ID: 1162739862

View in Genome Browser
Species Human (GRCh38)
Location 19:12767755-12767777
Sequence GTGTACTGTTTGGGTAGAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 106}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162739862_1162739877 23 Left 1162739862 19:12767755-12767777 CCTGTTCTACCCAAACAGTACAC 0: 1
1: 0
2: 1
3: 2
4: 106
Right 1162739877 19:12767801-12767823 GGGGCTTCATCTCACCGGCCTGG 0: 1
1: 0
2: 1
3: 13
4: 348
1162739862_1162739878 24 Left 1162739862 19:12767755-12767777 CCTGTTCTACCCAAACAGTACAC 0: 1
1: 0
2: 1
3: 2
4: 106
Right 1162739878 19:12767802-12767824 GGGCTTCATCTCACCGGCCTGGG 0: 1
1: 0
2: 1
3: 8
4: 109
1162739862_1162739870 2 Left 1162739862 19:12767755-12767777 CCTGTTCTACCCAAACAGTACAC 0: 1
1: 0
2: 1
3: 2
4: 106
Right 1162739870 19:12767780-12767802 GGACAGGTAAGACCCCGGGATGG 0: 1
1: 0
2: 0
3: 6
4: 137
1162739862_1162739867 -3 Left 1162739862 19:12767755-12767777 CCTGTTCTACCCAAACAGTACAC 0: 1
1: 0
2: 1
3: 2
4: 106
Right 1162739867 19:12767775-12767797 CACCAGGACAGGTAAGACCCCGG 0: 1
1: 0
2: 1
3: 13
4: 171
1162739862_1162739876 18 Left 1162739862 19:12767755-12767777 CCTGTTCTACCCAAACAGTACAC 0: 1
1: 0
2: 1
3: 2
4: 106
Right 1162739876 19:12767796-12767818 GGGATGGGGCTTCATCTCACCGG 0: 1
1: 0
2: 3
3: 28
4: 384
1162739862_1162739868 -2 Left 1162739862 19:12767755-12767777 CCTGTTCTACCCAAACAGTACAC 0: 1
1: 0
2: 1
3: 2
4: 106
Right 1162739868 19:12767776-12767798 ACCAGGACAGGTAAGACCCCGGG 0: 1
1: 0
2: 0
3: 12
4: 101
1162739862_1162739871 3 Left 1162739862 19:12767755-12767777 CCTGTTCTACCCAAACAGTACAC 0: 1
1: 0
2: 1
3: 2
4: 106
Right 1162739871 19:12767781-12767803 GACAGGTAAGACCCCGGGATGGG 0: 1
1: 0
2: 1
3: 9
4: 82
1162739862_1162739872 4 Left 1162739862 19:12767755-12767777 CCTGTTCTACCCAAACAGTACAC 0: 1
1: 0
2: 1
3: 2
4: 106
Right 1162739872 19:12767782-12767804 ACAGGTAAGACCCCGGGATGGGG 0: 1
1: 0
2: 0
3: 10
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162739862 Original CRISPR GTGTACTGTTTGGGTAGAAC AGG (reversed) Intronic
904699518 1:32350117-32350139 GTGTTATGTTTGAGAAGAACAGG - Intergenic
906636061 1:47411542-47411564 GTGTATGGTGTGGGTAGAGCAGG - Intergenic
911425256 1:97702031-97702053 CTGTACTGTTTGGATAGCACAGG - Intronic
916642270 1:166743144-166743166 TTGTACTGTTTGGACAGCACAGG - Intergenic
921306133 1:213798627-213798649 GTGTCTTGTTTGGGCAGAAGAGG + Intergenic
921639922 1:217541009-217541031 GTGAAATGTTTGGATACAACTGG - Intronic
922113917 1:222590706-222590728 GTGAACAGTTTGAGTAGAATCGG + Intergenic
922941841 1:229473748-229473770 GTGTATTTTTTGTGGAGAACGGG - Intronic
1063018638 10:2103803-2103825 GTGTAATGTTTGTTTGGAACAGG + Intergenic
1065173814 10:23057639-23057661 ATGTACTTTTTAGGTAAAACAGG - Intergenic
1068723882 10:60278922-60278944 TTGTTCTCTTTGGGGAGAACAGG - Intronic
1068842325 10:61629655-61629677 TTGTACTTTTTGAGAAGAACTGG + Intergenic
1075008788 10:118850761-118850783 GTGTAAGGCTGGGGTAGAACCGG + Intergenic
1076567541 10:131409210-131409232 GAGTCCTGTGTGGGTAGGACTGG - Intergenic
1079887051 11:26002376-26002398 TTGGACTGTTTGGGTTGAAGGGG - Intergenic
1079933839 11:26594652-26594674 TTGGACTGTTTGGGTTGAAGGGG + Intronic
1080598261 11:33796047-33796069 GTGTACTTTTTTGGTAGAGATGG + Intergenic
