ID: 1162745673

View in Genome Browser
Species Human (GRCh38)
Location 19:12796719-12796741
Sequence GGCGAAGATGAGCAACCACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 99}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162745673 Original CRISPR GGCGAAGATGAGCAACCACA GGG Intronic
901015397 1:6226505-6226527 GGGGAAGATGCACATCCACAGGG - Intronic
906415977 1:45621768-45621790 GGGGAACATGAGCAGCTACAAGG - Intronic
909104159 1:71388237-71388259 GGCTAATATGAGCCACTACATGG + Intergenic
909695522 1:78464682-78464704 GGCTAAGAAGAGGAGCCACATGG + Intronic
910110583 1:83678461-83678483 GGAGAAGGTGACCACCCACATGG - Intergenic
910117090 1:83743725-83743747 TGGGAAGATTAGCAACAACAGGG - Intergenic
910146590 1:84086753-84086775 GGTGAGGATGGGCAACTACAGGG - Intronic
912517117 1:110223451-110223473 GGCAAAGATGAGCACACCCAGGG - Exonic
921311748 1:213851440-213851462 GGGGAAGATGAGCCAGCAAAGGG - Intergenic
924781585 1:247153910-247153932 GGTGCAGATGAGCAAAGACAAGG - Intronic
1068228252 10:54134969-54134991 GGCCAAGGTGAGCGATCACAAGG + Intronic
1070342506 10:75510784-75510806 GGAGGAGATGAGCAAGCCCAGGG + Intronic
1070418372 10:76211136-76211158 GCCCAAGATGAGCAAAGACATGG - Intronic
1079135130 11:17772152-17772174 GGCGAAGATCAGCACGCCCAAGG - Exonic
1079156084 11:17949264-17949286 GGGGAAGATGGGGAACTACAGGG + Intronic
1082628252 11:55510346-55510368 GGAAAAGATGAGCAAGCACATGG - Intergenic
1089328368 11:117673029-117673051 CGAGGAGATGAGCAAGCACAGGG - Intronic
1089535531 11:119158678-119158700 GGCGAACATGAGGAACAGCATGG - Exonic
1091121713 11:133063237-133063259 GGCGGAGAGAAGCAACCAGAGGG + Intronic
1091815070 12:3431561-3431583 GGAGAGGATGAAAAACCACAAGG + Intronic
1091895421 12:4099239-4099261 GTCGAAGATGAGAAACTTCAAGG + Intergenic
1092555950 12:9561635-9561657 GGAGATTTTGAGCAACCACAGGG - Intergenic
1094516147 12:31129035-31129057 GGAGATTTTGAGCAACCACAGGG + Intergenic
1101919352 12:108919710-108919732 GGAGAAGATGACAAAGCACAGGG + Exonic
1103432628 12:120902026-120902048 GCTCAAGATGAGTAACCACAAGG + Intronic
1114624954 14:24122999-24123021 GAAGAAGCTGACCAACCACAAGG + Exonic
1115300233 14:31877169-31877191 GCTGAAAATTAGCAACCACATGG - Intergenic
1119509628 14:75200547-75200569 GGGGAAGAGCACCAACCACAGGG - Intergenic
1120781569 14:88490436-88490458 GGAGAGGAGGAGCAGCCACAAGG - Intronic
1136222948 16:28840239-28840261 GGCTAAGATGAGCTCCCAGAAGG - Intergenic
1141501922 16:84450425-84450447 GGGGAAGATGAAAAACCCCACGG + Intronic
1143728890 17:8868734-8868756 GGGGAAGTTGATCAACCGCATGG + Intergenic
1143931281 17:10429289-10429311 AGCGAAGAAGAGCAAGGACAAGG - Intergenic
1148124769 17:45231033-45231055 GGTGAAGATGTCCAACCCCAGGG - Intronic
1148999083 17:51738637-51738659 AGCCATGATGAGCATCCACAAGG - Intronic
1152100067 17:78296216-78296238 GGTGAAGAGGAGCTACCACCTGG + Intergenic
1152937402 17:83148431-83148453 GAGTCAGATGAGCAACCACAGGG - Intergenic
1162735663 19:12745668-12745690 GGGGAAGTTGAGCAGCCTCAGGG - Exonic
1162745673 19:12796719-12796741 GGCGAAGATGAGCAACCACAGGG + Intronic
1165879424 19:39032012-39032034 GGCCAGGATCAGCAGCCACAGGG + Exonic
1167577230 19:50323564-50323586 GGCGAAGATGAGCACCCCCAGGG + Exonic
1168608289 19:57777343-57777365 CACCAAGATGAGCAACTACATGG - Intronic
925874340 2:8299068-8299090 TGCGAGGTTGAGTAACCACATGG - Intergenic
930951452 2:57147601-57147623 CACGAAGATGAGCAAAGACACGG + Intergenic
935018028 2:99202461-99202483 GGCCAAGATGAGGAAGCACATGG - Intronic
935718029 2:105955522-105955544 GGCAAAGATGAGCAAGGAAAAGG + Intergenic
936241904 2:110795136-110795158 GACGAAGCAGAGCAGCCACACGG - Intronic
936577026 2:113665794-113665816 GGGGAAGATGTGCCACCAGAGGG - Intergenic
941188070 2:162342472-162342494 GGCGAAGAGGAGCTGCCAGATGG + Intronic
944310205 2:198224756-198224778 GGTGTGGATGAGCAATCACAGGG - Intronic
