ID: 1162755783

View in Genome Browser
Species Human (GRCh38)
Location 19:12858750-12858772
Sequence CTGCGGGGCTGCAGGGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 627
Summary {0: 1, 1: 1, 2: 6, 3: 67, 4: 552}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162755772_1162755783 19 Left 1162755772 19:12858708-12858730 CCACCTCTGCATGGTCATGGAAT 0: 1
1: 0
2: 3
3: 14
4: 239
Right 1162755783 19:12858750-12858772 CTGCGGGGCTGCAGGGAAGATGG 0: 1
1: 1
2: 6
3: 67
4: 552
1162755773_1162755783 16 Left 1162755773 19:12858711-12858733 CCTCTGCATGGTCATGGAATATG 0: 1
1: 0
2: 1
3: 20
4: 273
Right 1162755783 19:12858750-12858772 CTGCGGGGCTGCAGGGAAGATGG 0: 1
1: 1
2: 6
3: 67
4: 552

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162755783 Original CRISPR CTGCGGGGCTGCAGGGAAGA TGG Intronic
900176833 1:1294817-1294839 CTGCAGGTCCGCAGGGAAGGGGG + Intronic
900365249 1:2309586-2309608 CTGCCGGGGGGCAGGGGAGACGG + Exonic
900416051 1:2535153-2535175 CTGGGGGGCTGGGGGCAAGAGGG + Intergenic
900457426 1:2783989-2784011 CTGGGGGGCTGCCGTGAGGAGGG + Intronic
900485146 1:2919232-2919254 CTGCCCAGCTGCAGGGAAGCCGG - Intergenic
900577188 1:3389242-3389264 CTGCGAGGCGGCAGGGCAGTGGG - Intronic
900619785 1:3581429-3581451 CCAGGGGGCTGCAGGGAAGCCGG + Intronic
900760535 1:4467353-4467375 CAGAGGGGCTGCAGGGGAGAAGG + Intergenic
901002573 1:6155880-6155902 CTGCGGGGCTGCGGGGCTGCAGG - Intronic
901451219 1:9338031-9338053 CAGCTGGGGTGCAGGGAAGAGGG + Intronic
901508386 1:9701005-9701027 CTGCGGAGAAGCAGGGAGGAAGG - Intronic
902070243 1:13728490-13728512 CAGCGGGGCTGTGGGGAAGAAGG + Intronic
902777346 1:18683132-18683154 CTCTGGGGGTGCAGGGGAGATGG - Intronic
902895933 1:19480038-19480060 CTGCAGGGCTGCGTGGAGGAGGG + Intronic
903499971 1:23795334-23795356 CTCCAGGCCTGCAGGGAAGGAGG - Exonic
903575136 1:24335178-24335200 CTGTGGGTCTTCAGGGGAGAGGG - Intronic
903736077 1:25530594-25530616 CTGCGGGGCTGCGGGGCTGCGGG + Intergenic
903762887 1:25711650-25711672 GGGCGGGGCCGCAGGGAGGAGGG - Intronic
903808513 1:26021885-26021907 CTGCTGGGCTGCGGGGAAGAGGG + Exonic
904128647 1:28259960-28259982 GTTCGGGGTTCCAGGGAAGAGGG - Intronic
904311583 1:29632781-29632803 CTGGAGGGCTGAGGGGAAGAGGG - Intergenic
904311586 1:29632789-29632811 CTGGGGGGCTGGAGGGCTGAGGG - Intergenic
904322978 1:29708618-29708640 CTGCTCAGCTGCAGGGGAGAGGG + Intergenic
904376369 1:30084935-30084957 CTGCTCAGCTGCAGAGAAGAGGG - Intergenic
904417552 1:30372556-30372578 CTGGGGGGCTTCAGGGATGAAGG + Intergenic
904983066 1:34522967-34522989 TTGCAGGACTGCAGGGAAGTTGG + Intergenic
905425596 1:37881421-37881443 GTGTGGTGCTCCAGGGAAGAGGG - Intronic
905474914 1:38219284-38219306 CTGTGGGGCTTCAGGGGAGAGGG + Intergenic
905807447 1:40887111-40887133 AAGCAGGTCTGCAGGGAAGAGGG + Intergenic
907083647 1:51648560-51648582 ATGCGGGGCTATAGGGAAGCTGG - Intronic
907463741 1:54621695-54621717 CTGGAGGGCTGGAGGGCAGAGGG + Intronic
