ID: 1162753578

View in Genome Browser
Species Human (GRCh38)
Location 19:12843657-12843679
Sequence GTGTGGGTCTTCAGGCTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 360
Summary {0: 1, 1: 1, 2: 7, 3: 43, 4: 308}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162753578_1162753589 0 Left 1162753578 19:12843657-12843679 CCCTCCAGCCTGAAGACCCACAC 0: 1
1: 1
2: 7
3: 43
4: 308
Right 1162753589 19:12843680-12843702 CCAGGCCAGCAGTCCAGGCTGGG 0: 1
1: 0
2: 0
3: 46
4: 488
1162753578_1162753592 17 Left 1162753578 19:12843657-12843679 CCCTCCAGCCTGAAGACCCACAC 0: 1
1: 1
2: 7
3: 43
4: 308
Right 1162753592 19:12843697-12843719 GCTGGGCTTGATGACAGTTTAGG 0: 1
1: 0
2: 0
3: 8
4: 165
1162753578_1162753585 -5 Left 1162753578 19:12843657-12843679 CCCTCCAGCCTGAAGACCCACAC 0: 1
1: 1
2: 7
3: 43
4: 308
Right 1162753585 19:12843675-12843697 CACACCCAGGCCAGCAGTCCAGG 0: 1
1: 0
2: 3
3: 37
4: 338
1162753578_1162753593 18 Left 1162753578 19:12843657-12843679 CCCTCCAGCCTGAAGACCCACAC 0: 1
1: 1
2: 7
3: 43
4: 308
Right 1162753593 19:12843698-12843720 CTGGGCTTGATGACAGTTTAGGG 0: 1
1: 0
2: 1
3: 5
4: 108
1162753578_1162753587 -1 Left 1162753578 19:12843657-12843679 CCCTCCAGCCTGAAGACCCACAC 0: 1
1: 1
2: 7
3: 43
4: 308
Right 1162753587 19:12843679-12843701 CCCAGGCCAGCAGTCCAGGCTGG 0: 1
1: 0
2: 3
3: 51
4: 488
1162753578_1162753594 23 Left 1162753578 19:12843657-12843679 CCCTCCAGCCTGAAGACCCACAC 0: 1
1: 1
2: 7
3: 43
4: 308
Right 1162753594 19:12843703-12843725 CTTGATGACAGTTTAGGGCCAGG 0: 1
1: 0
2: 0
3: 5
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162753578 Original CRISPR GTGTGGGTCTTCAGGCTGGA GGG (reversed) Intronic
900751549 1:4401029-4401051 CTGTGGCTCTTCAGGCTTGAGGG + Intergenic
901597574 1:10397885-10397907 GGCTGTGTCTCCAGGCTGGAGGG - Intergenic
903575136 1:24335178-24335200 CTGTGGGTCTTCAGGGGAGAGGG - Intronic
903754181 1:25649396-25649418 GTGTGGGACCTAAGGCTGGTTGG + Intronic
904000150 1:27334290-27334312 GTGTGGGTGGGCAGGCAGGAGGG - Intronic
904902269 1:33866745-33866767 GTATGAGTGTACAGGCTGGAGGG - Intronic
905234509 1:36536698-36536720 GTGAGGGTCTTCTTGCTGGTGGG - Intergenic
905537900 1:38737975-38737997 GTGTGGTTCTTCAAGCTGGAAGG - Intergenic
906108586 1:43308857-43308879 TTGCTGGTTTTCAGGCTGGAGGG + Intronic
908494350 1:64679634-64679656 CTGTGGGTCCTGTGGCTGGAGGG + Exonic
909034920 1:70586154-70586176 GTGGGGGTCTTCAAACTGGTTGG - Intergenic
910603621 1:89058307-89058329 TTTAGGCTCTTCAGGCTGGATGG + Intronic
913184698 1:116359552-116359574 GTGATGGTCTTCAGGGTGGTGGG - Intergenic
913288592 1:117250959-117250981 GTGGGGGTCTTCAAACTGGTTGG + Intergenic
915101502 1:153504083-153504105 GTGAGGGTCTTCTTGCTGGTGGG - Intergenic
916167782 1:161978811-161978833 CTGTGTGTCTTCAGGCTTGAGGG + Intergenic
916291642 1:163173425-163173447 GTGTGGGTATGCTGGCTGGCTGG + Intronic
916384204 1:164249453-164249475 GTGTGGGTTTCCAGACTTGAGGG - Intergenic
916597373 1:166257506-166257528 CTGTGGCTGTTCAGCCTGGAAGG + Intergenic
916828198 1:168463623-168463645 ATGGGGGTCCCCAGGCTGGATGG - Intergenic
917515327 1:175702424-175702446 CTGTGGGTCTGGAAGCTGGAAGG - Intronic
917539844 1:175901893-175901915 CTGTGGGTTTTCAGGCTTGAGGG - Intergenic
917969904 1:180199797-180199819 GGGTGGGGGTCCAGGCTGGAGGG + Exonic
919048113 1:192480043-192480065 CTGTGGGTCTCCAGGCTTAAGGG - Intergenic