1170630838 20:18063419-18063441 GGCCAAGGTGGGCAATCACAAGG + Intergenic
1178943268 21:36925363-36925385 GGCCACGATGAACACCCACAAGG + Intronic
1178971428 21:37181299-37181321 GGAGATTATGTGCAACCACAAGG - Intronic
956588274 3:70886552-70886574 GGAGAAAATCAGCAACCTCATGG - Intergenic
957869454 3:86070984-86071006 GGTGAAGATTAGCAACCTCTTGG - Intronic
968661114 4:1799227-1799249 GGGGAAGATGGGCAACCATGAGG - Intronic
969089214 4:4680689-4680711 TGAGAAGATGAGCAATAACAAGG + Intergenic
969137251 4:5039995-5040017 GGAGTAGCAGAGCAACCACAAGG - Intergenic
971193831 4:24453127-24453149 GGAGAAGATGGCCAACTACAAGG + Intergenic
975065836 4:70062419-70062441 CCTGAAGATGGGCAACCACACGG + Intergenic
977696168 4:99968917-99968939 GGAGAAGAGAAGCAACCATATGG - Intergenic
978311145 4:107386206-107386228 TGCGGAGATGAGCAAGCTCAAGG + Intergenic
978737717 4:112103072-112103094 GGGGCAGAGGAGCAACCCCAAGG + Intergenic
983976910 4:173945659-173945681 GGTGAAGATGAGCTACCAACAGG + Intergenic
985847723 5:2364732-2364754 GGGGAAGCTGAGCACCCACCTGG + Intergenic
998170320 5:139868805-139868827 GGCGAGGATGAGCAGGCAGATGG + Intronic
998549828 5:143066826-143066848 GCAGAAGATGAGCCAGCACAGGG + Intronic
999517707 5:152317610-152317632 GGTGAAGATGAATAACCCCAAGG - Intergenic
1001556714 5:172641747-172641769 GGCGCTGATGAGCAAACTCAAGG + Intronic
1008797687 6:55323936-55323958 GGAGAAGCTGAGAAACCACAAGG - Intergenic
1008797781 6:55325636-55325658 GTTTAAGAAGAGCAACCACAAGG - Intergenic
1009196530 6:60693044-60693066 TGCAAAGATGAGCAACAAAATGG - Intergenic
1012466100 6:99517820-99517842 GGGGAAGATGAGAAACCAGCAGG - Intronic
1014575823 6:123070991-123071013 GGAGAATATGAAGAACCACAGGG - Exonic
1016995153 6:149956393-149956415 GACAAAGATAACCAACCACATGG + Intergenic
1017003455 6:150013041-150013063 GACAAAGATAACCAACCACATGG - Intergenic
1017712154 6:157180467-157180489 CTGGAGGATGAGCAACCACACGG - Intronic
1017717759 6:157224213-157224235 GGCGAAGATGAGGAAGGAGAGGG + Intergenic
1027351435 7:77315714-77315736 TCCGAAGATGAGAAAGCACAGGG + Intronic
1029560257 7:101298205-101298227 GGAGAAGATGAGGGACCAGACGG - Intergenic
1030152472 7:106420976-106420998 TGCTGAGATGAGAAACCACATGG - Intergenic
1035348958 7:158229788-158229810 GGGGAAGCTGAGCAAGAACAAGG + Intronic
1039119039 8:34125335-34125357 GGCGAAGATCAGCTACAAAATGG - Intergenic
1039947532 8:42142840-42142862 GGGGATGATAAGCAATCACAGGG - Intergenic
1042528455 8:69790784-69790806 GGTGAAGATCAGCAGTCACATGG + Intronic
1042779100 8:72469913-72469935 AGTGATGATGAGCTACCACATGG - Intergenic
1043157087 8:76796571-76796593 GGGGAAGATGAGCAACAGCGTGG + Intronic
1043676384 8:82961129-82961151 GGAGAAGTTGAGTAACCAAAAGG + Intergenic
1044107283 8:88225778-88225800 GGGGGAAATGAGCAACCTCATGG - Intronic
1045487243 8:102641004-102641026 GGAGAAGATGGCCACCCACAAGG + Intergenic
1049055973 8:140237876-140237898 GGCAAAGATGAGAAATGACAAGG + Intronic
1049668274 8:143858508-143858530 GGAGAAGATGAGCATCTACCAGG - Exonic
1049668690 8:143860107-143860129 GGAGAAGATGAGCATCTACCAGG - Exonic
1049669105 8:143861709-143861731 GGAGAAGATGAGCATCTACCAGG - Exonic
1049669520 8:143863311-143863333 GGAGAAGATGAGCATCTACCAGG - Exonic
1049669930 8:143864904-143864926 GGAGAAGATGAGCATCTACCAGG - Exonic
1049670347 8:143866512-143866534 GGAGAAGATGAGCATCTACCAGG - Exonic
1055709506 9:79044850-79044872 GGAGAAGTTGAGCAGCCAAATGG - Intergenic
1058246356 9:102630912-102630934 GTAAAAGATGAGCAACCCCAAGG - Intergenic
1060816164 9:126636392-126636414 GGCAAAGATCAGCATGCACAAGG + Intronic
1185803129 X:3031338-3031360 GGTGGAGATAAGCAACCACCCGG - Intronic
1186786321 X:12959404-12959426 GGCCAAGAAGAACAACCACAAGG - Intergenic
1189272336 X:39760265-39760287 GGTGAAGACGAGCAAGCAGAGGG + Intergenic
1193239849 X:79155334-79155356 GTAGAAGATGAGTAACCAAAAGG - Intergenic
1197440299 X:126480021-126480043 GGCTACTATGAGCAACTACATGG + Intergenic