908518299 1:64915906-64915928 TTCTGGAGCTGCAGGGAAGAGGG - Intronic
908544302 1:65148553-65148575 GTGAGGGGCTGCGGGGACGAGGG + Intronic
911851502 1:102826906-102826928 CTGCAAGGCTGCAGGGAGGCTGG + Intergenic
912702412 1:111888135-111888157 CTGTGGGGTGGGAGGGAAGAGGG + Intronic
912952928 1:114133038-114133060 CTGAGGGTATGCAGGGAGGAAGG - Intronic
913537021 1:119782914-119782936 CTGCAGGGCTGCAGGGGAAGGGG - Intergenic
915490488 1:156247653-156247675 CTGCTGGGGTGCAGGGACTAGGG - Intronic
915615425 1:157034138-157034160 CTGGGGCTCTGAAGGGAAGAGGG + Intronic
916021603 1:160797248-160797270 CTCCAGGGCTTCAGGGATGATGG + Intronic
916455984 1:164971422-164971444 CAGCAGAGCTGCAGGGCAGAAGG + Intergenic
917172260 1:172190155-172190177 CGGTGGGGGTGCAGGGAAAAGGG - Intronic
917535734 1:175873072-175873094 GTGGGGGGCTGAAGGGAGGAGGG - Intergenic
917621594 1:176801848-176801870 GTGCTGGGGTGCAGGGAGGAGGG - Intronic
918103929 1:181400438-181400460 GGCCGTGGCTGCAGGGAAGAGGG + Intergenic
919765497 1:201124678-201124700 CTGCAGGGCTGGAGGGGAGACGG + Intronic
920049263 1:203153541-203153563 CTGCAGGGCTACAGGGAGGAGGG - Intronic
920773765 1:208915307-208915329 ATGAAGGTCTGCAGGGAAGAAGG + Intergenic
921187581 1:212683546-212683568 CTGCTGGGCTGAAGGAAGGAAGG - Intergenic
921357900 1:214303814-214303836 CTGCTGGGCTGCAGAGGAGGGGG + Intronic
921743334 1:218710710-218710732 CTGGGAGGCGGCAGGGAATAGGG - Intergenic
921866719 1:220094291-220094313 ATCCCGGGCTGCAGGGAAGGCGG - Exonic
922465002 1:225840370-225840392 CTCTGGGGCTGCAGGGGAGAGGG + Intronic
922504144 1:226116728-226116750 CTGAGGTGCTGCAGGGAAAATGG + Intergenic
922618309 1:226976268-226976290 CTGCGGGGCTGCAGGGCTGCGGG + Intronic
922790054 1:228306357-228306379 CTGTGGGGCTGCAGGGGGCAGGG - Exonic
923189591 1:231607727-231607749 CTGCTAGGCTGCAGAGAAAAGGG - Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
924257386 1:242195935-242195957 GTGAGGGGCTGAAGAGAAGAGGG + Intronic
1062833790 10:623448-623470 CTGTGGGGCTGAGGGGAGGAGGG + Intronic
1062890495 10:1056524-1056546 CTGCCGGGCTACGGGGCAGATGG + Intronic
1063477010 10:6337697-6337719 CACCGAGGATGCAGGGAAGAAGG + Intergenic
1065738068 10:28771968-28771990 CTGGGCGGCTGCAGGGCAGAGGG - Intergenic
1066064125 10:31750108-31750130 CGGCTGGGCTTCAGGGGAGAGGG + Intergenic
1067049245 10:43002594-43002616 CTGTGGGCCTGGAGGGCAGATGG + Intergenic
1067098437 10:43317554-43317576 CGGCAGGGCTGCTGGGGAGAGGG - Intergenic
1067802447 10:49368408-49368430 CAGCGGGCCTGCAGGGCAGTGGG - Intronic
1068908986 10:62358301-62358323 CTACGTGGCAGCAGGCAAGAGGG + Intergenic
1069572020 10:69500001-69500023 ATACAGGGCTGCATGGAAGAGGG + Intronic
1069732989 10:70631258-70631280 CTGGGCGGCTGCCGGGCAGAGGG - Intergenic
1070888856 10:79927390-79927412 CTGATGGGCTGCTGGGAAGAGGG + Intergenic
1071237329 10:83664296-83664318 GTGCTGAGCTGCAAGGAAGAAGG - Intergenic
1073053429 10:100684023-100684045 CTGGGGGGCTGCAGGGGGGAGGG + Intergenic
