ID: 1162738956

View in Genome Browser
Species Human (GRCh38)
Location 19:12763125-12763147
Sequence TGGTGGGGAGGGAGGGCGGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 11490
Summary {0: 1, 1: 7, 2: 47, 3: 606, 4: 10829}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162738956_1162738971 7 Left 1162738956 19:12763125-12763147 CCTCCCGCCCTCCCTCCCCACCA 0: 1
1: 7
2: 47
3: 606
4: 10829
Right 1162738971 19:12763155-12763177 AGAGGGAAGAGCAGAGATCATGG 0: 1
1: 0
2: 9
3: 87
4: 844
1162738956_1162738966 -10 Left 1162738956 19:12763125-12763147 CCTCCCGCCCTCCCTCCCCACCA 0: 1
1: 7
2: 47
3: 606
4: 10829
Right 1162738966 19:12763138-12763160 CTCCCCACCAATCTGGGAGAGGG 0: 1
1: 0
2: 1
3: 22
4: 219
1162738956_1162738973 30 Left 1162738956 19:12763125-12763147 CCTCCCGCCCTCCCTCCCCACCA 0: 1
1: 7
2: 47
3: 606
4: 10829
Right 1162738973 19:12763178-12763200 CCTCAAAGCTCTCGAGCACCTGG 0: 1
1: 0
2: 1
3: 4
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162738956 Original CRISPR TGGTGGGGAGGGAGGGCGGG AGG (reversed) Exonic
Too many off-targets to display for this crispr