922702893 1:227772024-227772046 GAGTGGGACTTCAGGCTTGGAGG + Intronic
923449939 1:234107062-234107084 ATGTGGGTCTGCAGGTTGGGAGG + Intronic
923988188 1:239405244-239405266 GTGTGGGTCACCTGGCTCGAGGG - Intronic
924159321 1:241214153-241214175 GAGGGGGTCTTCAGGCTGAAAGG - Intronic
924556667 1:245124733-245124755 GTGGGGGTCTTCAAACTGGTTGG - Intronic
924640120 1:245825513-245825535 TTCTGTGTCTTCAGGCTGGAAGG + Intronic
924829892 1:247582399-247582421 GTGTGGGTCTGGGGGCTGTAAGG - Intergenic
1063622074 10:7658866-7658888 GTGTTGATGTTCATGCTGGAGGG + Intronic
1064309198 10:14197037-14197059 TTCTGGGTCTTCAGGCTGGCAGG - Intronic
1064705552 10:18069431-18069453 CTGTGGGTCTCCAGGCTTGAGGG - Intergenic
1065697414 10:28392481-28392503 ATGGGGGTCTTCAAACTGGATGG + Intergenic
1065966919 10:30778219-30778241 GTGGGGGTCTTCGAGCTGGTGGG - Intergenic
1066573608 10:36801280-36801302 GTGAGAGTCTCCAGGGTGGAAGG + Intergenic
1068165913 10:53332916-53332938 GCATGGGTCTTCAGGCTTGAGGG - Intergenic
1068523506 10:58103293-58103315 GTGTGGGGGTTCAGTCAGGATGG - Intergenic
1070450435 10:76552427-76552449 CTGTGGGGTTACAGGCTGGATGG + Intronic
1070850578 10:79559175-79559197 GGGTGGGACTTCAGTCTGCAGGG - Intronic
1070856640 10:79612112-79612134 GGGTGGGACTTCAGTCTGCAGGG + Intronic
1070962537 10:80509243-80509265 GTGTGGGGGTGCAGGCTGGTGGG + Intronic
1071572827 10:86707534-86707556 ATGTGGCGCATCAGGCTGGATGG + Intronic
1073193312 10:101667915-101667937 GACTCGGTCTTCAGTCTGGATGG + Exonic
1075075009 10:119344852-119344874 GGGTGGGTCTTGTGGCTGGCTGG - Intronic
1075134230 10:119768618-119768640 GTGTGAGTGTTCAGGCTGATGGG + Intronic
1076430538 10:130398863-130398885 CTGCGGGTCTTCAGCCTTGAGGG + Intergenic
1077714604 11:4569018-4569040 CTGTGGGTTTCCAGGCTTGAGGG - Intergenic
1078051782 11:7971726-7971748 ATCTCGGTGTTCAGGCTGGAGGG + Intronic
1079940876 11:26678844-26678866 CTGTGGGTCTTTAGGATGCATGG - Intronic
1080532621 11:33191869-33191891 GTGAGGGTCTTCTTGCTAGAGGG + Intergenic
1081612089 11:44568783-44568805 GTTTGGGTCCCCAGGGTGGAAGG - Intronic
1082751472 11:57022802-57022824 CTGTGGGTCTCCAGGCTTGAGGG + Intergenic
1084083513 11:66843977-66843999 CTGATGGGCTTCAGGCTGGAGGG + Exonic
1084444160 11:69193807-69193829 GTGTGAGTCAGCAGGGTGGAGGG + Intergenic
1085910445 11:80818725-80818747 GTGTGTGTAGTCAGGCTGGAGGG - Intergenic
1086417573 11:86604251-86604273 GTGTTGGTGTTAAAGCTGGAGGG + Intronic
1086434523 11:86768321-86768343 GTGAGGGTCTTCTTGCTGGTGGG - Intergenic
1086737401 11:90323073-90323095 CCCTGGGTCTTCAGGCTTGAGGG + Intergenic
1087551418 11:99655097-99655119 GTGGGGGTCTTCAAACTGGTAGG + Intronic
1087882871 11:103439413-103439435 GGAGGGGTGTTCAGGCTGGAGGG + Intronic
1088305202 11:108400207-108400229 TTGTGCTTCTTCAGGATGGATGG + Intronic
1090444774 11:126754740-126754762 CTTTGGGTCTACAGGTTGGAAGG + Intronic
1090540772 11:127700624-127700646 CTGTGGGTCTCCAGGCTTGAGGG + Intergenic
1090606167 11:128424875-128424897 TTGTGGGACTCCAAGCTGGAAGG - Intergenic
1091312803 11:134586539-134586561 GTGGGGGTCTTCAAACTGGCTGG - Intergenic
1091747272 12:3000373-3000395 GTGAGGGCCTTCGTGCTGGAGGG + Intronic
1092555405 12:9555062-9555084 GTGAGGTTATTCAAGCTGGAGGG + Intergenic
1093749288 12:22779839-22779861 CTGTGGGTTTCCAGGCTTGAGGG + Intergenic
1094516693 12:31135620-31135642 GTGAGGTTATTCAAGCTGGAGGG - Intergenic
1094745654 12:33341508-33341530 GTGTGGGTTTCCAGGTTTGAGGG + Intergenic