1073176401 10:101560074-101560096 CTGTGGGGCTGCAGGGAAGGGGG - Intergenic
1073439267 10:103543152-103543174 CTGCAGGACTACAGGGAGGAGGG - Intronic
1074164417 10:110862395-110862417 CCGCAGGGCTGCAGGCAACAGGG - Intergenic
1074226272 10:111487622-111487644 GTGGGGGTTTGCAGGGAAGATGG - Intergenic
1075430328 10:122374882-122374904 CTGCGGGGCTGCCGGGCTGCTGG + Intronic
1075934536 10:126328082-126328104 CTAGGGGCCAGCAGGGAAGATGG - Intronic
1076420218 10:130326138-130326160 CTGTGGGGTTGGAGGGAGGAAGG + Intergenic
1076662099 10:132062511-132062533 ATGCGGGGATACAGCGAAGATGG + Intergenic
1077089775 11:773173-773195 CAGCAGGGGTGCAGGGAGGAAGG - Intronic
1077107705 11:849200-849222 CTGCGGGGCTGCCTGGTGGAGGG + Intronic
1077252575 11:1567125-1567147 CTGTGGGGGCACAGGGAAGATGG - Intronic
1077253240 11:1569988-1570010 CTGAGGGGAGGCAGGGATGAGGG - Intronic
1077297710 11:1833915-1833937 CTGGGGGGCTGCAGAGGTGAGGG + Intronic
1077317363 11:1925476-1925498 CTGGGGGGCTGTGGGGAAGGGGG - Intronic
1077326680 11:1967013-1967035 CTGGGGGGCTGCAGGGCCGCCGG + Intronic
1077828325 11:5835063-5835085 CAGTGGGGCTGGAGGAAAGAGGG - Intronic
1078442363 11:11378421-11378443 CTGCAGGGCTGGAGGGCACAGGG - Intronic
1078691276 11:13582842-13582864 TTGCTGGTCTGCAGAGAAGATGG - Intergenic
1079261799 11:18889508-18889530 ATGCAGGGCTCCAGGGATGAGGG - Intergenic
1081574165 11:44309147-44309169 CTGCGGGGCTGCGGGACAGCAGG - Intronic
1081574166 11:44309155-44309177 CTGCGGGGCTGCGGGGCTGCGGG - Intronic
1081574176 11:44309187-44309209 CTGCGGGGCTGCGGGGCTGCGGG - Intronic
1081574179 11:44309195-44309217 CTGCGGGGCTGCGGGGCTGCGGG - Intronic
1081574182 11:44309203-44309225 CTGCGGGGCTGCGGGGCTGCGGG - Intronic
1081631653 11:44693782-44693804 CTGCGTGGCTTAAGTGAAGAAGG + Intergenic
1082784962 11:57311648-57311670 GGGCGGGGCTGCAGGAAAGGAGG - Intronic
1083493551 11:63030919-63030941 CTGGGGGGCTGTGGGGGAGACGG + Intergenic
1083736776 11:64686009-64686031 CTGCGTTGCTGGAGGGGAGAGGG - Intronic
1083770385 11:64863862-64863884 CAGCCGGGCTGCAGGGAGGAGGG + Intronic
1083891486 11:65597982-65598004 CTGGGGTGATGCAGGGAGGAGGG - Exonic
1083945676 11:65921315-65921337 TCGGGGGGCTGCAGGGCAGAAGG - Exonic
1084444882 11:69197749-69197771 CTGGGTGGCCTCAGGGAAGATGG + Intergenic
1084541227 11:69788345-69788367 GGGCGAGGGTGCAGGGAAGACGG + Intergenic
1084968836 11:72758488-72758510 CTGCGGTGGAGCAGGGGAGAGGG - Intronic
1085052981 11:73389221-73389243 CTGGAGGGCTGCAGGGCTGAGGG - Intronic
1085266065 11:75238786-75238808 CTGGGGGGCAGCAGGGGAGGGGG + Intergenic
1085553415 11:77396806-77396828 TTGGAGGGCTGCAGGGAAGCTGG - Intronic
1088315063 11:108498600-108498622 CTATGGGGCTGCGGGGAGGAAGG - Intergenic
1089240495 11:117074331-117074353 TTGTGGGGCTGTAGGGAAGTGGG - Intronic
1089283824 11:117392989-117393011 CTGCTGAGCTGCAGGGGAGATGG - Exonic
1089383440 11:118052368-118052390 CTGGGGCCCTGCAGGGAAGCAGG + Intergenic
1090596544 11:128326977-128326999 CTGAGGGGCAGCCGGGCAGAAGG - Intergenic
