGGCCTGGATCTGGCAAGTGG - Intergenic
1159806039 18:72959349-72959371 CTTACCCAGGATCATGTGACAGG - Intergenic
1162736015 19:12747558-12747580 CTTGGCCTGGATCTTGTGACGGG - Exonic
1162898441 19:13779385-13779407 CTTGACCTGGATCCAGTGAAGGG - Intergenic
1165956378 19:39504236-39504258 CTGGGCCTGGGCCCTGTGACGGG + Exonic
925262655 2:2541833-2541855 CTTGGCCTGAACCTAGTCACTGG + Intergenic
928119755 2:28575149-28575171 GTTGGCCTGGATATGGTGAAAGG - Intronic
928626265 2:33142793-33142815 CCTGGCCTGTATCTTGGGAGTGG + Intronic
929299026 2:40280801-40280823 CTTTGCCTGGCTATTGTTACAGG - Intronic
929378584 2:41321177-41321199 CCTGGCCTTGAACTTGTGCCTGG - Intergenic
929468094 2:42164045-42164067 CTTGGCCTAGGTCATGTGCCTGG + Intergenic
931160142 2:59680392-59680414 GTTGGCATGGATCTGGTGAAAGG - Intergenic
935351669 2:102156082-102156104 GTTGGCCTGGAACTGGTGATTGG + Intronic
936568056 2:113595463-113595485 CTTGCTCTGGATCCTGTGGCGGG - Intergenic
937406075 2:121630526-121630548 CTTGGCAAGAATTTTGTGACTGG - Intronic
939319623 2:140601515-140601537 CTCGGCCTGGAGCATTTGACAGG - Exonic
943054121 2:182954459-182954481 CTTGGCCTGTTTCTAGTGATGGG - Intronic
944373284 2:199011406-199011428 AGTGGCCTGGAGCTTGAGACTGG + Intergenic
944950429 2:204742475-204742497 CTTGGCCTGTAACTTGTGCTGGG + Intronic
946142098 2:217700188-217700210 CTTGTTCTGTATCTTGTGCCAGG - Intronic
1169631185 20:7634078-7634100 CTTGGCCTAGATCATTTCACTGG - Intergenic
1170001813 20:11622986-11623008 CCTGGCCTGGAGCTTATCACTGG + Intergenic
1170927930 20:20742762-20742784 CTTGTCTTGGATGTTGTGGCAGG + Intergenic
1171053852 20:21886814-21886836 CTTACCCTGGCTCTTGTGCCTGG + Intergenic
1172841763 20:37906179-37906201 CCTGCCCTGGAGCTTGTCACAGG + Intronic
1175169398 20:57069679-57069701 CTTGGCCTGAATACTGTGGCCGG - Intergenic
1175176792 20:57117403-57117425 CTGGGCCAGGATCACGTGACCGG + Intergenic
1182471726 22:30552986-30553008 CTTGGCCTGGAACCTGACACAGG + Intergenic
1184699295 22:46159446-46159468 CCTTGCCTGTATCTGGTGACAGG - Intronic
1185287093 22:50006504-50006526 CTTGGCCTGTGGCTTGTTACTGG - Intronic
949194162 3:1285702-1285724 CTTGGCCAAGATCTTGTCTCTGG + Intronic
953028280 3:39158227-39158249 ATAAGCCTGGAACTTGTGACTGG - Intergenic
953119076 3:40022178-40022200 ATTGGCCTGAATCATGTGGCTGG - Intronic
955689014 3:61572418-61572440 CTCGTTCTGGATCTTGTGTCTGG + Intronic
956703361 3:71978537-71978559 CTTGCCCTGGATCCTGTGGCTGG + Intergenic
960134762 3:114094045-114094067 CTTGGGCTGGACCTTGAGAATGG - Intergenic
961452561 3:127008995-127009017 CTTGGCCTGGCTCTTCAGGCAGG - Intronic
961745678 3:129062217-129062239 CTGGGCCTGGCTCTTCTGGCTGG + Exonic
963929182 3:150984394-150984416 CTTTGCCTGGCTTTTGTAACAGG + Intergenic
964331480 3:155608162-155608184 CCTAGCCTGGAGCTGGTGACTGG - Intronic
967692834 3:192496729-192496751 CTGGGAATGGATCTTTTGACTGG - Intronic
969123867 4:4931550-4931572 CTTGCCCTGGAGCATGTGTCTGG + Intergenic
969556624 4:7915975-7915997 CCTGGACTAGAACTTGTGACTGG - Intronic
974022121 4:56700996-56701018 TGTGACCTGTATCTTGTGACAGG - Intergenic
974774279 4:66459800-66459822 CTTGGCCTGGCTTTTGTATCAGG + Intergenic
976207236 4:82634826-82634848 CTTGCCCTGCATCTTCTGAAAGG - Intronic
976310081 4:83602731-83602753 TTGGGCTTGGATCTTGTGAAAGG + Intronic
978213630 4:106170043-106170065 TATGGCCTGGTTCCTGTGACTGG + Intronic
979259120 4:118632587-118632609 CTTGGCCTGGACCGGCTGACTGG - Intergenic
979329229 4:119407972-119407994 CTTGGCCTGGACCGGCTGACTGG + Intergenic