1096115223 12:49051403-49051425 GTGTGGCTCCTCAGGCCGGGGGG + Exonic
1096939556 12:55327040-55327062 GAGTGGGTCTTCTGGCTCCATGG - Intergenic
1097189859 12:57214501-57214523 GTGTGGGGCTTCAGGATAGGCGG - Intergenic
1097246071 12:57608512-57608534 GTTTGGGTGTTCAGCCTGGGAGG - Exonic
1097897688 12:64841997-64842019 GTGTAGGTCTTCTGGTTGGTGGG + Intronic
1100099262 12:91082645-91082667 GTGTGGGTTGACAGGCTGCATGG + Intergenic
1100386961 12:94112634-94112656 CTGTGAGTCTCCAGGCTTGAGGG - Intergenic
1102347719 12:112170177-112170199 GTGTGTGGCTTCCTGCTGGAAGG - Intronic
1104914751 12:132258845-132258867 CTGTGGGTCTCCAGCGTGGACGG - Intronic
1105708958 13:22986829-22986851 GAGAGGGTCTTCAGACTGGCTGG - Intergenic
1106800818 13:33254531-33254553 CTGTGGGTCTTCAGGCTTGATGG - Intronic
1107158846 13:37201598-37201620 GTGAGAGTCTTCAAGCTGGTTGG + Intergenic
1107388105 13:39934390-39934412 ATGTGGGTCTTCAAATTGGATGG + Intergenic
1107474002 13:40717315-40717337 GTCTGTGGCTCCAGGCTGGAGGG - Intergenic
1107660713 13:42636545-42636567 GTGGGGGTCTTCAAACTGGTTGG + Intergenic
1112259721 13:97867416-97867438 TTGTGGGTCTCCAGGCTTGAGGG - Intergenic
1112399708 13:99065424-99065446 TTGTGGGTTTTCGAGCTGGAAGG - Intronic
1112920256 13:104604027-104604049 CTGTGGGTCTTAAGCCTTGAGGG - Intergenic
1113035938 13:106048960-106048982 GGGTGGGTCTGCAAGCTGGAGGG - Intergenic
1113062015 13:106331968-106331990 CCGTGGGTCTCCAGGCTTGAGGG + Intergenic
1113073145 13:106441149-106441171 GTGTGGGGGTGGAGGCTGGAAGG + Intergenic
1114226047 14:20739966-20739988 GTGGGGGTCTTCAGACTGGTTGG - Intronic
1114227381 14:20751698-20751720 GTGGGGGTCTTTAGACTGGTTGG - Intergenic
1115707694 14:36015120-36015142 GAGTGGGTCTTCAGCCTCCAGGG - Intergenic
1115961025 14:38836276-38836298 CTGTGTGTCCTGAGGCTGGACGG + Intergenic
1118748092 14:68788793-68788815 GTGTAGGTCTGCAGGAAGGAAGG - Exonic
1120280511 14:82432050-82432072 TCGTGGGTCTCCAGGCTTGAGGG + Intergenic
1121847783 14:97188463-97188485 ATGTGGTTCTTCTGGCTGGAAGG - Intergenic
1122244009 14:100388508-100388530 GTGTGGGGCTTTAGACTGGTTGG + Intronic
1123957875 15:25358287-25358309 GTTTGAGTCTTCAGCCTGGGAGG + Intronic
1125533406 15:40428659-40428681 GTGTGGGTGATCAGGTGGGAGGG - Intronic
1125909679 15:43425085-43425107 GTGAGGGCCTTCTTGCTGGAGGG - Intronic
1126129496 15:45326527-45326549 GTGGGGGTCTTCAAACTGGTTGG + Intergenic
1126910336 15:53410666-53410688 GTGAGAGTCTGCAGGCTGGGTGG + Intergenic
1127341545 15:58049996-58050018 GTGTGGGTCTTGAGGGGGAAGGG + Intronic
1128217639 15:65945383-65945405 GTGTGGGGCTGCAGGCCTGAGGG + Intronic
1131898231 15:97057718-97057740 GTGTGGCTCTGTGGGCTGGAGGG + Intergenic
1136619151 16:31416497-31416519 GTCAGGGTCTGCAGGCTGAAGGG - Exonic
1137552688 16:49451438-49451460 GTGAGAGTCTGCAGGCAGGAAGG - Intergenic
1137754458 16:50890236-50890258 GGGTGTGTCTTCAGGATAGAAGG + Intergenic
1139093808 16:63680409-63680431 CCGTGGGTCTCCAGGCTTGAAGG + Intergenic
1139532129 16:67547553-67547575 GGGTGGGACTTCAGGATGGCAGG + Intergenic
1139750498 16:69106632-69106654 GTGCGGGGCTCCAGGCTGGCTGG + Intronic
1142306458 16:89288662-89288684 GTGTCTGTTTCCAGGCTGGACGG - Exonic
1142334522 16:89479038-89479060 GTGTGGGTCTTGAGGCCCGAAGG - Intronic
1142602265 17:1059515-1059537 AGGTGGGGCTTCAGGCTGAAAGG - Intronic
1142945431 17:3422499-3422521 GTGTGTATTTTCAGGCTAGAAGG - Intergenic
1143411573 17:6712632-6712654 ATGTGGCTCTCCAGGTTGGAAGG + Intronic