1202809661 11_KI270721v1_random:22193-22215 CTGGGGGGCTGCAGGGCCGCCGG + Intergenic
1091405212 12:204504-204526 ATGGGGGGATGCAGGCAAGATGG + Intronic
1092088585 12:5785833-5785855 CTGCTGGCCTGGAGGGTAGATGG - Intronic
1092230511 12:6773253-6773275 TTGTGGGGCTGCAGGGGAGCTGG - Exonic
1092259746 12:6946470-6946492 CTTTGGGGCTGCAGGGAAGCTGG + Intronic
1095476182 12:42589510-42589532 CTGCGGGGCTGCTGGGCTGCGGG + Exonic
1095565113 12:43613839-43613861 GTGGGGGGCTGGAGGGGAGAAGG - Intergenic
1095995968 12:48085046-48085068 CTGCCTGGCTGCAGGGATGGCGG + Intronic
1096716991 12:53497615-53497637 CTGAGGTGATGCTGGGAAGAAGG - Intronic
1097160951 12:57046428-57046450 CTGGGAGGCTCAAGGGAAGAGGG + Intronic
1097745939 12:63302994-63303016 CTCCCAGGCAGCAGGGAAGAAGG + Intergenic
1099254613 12:80300393-80300415 CTGGGTGGCTGCAGAGAAGCAGG + Intronic
1101988545 12:109466231-109466253 CTGAGGGGCTACAGAGAAGCAGG - Intronic
1102516085 12:113447819-113447841 CAGGGTGGCTGCAGGGAAGAGGG + Intergenic
1102541445 12:113622332-113622354 CTGGAGGCCTGCAGGGAAGCTGG + Intergenic
1102646918 12:114409531-114409553 CGCCGGGGCTGCAAGGAAAAGGG + Intergenic
1102961422 12:117095961-117095983 CTGTGGGACTGCAGGCAAGCTGG + Intronic
1102974082 12:117193610-117193632 CTGAGTGGCTGCAAAGAAGATGG - Intergenic
1103170417 12:118813960-118813982 CTGCCGGGCTGGGTGGAAGAGGG - Intergenic
1103270332 12:119668213-119668235 CTGCGGGGACACAGGGAAGGCGG - Exonic
1103764441 12:123271027-123271049 CTGCGGGGCTGCCGGGCTGCCGG - Intronic
1103764443 12:123271035-123271057 CTGCGGGGCTGCGGGGCTGCCGG - Intronic
1103764445 12:123271043-123271065 CTGCGGGGCTGCGGGGCTGCGGG - Intronic
1104076106 12:125391553-125391575 CTGCAGGTCTGCAGGGGAGTAGG - Intronic
1104274965 12:127318308-127318330 CTGTGGGGATGCAGTGAGGATGG - Intergenic
1104602105 12:130161453-130161475 CTGCGGGGCTGCAGCCAAGGAGG + Intergenic
1104637393 12:130446904-130446926 TTGCCTGGCTGCAGGGATGAGGG + Intronic
1104963693 12:132499704-132499726 CTGGGGGGCTGCAGGGCTGGGGG + Intronic
1105847313 13:24304556-24304578 GTGGGGGGCTGCAGGGGAGAAGG - Exonic
1106244282 13:27933949-27933971 CTCCAGGGCTCCAGGGAAAAGGG - Intergenic
1106416703 13:29551818-29551840 CTGCTGGCCAGCAGGGAAGTGGG - Intronic
1106553222 13:30789010-30789032 CTGGGTGGCAGCAGGGATGAGGG + Intergenic
1106587740 13:31072012-31072034 CAGCGGTGCTGGAGAGAAGAGGG - Intergenic
1107058507 13:36131205-36131227 CTGCGGGGCTGCAGGGCTGGGGG + Exonic
1107433045 13:40356700-40356722 CTGCGGGGCGGCAGTGAGGCTGG + Intergenic
1108389695 13:49936189-49936211 CTGCGGTGCTGCAGAGACGGGGG - Exonic
1110260093 13:73475122-73475144 CTCAGGGGCTCCAGGGATGAGGG + Intergenic
1113040740 13:106101495-106101517 CTGAGGGACTGAAGGAAAGAAGG - Intergenic
1114502161 14:23178462-23178484 CTGCAGGGCTGCTGGGAACCTGG - Intronic
1114731773 14:25000590-25000612 TTGGGTGGCTGTAGGGAAGAAGG - Intronic
1116500866 14:45619336-45619358 CTACAAGGCTGCAGGGAAAAGGG - Intergenic