980120593 4:128724089-128724111 CTGGGTCTGGATGGTGTGACAGG - Intergenic
981637294 4:146895326-146895348 CTTGTCATGGATCTTGGGATTGG - Intronic
985484809 5:142041-142063 CTGTGCCTGGAACTTCTGACAGG + Intronic
986718559 5:10541446-10541468 CTTGACCTTGACCATGTGACAGG - Intergenic
990041963 5:51387384-51387406 CTTGCCCGGGATCTTGGGCCAGG + Intronic
991432952 5:66567430-66567452 CTTGGACTGGATTTAGTGACTGG + Intergenic
993162924 5:84313047-84313069 AATGGTCTGGATTTTGTGACAGG + Intronic
996253146 5:121363274-121363296 CTTTGCCTGGATCTGGTGACTGG - Intergenic
996396676 5:123020933-123020955 CTTGCCCTGGCTCCAGTGACTGG - Intronic
997658352 5:135571916-135571938 CTTAGCCAGCATCTTGTGAACGG - Intronic
1005328564 6:24725946-24725968 ATTGTCCTGGAGCTTGGGACAGG + Intergenic
1006036888 6:31220938-31220960 TTTGGCCTGTATCTTTTAACTGG + Intergenic
1013797479 6:113903843-113903865 CTTGGCGTTGATCTTGCGATTGG + Intergenic
1017793137 6:157819328-157819350 CTTGGACTGGATGCTGTTACAGG - Intronic
1021465038 7:20932857-20932879 CTTGGTCTGGAAGCTGTGACAGG + Intergenic
1024649305 7:51390565-51390587 CTTGGCCTGGACCGGCTGACTGG + Intergenic
1024855319 7:53771844-53771866 CCTGACCTGGGTCTTGTCACAGG - Intergenic
1025053384 7:55745894-55745916 CTTGGCCTGGACCGGCTGACTGG + Intergenic
1025131488 7:56376368-56376390 CTTGGCCTGGACCGGCTGACTGG + Intergenic
1026122195 7:67547842-67547864 CTTGGCCATGACCTTGTGCCAGG + Intergenic
1028474587 7:91239441-91239463 CTTGGCCTGGATCATGGGGGAGG - Intergenic
1028483531 7:91334001-91334023 TTTAGTCTGGATCTTGTGGCTGG + Intergenic
1028746535 7:94333718-94333740 CGTGGGCTGGATTTAGTGACAGG + Intergenic
1032500614 7:132396979-132397001 CTGGGTCTGGATCTTGGGGCAGG - Intronic
1033324537 7:140366691-140366713 CTTTGGCTGGAGCTGGTGACAGG - Intronic
1037596315 8:20357327-20357349 TTGGGCCTGGATGGTGTGACTGG - Intergenic
1039120599 8:34142103-34142125 CCTGGCCTGGATGTCTTGACTGG + Intergenic
1040535647 8:48307201-48307223 CTAGCACTGGATCTTGTGAAAGG + Intergenic
1042737638 8:72006399-72006421 GTTGGCATGGATGTTGTGAAAGG + Intronic
1047373773 8:124277220-124277242 CTTGGCCAGGATTTGGTGAATGG - Intergenic
1048865899 8:138761254-138761276 CCAGGCCTGGCTCTTGTCACTGG - Intronic
1048924022 8:139254662-139254684 CTTGCCCTGGACCTTGTGAATGG + Intergenic
1049884475 9:18058-18080 CTTGCTCTGGATCCTGTGGCGGG + Intergenic
1050396864 9:5207450-5207472 CTTTGCCTGGTTTTTGTCACAGG - Intergenic
1051076718 9:13247578-13247600 CATGGCATAGATCTTGTGAAAGG - Intronic
1056330116 9:85514208-85514230 CTTGGCCTGGACCTACTGATTGG - Intergenic
1062616224 9:137397222-137397244 CTTGGTCTGGATCTGGCGAGAGG - Intronic
1186962280 X:14749408-14749430 CCTTACCTGGATCTTGTGGCAGG + Intergenic
1191091605 X:56629245-56629267 CTTGGCTTTGCTATTGTGACTGG + Intergenic
1191871408 X:65748885-65748907 CTTGGTTTGGATCTTGTCAGAGG + Intergenic
1192450195 X:71240001-71240023 CTTGGCCTAGCTCTTATGATAGG + Exonic
1193428990 X:81377023-81377045 CTAGGCCTGGAAGTTGTAACAGG - Intergenic
1194310655 X:92301744-92301766 CTTTGCCTGGTTCTGGTGTCAGG + Intronic
1194919546 X:99748573-99748595 TTTGGTCTGGGTCTTGTGAATGG + Intergenic
1198007722 X:132515738-132515760 CTTGGCTTTCATCTTGGGACTGG + Intergenic
1198248854 X:134859789-134859811 CTTGGCATGGCTCTTGTGCTTGG + Intergenic
1198988630 X:142484522-142484544 CTTTGCATGGATCTTGAGAAGGG + Intergenic
1200175114 X:154108742-154108764 CTGAGCCTGGATCCTGGGACAGG + Intergenic
1200401331 X:156022093-156022115 CTTGCTCTGGATCCTGTGGCGGG - Intergenic
1200618936 Y:5416029-5416051 CTTTGCCTGGTTCTGGTGCCAGG + Intronic