1080643427 11:34171728-34171750 GTATACTGTTTGTGTTGAGCAGG + Intronic
1080748698 11:35132409-35132431 CTGTATTCTTTGGGTAGAATGGG + Intergenic
1084211231 11:67623876-67623898 GTATAGGGTTTGGGTACAACTGG - Intergenic
1084354358 11:68627314-68627336 GTGTACGGGTTGGGCAGCACAGG - Intergenic
1088457341 11:110046965-110046987 TTGTACTGTTTGGGGAGCAAGGG - Intergenic
1092474646 12:8808096-8808118 GTGTACGGGTTGGGCAGCACAGG - Intergenic
1095797582 12:46237185-46237207 GTTCACTGTTTGGGGAGAAGTGG + Intronic
1096343804 12:50827824-50827846 ATGTACAATTTGGGAAGAACTGG + Intergenic
1096512363 12:52138064-52138086 GTGTACTGTGTGGTCAGAGCAGG - Intergenic
1100530000 12:95454154-95454176 GTGTAAGGGTTGGGTACAACTGG + Intergenic
1100764060 12:97843964-97843986 GTCTCCTGGCTGGGTAGAACAGG + Intergenic
1104306392 12:127614092-127614114 GTGTAAGGGTTGGGTACAACTGG - Intergenic
1105929242 13:25036773-25036795 AGGGACTGTTTAGGTAGAACTGG + Intergenic
1106685395 13:32053786-32053808 GTCTCCTTCTTGGGTAGAACAGG + Intronic
1107296371 13:38913527-38913549 TTGTCCTGTTTGGTTAGAAAAGG + Intergenic
1111115333 13:83769092-83769114 TTGTACTGGTTGTGCAGAACCGG + Intergenic
1112215190 13:97423247-97423269 GTGTAATGTTGGGGTAGAGGCGG + Intergenic
1123695755 15:22878028-22878050 GAGTTGTGTTTGGGAAGAACAGG - Intronic
1126705914 15:51404802-51404824 GTTTCCTGTTGGGGGAGAACTGG - Exonic
1132440188 15:101855034-101855056 GTGTACAGTTTAGCTGGAACTGG - Intergenic
1134251070 16:12574547-12574569 GTGTACTGTTGGAGTCGCACTGG + Intergenic
1135105301 16:19644407-19644429 GTTTCCTTTTTGGGGAGAACGGG + Intronic
1135409897 16:22225695-22225717 GGATACTGCTTGGGTAAAACGGG + Exonic
1140453492 16:75090387-75090409 GTGTCCTTTTTGTGGAGAACGGG + Intronic
1147543598 17:41381268-41381290 ATGTGTTGTTTGGGTAGAATTGG + Intronic
1149274184 17:55015705-55015727 TTGTACCGTTTGGGTTGAAAGGG + Intronic
1150694536 17:67393201-67393223 GTGTACAGTTTCAGTAGAATTGG + Intronic
1154960201 18:21300777-21300799 GTGTCCTGTTGGGGAAGAAGGGG - Intronic
1158576050 18:58639089-58639111 GTGTAGTGTTTGGCTTGCACTGG + Intergenic
1162739862 19:12767755-12767777 GTGTACTGTTTGGGTAGAACAGG - Intronic
1168004684 19:53477134-53477156 GTGTACGGGTTGGGTACCACTGG + Intronic
928636521 2:33252086-33252108 GTGTACTGTCTGGCTAGAACAGG + Intronic
931623093 2:64230621-64230643 GTGTGCTGTTAGGATAGAATAGG - Intergenic
932107436 2:68958511-68958533 TTTTACTGTTTGGTTTGAACAGG - Intergenic
932715249 2:74096230-74096252 GTGTACTTTCTGGGTTGGACTGG - Intronic
939903590 2:147881916-147881938 ATGTACCGTTTGTGTTGAACTGG + Intronic
941227562 2:162867948-162867970 CTGTCCTGTTAGGGTAGAAAAGG + Intergenic
943399226 2:187384335-187384357 ATGGACTTTTTGGGAAGAACAGG - Intronic
944273375 2:197806772-197806794 GTGTCCTGTGTGTGTAAAACAGG + Intronic
1172874661 20:38156904-38156926 GTGTCCTCTTTGGGAAGAAGAGG - Intronic
1175723332 20:61300648-61300670 GGGTCCTGTGTGGGCAGAACAGG - Intronic
1178609560 21:34069080-34069102 CTGTACTGTTAGGGTAAACCGGG + Intergenic
1180894135 22:19315869-19315891 GTGTACCATTTGGGGAAAACGGG - Intergenic
1183359991 22:37378525-37378547 CTGGACTGTTTGGGAAGAGCTGG - Intronic
1184292949 22:43508082-43508104 GTGTTCTGTTTTGGGAGACCAGG - Intergenic
950783377 3:15411603-15411625 GGTTTCTGTTTGGGTAGAAGAGG - Intronic