1117547816 14:56807968-56807990 CTGCGGGGCTGCGGGGCTGCCGG - Intronic
1117547818 14:56807976-56807998 CTGCGGGGCTGCGGGGCTGCGGG - Intronic
1117547821 14:56807984-56808006 CTGCGGGGCTGCGGGGCTGCGGG - Intronic
1117547824 14:56807992-56808014 CTGCGGGGCTGCGGGGCTGCGGG - Intronic
1117913843 14:60657255-60657277 CGTCGGGGCTTGAGGGAAGAGGG + Intronic
1118591199 14:67402560-67402582 GTGAGGGGCTGCCGGGGAGATGG - Intronic
1119262553 14:73246050-73246072 CTGCGGGGCGGAGGGGAAGTCGG - Intronic
1119398930 14:74348979-74349001 GTCCGGGGCTCCAGGGACGAGGG - Intronic
1119474336 14:74918526-74918548 CTGAGGGGCTGCAGGGTGGTCGG - Exonic
1119538534 14:75423018-75423040 CTCCAGGGCCACAGGGAAGAGGG + Intergenic
1120766066 14:88327164-88327186 CTTCTGGACTTCAGGGAAGAAGG - Intergenic
1121231956 14:92364894-92364916 TTGCTGGGGTGCAGGGAGGAGGG - Intronic
1121495361 14:94388428-94388450 CTGCTGAGGTGCAGGGCAGATGG - Intronic
1121526855 14:94625219-94625241 CTGAGGGGCTACAGAGAGGAAGG + Intergenic
1121816336 14:96931924-96931946 CTGCGGAAATGCAGGCAAGATGG + Intergenic
1121843247 14:97151902-97151924 AGGCGGGCGTGCAGGGAAGAAGG - Intergenic
1122205239 14:100145069-100145091 CTGGGGGGCGGCAGGGAAGCGGG - Exonic
1122296582 14:100709397-100709419 CGGCGGGGCCCCAGGGAGGAGGG - Intergenic
1122645159 14:103189233-103189255 CCGCGGGGCTGCGGGGTCGAGGG + Intergenic
1122787130 14:104168939-104168961 CTGGGGGTCTGCGGGGAACAAGG + Intronic
1123005904 14:105323737-105323759 CTGCAGTGATCCAGGGAAGATGG + Intronic
1123459677 15:20458410-20458432 CTGCAGGCCTCCAGAGAAGATGG + Intergenic
1123658385 15:22542010-22542032 CTGCAGGCCTCCAGAGAAGATGG - Intergenic
1124265906 15:28234247-28234269 CTGCAGGCCTCCAGAGAAGATGG + Exonic
1124312250 15:28636502-28636524 CTGCAGGCCTCCAGAGAAGATGG - Intergenic
1124712740 15:32029511-32029533 CCCGGGGGCTGCAGGAAAGAAGG + Intergenic
1125717890 15:41830080-41830102 CCTCGGGGATGCAGGGAACAGGG - Intronic
1126284629 15:46996832-46996854 CTGCGGAGCTCCTGGGAGGAGGG - Intergenic
1127355360 15:58193774-58193796 CTGCAAGGCTGCAGGGAGGCTGG + Intronic
1128536114 15:68491851-68491873 CAGGGGGGCTGGAAGGAAGAGGG + Intergenic
1128579535 15:68799248-68799270 CTGAGGGGCTGCTGGAAGGAAGG + Intronic
1128702225 15:69813061-69813083 GGGCGGGGCTGCAGAGAAAAAGG - Intergenic
1129965044 15:79727204-79727226 TGGCGAGGCTGCAGGGAAAAGGG - Intergenic
1130079730 15:80722059-80722081 TAACAGGGCTGCAGGGAAGATGG - Intronic
1130898149 15:88186594-88186616 CTCTGGGGCTGCAGGAAAGCAGG - Intronic
1130979481 15:88803155-88803177 CTCCGGGGCTGGCGGGAGGAAGG - Intergenic
1131446462 15:92502041-92502063 CTGAGGTTCTGCAGGGAGGAGGG - Intergenic
1132109109 15:99089247-99089269 GTGTGAGGCTGGAGGGAAGAGGG - Intergenic
1132137820 15:99360780-99360802 ATGAGTGGCTGCAGGGAATAGGG + Intronic
1132255318 15:100372067-100372089 TTGTGAGGCTGCGGGGAAGAGGG - Intergenic
1132595253 16:746208-746230 CTGCGGGTCTGCAGGGCTGCAGG + Intronic