1143721989 17:8818933-8818955 GAGTGGGTCTTCCTGTTGGAAGG - Intronic
1144157310 17:12518412-12518434 GTGTAGCTCTGGAGGCTGGATGG - Intergenic
1144371311 17:14594339-14594361 TGGTGGGTCTCCAGGCTTGAGGG - Intergenic
1144953455 17:19005771-19005793 GTGTAGGACTTCATGCTTGAGGG - Intronic
1145242469 17:21248000-21248022 AGGAGGGTCTTCAGGCTGAAAGG + Intronic
1146346405 17:32062980-32063002 GTGTGGGACTCCTGGCTGGGTGG + Intergenic
1147484797 17:40802267-40802289 GGCTGGGACATCAGGCTGGAAGG + Intergenic
1148852000 17:50560107-50560129 GGGTGGGGCTTCAGGCTGGAGGG - Intergenic
1149907712 17:60541836-60541858 GTGAGGGTCTTCTTGCTGGTGGG - Intergenic
1149990058 17:61378140-61378162 GGGTGGGAGGTCAGGCTGGAAGG - Intronic
1150003439 17:61455786-61455808 GTGTGGCTGCTCAGGCTGGTGGG + Intronic
1150740493 17:67775594-67775616 GTGTTGGTGTTAATGCTGGAAGG + Intergenic
1151156220 17:72124316-72124338 CTGTGGGTCTGCGGGATGGAAGG - Exonic
1151291913 17:73156580-73156602 GGGTGGGTCTTCATGCTGAGCGG - Intergenic
1151473910 17:74334612-74334634 CTGTCAGCCTTCAGGCTGGATGG - Intronic
1152607730 17:81301463-81301485 GTGTGGGCATTGAAGCTGGAAGG - Intergenic
1153157492 18:2166234-2166256 GTGGGGGTCTTCAGAATGGTGGG + Intergenic
1156684287 18:39626082-39626104 GTTTGGGTTTACAGACTGGATGG - Intergenic
1157151231 18:45220804-45220826 TTGTGGTTCTCGAGGCTGGAAGG + Intronic
1157508942 18:48253984-48254006 ATGGGGGTCTTCAGGCTGGTTGG - Intronic
1158057953 18:53304234-53304256 CTGTGGGTTTCCAGGCTTGAGGG + Intronic
1158897002 18:61923531-61923553 GTGAGAGTCTTCTGGCTGGTGGG + Intergenic
1161123418 19:2542734-2542756 GTTGGGGTCTCCAGGCTGGAGGG + Intronic
1161296416 19:3522735-3522757 GTGTGGATATACAGGCTGGGAGG + Intronic
1161615546 19:5268296-5268318 TTTTGGCTCTACAGGCTGGACGG - Intronic
1162753578 19:12843657-12843679 GTGTGGGTCTTCAGGCTGGAGGG - Intronic
1162825508 19:13249000-13249022 GTGTTGTTGCTCAGGCTGGAGGG + Intronic
1162989473 19:14293141-14293163 GTGTGGGACTCCTGGCTGGGTGG - Intergenic
1163729962 19:18943192-18943214 GACTGGGGCTTCAGGATGGATGG - Intergenic
1165597635 19:37024008-37024030 GTGTTGATGTTCATGCTGGAGGG - Intronic
1166198909 19:41223603-41223625 CTGGGGGTCTCCAGGGTGGAGGG + Intronic
1166210171 19:41301891-41301913 GTTGGGGTTTTCAGGCTGGATGG + Intronic
1168082447 19:54020217-54020239 GGGTGGGTCTTCAGCCTTGCTGG - Intergenic
925277770 2:2662572-2662594 GTGTGGCTGTTGAGGCTGGGAGG - Intergenic
926059964 2:9799089-9799111 GTGGGGGTCTTCGAGCTGGTTGG + Intergenic
928103864 2:28455064-28455086 CCGTGGGTCTTCAGGCTTGAGGG - Intergenic
929092895 2:38237277-38237299 GTGTGGGGGTTCAGTCAGGATGG + Intergenic
930903802 2:56541392-56541414 GTGAGGGTCTTCTTGCTGGTGGG + Intergenic
932002125 2:67894570-67894592 GTGTGGGTATTAAGGCTAGGAGG - Intergenic
932466179 2:71925781-71925803 CAGTGGCTCTTCAGGGTGGATGG + Intergenic
933409804 2:81910537-81910559 CTGTGGGCCTCCAGGCTTGATGG + Intergenic
935256158 2:101311413-101311435 GTGGGGGTCTTCAGATTGGTTGG + Intergenic
935280865 2:101516687-101516709 GTGGGGGTCTTCAGACTGGTTGG - Intergenic
935370937 2:102345873-102345895 GTGTGAGTGGGCAGGCTGGATGG - Intronic
935381149 2:102452254-102452276 GTGTGTGTGTTCAGGCTGATAGG + Exonic
936404098 2:112187219-112187241 ATGGGCGTCTTCAGGTTGGAAGG - Exonic
939256100 2:139746801-139746823 CTGCGGATCTTCAGGCTTGAGGG - Intergenic
939391177 2:141571018-141571040 GGGTGTGTCTCCAAGCTGGAGGG - Intronic