951837779 3:27001970-27001992 TTGGACTGTTTGGGTTGAAGTGG - Intergenic
956198453 3:66677937-66677959 GTATAATATTTGGGAAGAACTGG + Intergenic
957451593 3:80388055-80388077 GTGTACGGTTTGGGCACCACAGG - Intergenic
957943312 3:87032533-87032555 TTGTACTGCTTGGGTACAGCTGG - Intergenic
959908082 3:111732403-111732425 GTGTAATGATTGGCTAGACCAGG + Intronic
961000389 3:123370346-123370368 GTGTATTGCCTGGGAAGAACAGG - Intronic
966149835 3:176855485-176855507 GTGTTCTGTTTTCCTAGAACAGG - Intergenic
967683514 3:192393271-192393293 GTTTACTGTTTGATTAGAACAGG - Intronic
974187522 4:58461942-58461964 GTATAGGGTTTGGGTACAACTGG - Intergenic
977756073 4:100673870-100673892 GGGGACTGTTTAAGTAGAACGGG + Intronic
978909468 4:114047495-114047517 TTGGACTGTTTGGGTTGAAGGGG - Intergenic
982083818 4:151815148-151815170 GTGTACGGTTTTGGCACAACAGG + Intergenic
983229861 4:165118414-165118436 GTGGAATGTTTGGTTACAACGGG - Intronic
985990834 5:3559703-3559725 TTGTACCATTTGGGAAGAACAGG + Intergenic
993984531 5:94582140-94582162 GTATACTGTTTGCATAGAATGGG + Intronic
996118985 5:119649749-119649771 CTGAACTGTTTGAGTAGATCTGG - Intergenic
1009935702 6:70232380-70232402 GTCTACTGTTGTGGTAGAGCAGG + Intronic
1011536773 6:88384005-88384027 CTGAACTGTTTTGTTAGAACTGG - Intergenic
1013543458 6:111133746-111133768 TTGGACTGTTTGGGTTGAAAGGG - Intronic
1016537836 6:145128031-145128053 GTGTAGGATTTGGGTAGAAAAGG + Intergenic
1017101140 6:150850902-150850924 GTATAGGGTTTGGGTACAACTGG - Intergenic
1018290782 6:162290748-162290770 CTGGACTGTTAGGGCAGAACTGG - Intronic
1018594555 6:165464315-165464337 CTGTAGTGTTTGGTTGGAACCGG - Intronic
1018854887 6:167668080-167668102 GTGTGTGGTTTGGGCAGAACGGG + Intergenic
1020784677 7:12558291-12558313 GTGTGCTGTTTGCATAGTACAGG + Intergenic
1027715586 7:81665126-81665148 AGGTACTGTTTGGGGAGGACTGG + Intergenic
1028947821 7:96600986-96601008 TTGTACAGATTGGGTAGACCAGG + Intronic
1030216666 7:107050383-107050405 GTGCTGTGTCTGGGTAGAACAGG + Intronic
1030935534 7:115581245-115581267 ATGTACTATTTTGGTAGAAAGGG - Intergenic
1032183163 7:129699320-129699342 TTCTACTCTTTGGGTAGAAGAGG - Intronic
1043023059 8:75029105-75029127 GCCTACTGTTTGGACAGAACAGG + Intronic
1044426803 8:92061716-92061738 GTGGATTATTTGGGTAGGACAGG - Intronic
1044885745 8:96775101-96775123 TGGGTCTGTTTGGGTAGAACTGG + Intronic
1045479224 8:102579078-102579100 GTGTGGTCTTTGGCTAGAACTGG - Intergenic
1046117284 8:109799414-109799436 GTGTAGGGTTTGGGGAGAAGTGG + Intergenic
1053326071 9:37152803-37152825 GAATACTGTTTGGGAAGAAGGGG - Intronic
1061598608 9:131649857-131649879 GTGTGCTGCTTGGGTCCAACGGG - Intronic
1186098342 X:6127781-6127803 TTGTGATGTTGGGGTAGAACAGG + Intronic
1187170283 X:16844587-16844609 GTCTACTTTTTGAGTAGAAATGG - Intronic
1189549186 X:42075552-42075574 GAGAACAGTTTGGGTAGATCAGG + Intergenic
1192310018 X:70003630-70003652 TTGTACTGTTTGGGAAATACTGG - Intronic
1192845700 X:74905107-74905129 GGGTACAGTTTGAGTAGAAAAGG + Intronic
1200421479 Y:2974123-2974145 GTGTAGTGTTAGGTTTGAACAGG + Intronic
1202192439 Y:22259043-22259065 GTATACGGTTTTGGTACAACTGG + Intergenic
1202243052 Y:22790007-22790029 GTATAGGGTTTGGGTACAACCGG - Intergenic
1202396039 Y:24423757-24423779 GTATAGGGTTTGGGTACAACCGG - Intergenic
1202474746 Y:25246335-25246357 GTATAGGGTTTGGGTACAACCGG + Intergenic