1132595298 16:746383-746405 CTGCGGGTCTGCAGGGCTGCAGG + Intronic
1132889032 16:2195359-2195381 CTGTGGGGGTGGAGGGAGGAGGG + Intronic
1132978424 16:2721586-2721608 CTGGGGGTCTGGAGGGAAGGAGG + Intergenic
1133012837 16:2924508-2924530 CTGCTGGGCTGCAGGGTACAAGG + Intronic
1133389220 16:5395740-5395762 ATGCGAGTCTGCTGGGAAGATGG - Intergenic
1133881893 16:9790080-9790102 CTACTGTGCTGCAGGGAAGGAGG + Intronic
1134694608 16:16214330-16214352 CTGGGGGTCTTCAGGGAAGAAGG + Exonic
1134977228 16:18580307-18580329 CTGGGGGTCTTCAGGGAAGAAGG - Intergenic
1136054789 16:27680319-27680341 CAGCATGGCTGCAGGGGAGACGG + Intronic
1136115794 16:28093535-28093557 CTGCGGGGCAGCGAGGAGGAAGG + Intergenic
1137731434 16:50693467-50693489 CTGCGGGGCTGCGGGGCTGCGGG + Intergenic
1137731437 16:50693475-50693497 CTGCGGGGCTGCGGGGCTGCGGG + Intergenic
1138089916 16:54165545-54165567 CCGCGGGGCTGAAGGACAGAAGG + Intergenic
1138643612 16:58406538-58406560 CTGGAGGGCTGCTGGGGAGAGGG - Intergenic
1138656840 16:58496275-58496297 CTCCGGGGCTGCAGCTCAGAGGG - Intronic
1138786216 16:59849908-59849930 ATGTGAGGCAGCAGGGAAGAAGG - Intergenic
1139068834 16:63355577-63355599 ATGCCTGGCTGCAGGCAAGAGGG + Intergenic
1139513450 16:67440148-67440170 CTGAGGGGCTGCCTGGAGGATGG - Intronic
1140224467 16:73066864-73066886 CCGCGGGGCTGGGGGGAGGAGGG - Intergenic
1141852029 16:86652990-86653012 CAGAGGGTCTGGAGGGAAGAAGG - Intergenic
1142292986 16:89201234-89201256 CTGCGGGGCAGCAGGGACGGGGG + Intronic
1142376010 16:89707490-89707512 CTGGGGAGCATCAGGGAAGAGGG - Exonic
1142614246 17:1125567-1125589 CTCCGGGGCTGCTGGGAGGCGGG + Intronic
1142638394 17:1271287-1271309 CGGCTGGGCTGCAGGGAGGCCGG + Exonic
1142668698 17:1477472-1477494 CTGCGGGGCTGCTGGGGGCAAGG - Intronic
1143044905 17:4070046-4070068 CTGCTAGGCGGCAGGGAAGCAGG + Intronic
1143303069 17:5925238-5925260 CTGCGGGACTCCAGGCAAGAGGG - Intronic
1143387005 17:6536923-6536945 CTGCTGGGCTGCAGAGGAGTTGG - Intronic
1143393578 17:6575104-6575126 CACTGGGGCTGCAGGGCAGATGG + Intergenic
1144232319 17:13220471-13220493 CTGCTGGGCTTCTGGGAAGAGGG + Intergenic
1144433017 17:15212514-15212536 CTGCAGGGGTGAAGGGGAGATGG + Intergenic
1145242049 17:21245808-21245830 GGGCGGGGCTGCAGGCATGAGGG - Intronic
1145304965 17:21668960-21668982 CTGGGGGTCTGCAGGGAGGTCGG + Intergenic
1146924518 17:36735044-36735066 CTGTTCTGCTGCAGGGAAGATGG - Intergenic
1147444236 17:40465101-40465123 CTGGGTGGCTGCAGGGCTGAAGG + Intergenic
1147484628 17:40800777-40800799 CAGTGGGGATGCAGAGAAGATGG + Intergenic
1148162040 17:45455781-45455803 CTGAGGGACTACAGGGGAGAAGG - Intronic
1148205774 17:45778982-45779004 CTGGGGGGCTGCAGGGGAGGGGG - Intergenic
1149637953 17:58185404-58185426 CTGAGGGTGTGCAGGGAGGAGGG - Intergenic
1150620764 17:66806417-66806439 CTGCAGGGCTGCAGGGACAGGGG - Exonic
1151424843 17:74024358-74024380 CTGCGGGGTGGCAGGGAGAAAGG - Intergenic
1151676771 17:75602764-75602786 CTCCCGGGCTGCAGGGTGGATGG + Intergenic