940019860 2:149145517-149145539 ATGTGGTTCTTCAGGCTTGCCGG - Intronic
940170096 2:150819577-150819599 GTAGGGGTCTTCAGGCTGGTTGG - Intergenic
940486737 2:154305298-154305320 GTGTGTGTGTTCAGGAAGGAGGG + Intronic
943948110 2:194093295-194093317 GTGTGGGGGTTCAGTCAGGATGG - Intergenic
944537876 2:200729141-200729163 GTGTGGGTCTGCATTCTAGAGGG - Intergenic
945697837 2:213130490-213130512 GGGTGGGTCTTAAGGTTGGTGGG - Intronic
946165760 2:217862944-217862966 CTGTAGGTCTGCTGGCTGGAAGG - Intronic
946391161 2:219417867-219417889 GTGGGGGTCTCTAGGCAGGAAGG - Intergenic
946538491 2:220657856-220657878 GTGTGGGTCTTCAGGCTTGAGGG + Intergenic
946547568 2:220761460-220761482 GGGAGGGTCTACAGGCTGAAGGG - Intergenic
946712104 2:222517198-222517220 CAGTGGGTTTCCAGGCTGGAGGG - Intronic
946790351 2:223294661-223294683 CTGCTGGTCTTCAGACTGGAAGG - Intergenic
947129118 2:226903701-226903723 CTGTGGGTTTCCAGGCTTGAGGG - Intronic
947714892 2:232334505-232334527 GTGAGGGGCACCAGGCTGGAGGG - Intronic
947733967 2:232445456-232445478 GTGAGGGGCACCAGGCTGGAGGG - Intergenic
948509031 2:238450819-238450841 GTGTGGGTCTTCTGGCTCTGGGG + Exonic
948610105 2:239161645-239161667 CTGGGGACCTTCAGGCTGGAGGG - Intronic
948915565 2:241033596-241033618 GTCTGTGTCTTCCAGCTGGACGG - Intronic
948992664 2:241562672-241562694 TTGTGGTTCTGCAGGCTGGTGGG + Intronic
949053787 2:241912996-241913018 GTGTGGGCCCTGAGTCTGGAAGG + Intergenic
1171171994 20:23023763-23023785 ATGGGGGTCTTCATGCTGGTGGG - Intergenic
1171341239 20:24431222-24431244 GTGGGGGTGTTTGGGCTGGAAGG - Intergenic
1171341487 20:24432136-24432158 GTGGGGGGATTCTGGCTGGAAGG - Intergenic
1171367178 20:24633334-24633356 CTGTGGGCCTTCGGGCTGGGTGG - Intronic
1172102348 20:32492895-32492917 GTGTGGGTCTCCAGGGTGTGTGG + Intronic
1172143739 20:32742602-32742624 GTGGGGGTCTTCATCCTCGATGG - Intronic
1172903360 20:38350803-38350825 CTGTGGATGTTCAGGCTGAAGGG - Exonic
1173059566 20:39648411-39648433 CTGCGGGTTTTCAGGCTTGAGGG + Intergenic
1173215555 20:41079027-41079049 GTGTCAGTATTCAGGCAGGAGGG + Intronic
1173369876 20:42426131-42426153 CTGTGGGTTTCCAGGCTTGAGGG - Intronic
1173396976 20:42689085-42689107 CTGTGGGTCTTCAGGCTTGAGGG - Intronic
1173915442 20:46704843-46704865 GTGGGGGTCTTCAAACTGGTTGG + Intergenic
1177943496 21:27440265-27440287 ACTTGGGTCTTCAGGCTGGAGGG - Intergenic
1178097856 21:29234812-29234834 CTGCCGGTCTTCAGGCTTGAGGG + Intronic
1178469435 21:32878860-32878882 TTGTGGGTCTGCACGCTGGTTGG + Intergenic
1179284276 21:39963251-39963273 CTCTGGGTCCTCAGGCTGCATGG + Intergenic
1179942510 21:44649211-44649233 GAGGGTGTCTGCAGGCTGGAGGG - Intronic
1180170708 21:46056858-46056880 GTCAGGGCCTGCAGGCTGGATGG + Intergenic
1181491627 22:23263839-23263861 GATTTGGTCTTCAGTCTGGATGG - Intronic
1183026361 22:35068407-35068429 CTGTGTGTCTGCAGGCAGGAAGG + Intronic
1184979367 22:48085114-48085136 GTGTGGGGCTGCTGGCTGGGAGG + Intergenic
1185224021 22:49643001-49643023 GTCTGGATCTGCAGGCAGGAGGG - Intronic
949374950 3:3378959-3378981 GTGAGGGTCTTCTTGCTGGTGGG + Intergenic
949764944 3:7516073-7516095 GGGAGGATCTTGAGGCTGGAAGG + Intronic
949808321 3:7978786-7978808 CTGCGGGTCTTCAGGCTTGAGGG + Intergenic
951923046 3:27876811-27876833 GGGTCTGTCTTCAGGCTGCAAGG + Intergenic
952422780 3:33146304-33146326 GTTTGGTTCTGCAGGCTGGTGGG + Exonic
954449113 3:50562264-50562286 GTGTGGGCTCCCAGGCTGGAGGG - Intronic