1151785149 17:76271777-76271799 CTGCAGGGCTGCGGGGAAGGGGG - Intergenic
1152461379 17:80444161-80444183 CCGCGGGGGTGCCGGGAGGAGGG + Intergenic
1152540271 17:80971253-80971275 CTGGGGGGCTGCATGGACGATGG - Intergenic
1152595282 17:81234782-81234804 CTGGGCTCCTGCAGGGAAGATGG - Intronic
1152728818 17:81960220-81960242 CTTCGGGGCTGCAAGGAGGTGGG + Intronic
1152793350 17:82293488-82293510 CTGCGGGGCTGCGGGGAGGGAGG + Intergenic
1152807261 17:82362034-82362056 ATGCTGGGCGGCAGGGATGAAGG - Exonic
1152845531 17:82597389-82597411 CCCCGGGGCTGCAGGGCTGATGG + Intronic
1152942930 17:83181956-83181978 CTGGGGGGGTGCAGGGGGGATGG + Intergenic
1153264155 18:3252299-3252321 CTTCAGAGTTGCAGGGAAGATGG - Intronic
1154190922 18:12230658-12230680 CTCCGGTGCAGCAGGGAGGATGG + Intergenic
1154311025 18:13266281-13266303 ATGCAGGGCTGGAGGGCAGAGGG - Intronic
1157222653 18:45838703-45838725 CGGCGCGGCTGCAGGGGAGAAGG - Exonic
1157429779 18:47615219-47615241 CTATGGGGCTGCAGTGTAGAGGG + Intergenic
1157596120 18:48864895-48864917 CTGCGGAACTGCAGGAATGAGGG - Intergenic
1158434710 18:57427903-57427925 CTCCGGGCTTGCGGGGAAGAAGG - Intergenic
1158519931 18:58163432-58163454 CTGCAGCGCTTCAGGGAACAGGG + Intronic
1159359413 18:67381417-67381439 GTGAGGGGCCGCAGGGAAGCGGG + Intergenic
1160128487 18:76203060-76203082 GAGAGGGGCTGCAGTGAAGAAGG + Intergenic
1160153969 18:76418898-76418920 CAGAGGGTCTGCAGGGCAGATGG + Intronic
1160517517 18:79486727-79486749 CTGCAGGGCTGCAGGCAGGTCGG - Exonic
1160812615 19:1019490-1019512 CTGGGGGGCTGCAGGGAGGAAGG + Intronic
1160824379 19:1072828-1072850 CTGGTGGGCTGCATGGAGGAAGG + Intronic
1160843679 19:1157370-1157392 CTCCGGGGCTGCGTGGCAGAGGG - Intronic
1160844434 19:1160225-1160247 CAGCCGGGCTGCAGGGATGTGGG - Intronic
1160997197 19:1888264-1888286 GGAAGGGGCTGCAGGGAAGATGG - Intergenic
1161076576 19:2288660-2288682 CTGCTGGGCTGTGGGGAGGACGG + Intronic
1161101674 19:2424720-2424742 CTGCAGGGCTGGAGGTCAGAAGG + Intronic
1161112730 19:2479098-2479120 CTTGGGGGCTGCAGGGCAGAGGG - Intergenic
1161395763 19:4044137-4044159 GTGGGCGGCTGCAGGGAAGGTGG - Intergenic
1161979728 19:7624179-7624201 CTGGGGGCCAGCAGGGAAGGAGG - Intronic
1162023292 19:7878815-7878837 CTCCAGGCCTGCAGGGAAGGAGG + Intergenic
1162087157 19:8255743-8255765 CTTCTGGGGTGCAGGGAAGCGGG + Intronic
1162589835 19:11584221-11584243 CTTGGGGGCTGCAGGGAAGGGGG + Intronic
1162740594 19:12771470-12771492 CTGCGGGACTGCAGAGATGAGGG + Exonic
1162755783 19:12858750-12858772 CTGCGGGGCTGCAGGGAAGATGG + Intronic
1163218356 19:15897139-15897161 CTGCGGGGCTCCTGGGCAGAGGG - Intronic
1163641444 19:18464702-18464724 GTGCCGGGCTTCAGGGAGGAGGG - Intronic
1164735875 19:30540523-30540545 CTGAGGTGCTGTAGGGATGAAGG - Intronic
1165044207 19:33091797-33091819 GTGCGAGGCTGCAGGTAAGAGGG + Intronic
1165056197 19:33177621-33177643 CTGCGCGGCTGCAGGGAGACGGG - Intronic
1165192355 19:34075754-34075776 CTGTGAGGCTGGAGGCAAGATGG - Intergenic