957383603 3:79467332-79467354 CTATGGGTCTCCAGGCTTGAGGG - Intronic
958524723 3:95241092-95241114 CTGTGGGTTTTCAGGCTTGAGGG + Intergenic
959254697 3:103993214-103993236 CTGCGGGTATTCAGGCTTGAGGG + Intergenic
959585308 3:108020237-108020259 ATGTGTTTGTTCAGGCTGGATGG - Intergenic
960631563 3:119737036-119737058 ATGTTGGTCATCAGGCTGGTCGG + Intronic
961527091 3:127511316-127511338 GTGAGGGTTTTCTTGCTGGAGGG - Intergenic
962290697 3:134134229-134134251 GTGTGGGACTGCAGTTTGGAGGG - Intronic
962850993 3:139308294-139308316 CTGTGTGTCCTCAGGCTGCAAGG - Intronic
963710109 3:148737573-148737595 GTGTGGGTGTCCAGGATGCAAGG - Intronic
965921439 3:173920101-173920123 ATGTTGATCTTCAGGCTGAAAGG + Intronic
967270028 3:187725560-187725582 GTGTGGGTTTTCAGGTTGGCTGG + Exonic
967351814 3:188522300-188522322 GTGTGTATCATCAAGCTGGACGG - Intronic
969389291 4:6878957-6878979 GTTTGGGGTTTGAGGCTGGAGGG - Intronic
971742732 4:30540435-30540457 CTGTGGGTTTCCAGGCTTGAGGG + Intergenic
972577574 4:40365837-40365859 GTCAGGGTCTTCAGCATGGAAGG + Intergenic
973705454 4:53576013-53576035 GTGTTGGGCTTCAGGCTGGTGGG - Intronic
973763065 4:54138679-54138701 GTGGGGGTCTTCAAACTGGTTGG - Intronic
974550265 4:63363138-63363160 CTTTGTGTCTTCAGGCTTGAGGG + Intergenic
974862962 4:67545682-67545704 GGGTGGGTCTGCAGGCTGGAGGG - Intergenic
975417106 4:74117408-74117430 CAGTGGGTTTTCAGGCTGCAGGG + Intronic
975781755 4:77847812-77847834 GTGAGGGTCTTCAAACTGGTTGG - Intergenic
976347899 4:84026283-84026305 GGGAGGGATTTCAGGCTGGAAGG + Intergenic
976890452 4:90039987-90040009 CTGCAGGTCTTCAGGCTTGATGG + Intergenic
977293350 4:95186935-95186957 GTGTGTGACTCAAGGCTGGATGG - Intronic
977441152 4:97070056-97070078 TTGTGGGTTTCCAGGCTTGAGGG - Intergenic
977738229 4:100444172-100444194 ATGTGGCTGTTCAGCCTGGAGGG + Intronic
979600908 4:122585873-122585895 CCATGGGTCTTCAGGCTTGAGGG - Intergenic
980318207 4:131233993-131234015 CTGTGGGTTTCCAGGCTTGAGGG - Intergenic
980404130 4:132334262-132334284 GTTTGGGTCTTCATGTTGGAAGG + Intergenic
980516487 4:133868961-133868983 GTTTGCATCTGCAGGCTGGATGG - Intergenic
981207701 4:142063281-142063303 GTATGGGTCTTCAGTCAGGCAGG - Intronic
981314871 4:143332221-143332243 GTACAGGTTTTCAGGCTGGAAGG - Intergenic
982326845 4:154137145-154137167 CCATGGGTCTTCAGGCTTGAAGG + Intergenic
982632113 4:157843662-157843684 GGGTGGGTGTTCAGGCAGAAAGG + Intergenic
984520576 4:180796659-180796681 CTGTGGGTATCCAGGCTTGAGGG + Intergenic
985017439 4:185651198-185651220 GCAGGGGTCTGCAGGCTGGAAGG - Intronic
985138357 4:186812335-186812357 CTGTGGGTCTCCAGGCTTGAGGG + Intergenic
986219335 5:5753479-5753501 GTGTTGATGTTCATGCTGGAAGG + Intergenic
986278456 5:6302621-6302643 GTGTGGGAGTTCAGGCAGGCTGG - Intergenic
986629122 5:9752477-9752499 GTGAGGGGCCTCAGGCTAGACGG - Intergenic
986990204 5:13543677-13543699 GTGTGGGTCCTGAGTCTGGTTGG - Intergenic
987504878 5:18754652-18754674 TCGTGGGTTTTCAGGCTTGAGGG + Intergenic
989322384 5:40151415-40151437 GTGTGGGTTTTGGGGGTGGAGGG - Intergenic
989541971 5:42628295-42628317 CTGCAGGTCTTCAGGCTTGAGGG + Intronic
989542246 5:42630974-42630996 CTGCAGGTCTTCAGGCTTGAGGG + Intronic
992637076 5:78735470-78735492 CTGTGGGTTTTCAGGCTTGAGGG - Intronic
992679982 5:79143928-79143950 GAGTGGGATTTCAGGGTGGAAGG - Intronic
992872597 5:81021976-81021998 GTGGGGGTCTTCAGACCGGTTGG + Intronic
994778620 5:104065371-104065393 GAATGGGCCTTGAGGCTGGAAGG + Intergenic
995239524 5:109870347-109870369 GTCTGGGCCAGCAGGCTGGAGGG - Intergenic
995772746 5:115690091-115690113 GTGAGAGTCTTCTGGCTGGTGGG + Intergenic
996648010 5:125840794-125840816 CTGTGGGTCTCCAGGCTTGGGGG - Intergenic
997778643 5:136634747-136634769 CTGTGGGTATTCAGGATGGAGGG + Intergenic
999811016 5:155127099-155127121 CTGTGGGTCTTCAGGCTTGAGGG + Intergenic
1000282617 5:159795065-159795087 TTTTGGTTATTCAGGCTGGATGG + Intergenic
1001977188 5:176009768-176009790 CTGCAGGTCTTCAGGCTGGAGGG - Intronic
1002240237 5:177834012-177834034 CTGCAGGTCTTCAGGCTGGAGGG + Intergenic
1002581789 5:180213050-180213072 GTGCGGGTCCTCAGGGAGGAAGG + Intergenic
1002584332 5:180232571-180232593 GTGGGGGTTTTCAGGGAGGAGGG - Intergenic
1003613791 6:7636890-7636912 GTGAGGGCCTTCTTGCTGGAGGG + Intergenic
1004433028 6:15563624-15563646 GTGGGGATCTTCAAGCTGGTTGG - Intronic
1004469591 6:15917287-15917309 CTGTGGGTATTCAGGCTTGAGGG + Intergenic
1004609375 6:17224800-17224822 GTGGGGGTCTTCAAGCTGGCTGG + Intergenic
1006280486 6:33049230-33049252 GTGTGGGGGTTCAGTCAGGATGG + Intergenic
1007246993 6:40470132-40470154 GTGGGGTTCTGCAGGCAGGATGG - Intronic
1007421766 6:41723948-41723970 CTGTGGGGCTTCTGGCTAGAAGG - Intronic
1011229246 6:85141474-85141496 GTGTGGATCTTCAAACTGGTTGG - Intergenic
1011491885 6:87901035-87901057 CTGTGGGTTTCCAGGCTTGAGGG + Intergenic
1011609261 6:89134427-89134449 GTGTGGGGGTTCAGTCAGGATGG - Intergenic
1012173292 6:96046557-96046579 GTGTAGGTCTTCAGGATGGGTGG - Intronic
1014825754 6:126047188-126047210 CCGTGGGTTTTCAGGCTTGAGGG - Intergenic
1016569027 6:145492177-145492199 GTGTGGGTCTTGGGGCTAGCTGG + Intergenic
1018060605 6:160086879-160086901 GTGTGTGTGGTCAGGGTGGAAGG + Intronic
1018526087 6:164710937-164710959 GCCGGGGTCTTCAGGCTTGAGGG + Intergenic
1018735611 6:166685286-166685308 GGGTGTGTGTGCAGGCTGGAAGG + Intronic
1019577186 7:1743255-1743277 CTGAGGGTCTCCAGGCAGGACGG - Intronic
1021149252 7:17129209-17129231 GTGAGGGTCTTCTTGCTGGTGGG - Intergenic
1022601814 7:31767953-31767975 GTGTGGGGGTTCAGTCAGGATGG + Intronic
1022873475 7:34503880-34503902 TTGTGGTTCTGCAGGCTGCATGG + Intergenic
1023505071 7:40890593-40890615 GTTGGAGTCTTCAGGCAGGATGG - Intergenic
1023873778 7:44276186-44276208 GGGCGGGTCTCCAGGCTGGGAGG + Intronic
1024086000 7:45892077-45892099 GTGTGCGTCGTCAGGGTGAAAGG + Intronic
1024114374 7:46178472-46178494 GTGTGTTTCTTCAGGCACGATGG + Intergenic
1024225925 7:47326979-47327001 GTGTGTGTATTCCAGCTGGAAGG - Intronic
1024558463 7:50623595-50623617 GTGGGTGTCTGCAGCCTGGAGGG - Intronic
1026057251 7:66995466-66995488 CTGGTGGCCTTCAGGCTGGACGG - Exonic
1026720863 7:72829585-72829607 CTGGTGGCCTTCAGGCTGGACGG + Intergenic
1026821523 7:73552802-73552824 ATGTGGGACATAAGGCTGGAAGG + Intronic
1027238548 7:76312536-76312558 GTCTATGTCTTCAGGCTGGTGGG + Intergenic
1027596926 7:80185428-80185450 GTGAGGGTCTTTAAACTGGATGG - Intronic
1028262578 7:88684153-88684175 GTGTTGGACTTCAGGCTGTGTGG + Intergenic
1028879751 7:95866800-95866822 TTGTGGTTCTTCTGGCTTGAGGG - Intronic
1029017109 7:97326094-97326116 CTGTGGGTTTCCAGGCTTGAGGG + Intergenic
1031292765 7:119958622-119958644 GTGGGGGTCTTCAAGCTGTTTGG + Intergenic
1031522704 7:122785832-122785854 GTGTGGGGCTTGAGGTGGGAGGG - Intronic
1032573669 7:133028994-133029016 GTGTGGGTCTTCTTACTGGTGGG - Intronic
1034423783 7:151002484-151002506 GTGTGGGGTTTCAGGCTCCAGGG - Intronic
1035330414 7:158093224-158093246 GTGTGGGTCTACAGTGTGGGGGG - Intronic
1036209016 8:6827070-6827092 ATGTGGATCTTCAGGTTGTAAGG - Intronic
1037281850 8:17250056-17250078 GTGAGGGTCTTCAGGGCGGAAGG + Intronic
1039119542 8:34130463-34130485 GCGGGGGTCTTCAGACTGGCTGG - Intergenic
1039504758 8:38043901-38043923 GGGTGGCTTTTCTGGCTGGATGG - Intronic
1042069692 8:64917565-64917587 GTGTAGATCTTCAACCTGGAGGG - Intergenic
1042334873 8:67619693-67619715 GTGGAGGTCTTCAGACTGGTTGG - Intronic
1042984323 8:74566404-74566426 CTGTGGGTCTCCAGGCTCGAGGG - Intergenic
1045236621 8:100357765-100357787 GTGTGGGGCGTCAGGGTTGAGGG + Intronic
1045857253 8:106778738-106778760 GGGTGAGTCTTCAGGTAGGAAGG + Intergenic
1046582475 8:116110561-116110583 TTGTGGGTTTCCAGGCTTGAGGG - Intergenic
1047003715 8:120598105-120598127 AAGTGGGACTTCAGGCTGGATGG - Intronic
1047820471 8:128514236-128514258 TTGTTGGTAGTCAGGCTGGAAGG + Intergenic
1048443634 8:134477763-134477785 CTTTGGTTCTTCAGGCGGGATGG - Intergenic
1049018317 8:139937088-139937110 GGGCTGGACTTCAGGCTGGAGGG + Intronic
1049500057 8:142957777-142957799 GTGAGGGCCTTCTGGCTGGTGGG + Intergenic
1049602627 8:143514993-143515015 GTGTGTGTCTGCAGGATGGTGGG - Intronic
1049854131 8:144851016-144851038 GTGTCAGGCTTCAGGCTGGTGGG + Exonic
1053287357 9:36858689-36858711 TTGAGGGTCTCCAAGCTGGAGGG - Intronic
1056077807 9:83059604-83059626 GTGTGGGTGTTGAGGGTGGAGGG - Intronic
1056103492 9:83323596-83323618 GTGAGGGCCTTCATGCTGGTGGG - Intronic
1057171153 9:92963975-92963997 GTGTAGATCTTCAGGGAGGAGGG - Intronic
1058404268 9:104654021-104654043 GAGAGGGTCTTCAGACTGGCTGG + Intergenic
1059250072 9:112880429-112880451 GTGAGGGTCTTCAGGCTGGTTGG - Intronic
1060932226 9:127496333-127496355 GACTGGATCTTCAGACTGGAGGG + Intronic
1062034647 9:134377540-134377562 GTGTGGGTGTGCTGGCTGCAGGG - Intronic
1062193071 9:135257544-135257566 GTGTGAGGCTTCAGTCTGGGAGG + Intergenic
1062209752 9:135357107-135357129 GGCTGGGTCATCAGGCTAGAGGG + Intergenic
1062526645 9:136980529-136980551 ATGTGGGGCTTCAGCCTGGTGGG + Intronic
1062689209 9:137832786-137832808 GTGAGGGGCTTCCGACTGGAGGG - Intronic
1203783120 EBV:112169-112191 GAGTGGGTCTTCAGGCACCAGGG + Intergenic
1185672820 X:1825735-1825757 GTGTTGGTGGTGAGGCTGGATGG - Intergenic
1185673021 X:1826660-1826682 GTGTTGGTGGTGAGGCTGGATGG - Intergenic
1186007518 X:5089668-5089690 GTGTTGGTGTTAATGCTGGAGGG - Intergenic
1187989665 X:24855792-24855814 GTGTGGGACTTCAGTATGCACGG - Intronic
1188062041 X:25612809-25612831 GTATGGCTCTGGAGGCTGGAGGG + Intergenic
1188807064 X:34604692-34604714 CTGTGGGTTTCCAGGCTCGAGGG - Intergenic
1189420369 X:40851796-40851818 GTGGGGGTCTTCAAACTGGTTGG + Intergenic
1189646686 X:43140395-43140417 GTGTGTGTCTTTAGGGTGGAAGG - Intergenic
1191841659 X:65517599-65517621 GTGTGTGCCTTGAGGCTGGCTGG - Intronic
1192113857 X:68392553-68392575 CCGTGGGTCTCCAGGCTTGAGGG - Intronic
1199020084 X:142868740-142868762 CTGTGGGTCTCCAGGCTTGAGGG + Intergenic
1199380605 X:147168205-147168227 CTGTGGGTTTCCAGGCTTGAGGG - Intergenic
1199559904 X:149151292-149151314 TTGTGGGTCTTCAGGTTTGAGGG - Intergenic
1200246833 X:154530974-154530996 GTGTGGCCCTTCTGCCTGGAAGG + Intergenic
1201283496 Y:12360337-12360359 GTGTGTGTCTTCAGGTTGCTGGG - Intergenic
1201286112 Y:12380022-12380044 GTGTGGATGTTCGTGCTGGAGGG - Intergenic