1165895577 19:39139118-39139140 CTGGGGTGCTGCAGGAAAGTGGG - Intronic
1166191609 19:41180304-41180326 CTGGGTGGCTGCCGGGCAGAGGG - Intergenic
1166198335 19:41220621-41220643 CTGCGTGCCTGGAGGGGAGATGG - Exonic
1166515686 19:43445072-43445094 CTGCGTGGCTGCAGCGGAGCAGG + Intergenic
1166689671 19:44814818-44814840 CTTCAGGGCTGTAGGGAGGAGGG - Intronic
1167411633 19:49347536-49347558 CTGCAGGGCTGCAGGGGACTGGG - Intronic
1168335254 19:55593516-55593538 GGGCCGGGCTGCAGGGGAGAGGG + Exonic
1168337668 19:55605613-55605635 GTGCGGGGCTGCCGGGGAGGGGG + Intronic
1168481023 19:56719693-56719715 CTGCTGGGATGGAGGAAAGATGG + Intergenic
925451090 2:3969696-3969718 GTGGGGGGCAGCAGGGCAGAGGG - Intergenic
927646978 2:24884063-24884085 GTGAGAGGCTGTAGGGAAGAGGG - Intronic
927672247 2:25078578-25078600 CAGCAGGGCTGGAGGGAAGCTGG - Intronic
927675632 2:25103830-25103852 CTGGGGGGTGGCAGGGGAGAGGG + Intronic
927846385 2:26474492-26474514 AGGTGGGACTGCAGGGAAGAGGG - Exonic
928123220 2:28598886-28598908 CACAGGGGCAGCAGGGAAGAGGG - Intronic
928622809 2:33108221-33108243 CTGGGGGGCTGTGGGGCAGAGGG + Intronic
928983238 2:37156997-37157019 CCGGGCGGCTGCAGGGAAGGCGG - Exonic
929170397 2:38926685-38926707 CTGGGGTTCTGCAGGGAGGAAGG + Intronic
929262766 2:39884019-39884041 CTATGAGGCTGAAGGGAAGATGG + Intergenic
929759944 2:44798463-44798485 ATGCGGGGCTGGAGGAAAGCAGG - Intergenic
932405647 2:71511223-71511245 CTGGGGGGCAGGAAGGAAGAGGG + Intronic
932830150 2:74981443-74981465 CTGTGAGGCTACAGGCAAGATGG + Intergenic
934619341 2:95794411-95794433 ATGCGCGGCTGCAAGGAGGAAGG + Intergenic
934641551 2:96030146-96030168 ATGCGCGGCTGCAAGGAGGAAGG - Intronic
935065588 2:99644644-99644666 CTGCGCGTCTGCAGAGAAGCTGG - Intronic
935595490 2:104874160-104874182 CTGCGGGTCTCCTGGGAGGAAGG + Intergenic
935648671 2:105363464-105363486 GTGATGGGCTGCAGGGACGAGGG + Exonic
935842655 2:107130159-107130181 GCCAGGGGCTGCAGGGAAGAGGG - Intergenic
937241456 2:120465082-120465104 CTGGGGGGCTCCATGGCAGAAGG - Intergenic
937899960 2:127012278-127012300 CTGGGGAGTGGCAGGGAAGAGGG + Intergenic
938103948 2:128517113-128517135 CATCGCGGCAGCAGGGAAGATGG - Intergenic
938115823 2:128602449-128602471 CTTCTGGGCTGCTGGGAACATGG + Intergenic
938540647 2:132281228-132281250 CCGTGGGGCTGCAGGGGAGGGGG + Intergenic
938601999 2:132851711-132851733 CTGTCGGGCTGCAGGAAGGAAGG - Intronic
938864352 2:135402964-135402986 CTGAGGGGGTGCAGCCAAGATGG + Intronic
941718622 2:168789385-168789407 TTACGTGGCTGCAGGCAAGAGGG + Intronic
945193196 2:207211784-207211806 CTGCGAGGCTGCAGAAAAAAGGG + Intergenic
946154986 2:217801377-217801399 CTGGGTGTCTGGAGGGAAGAGGG - Exonic
947856114 2:233325760-233325782 CTGCAGGGCTTCAGGAAAGTGGG + Intronic
948068095 2:235097160-235097182 CTGCTTGGCTGCAGGGCAGAGGG + Intergenic
948181335 2:235983243-235983265 CAGCGCTGCTGCAGGGAACATGG + Intronic
948301168 2:236908613-236908635 CTGTGTGGCTGGAGGGAAGGCGG - Intergenic
948610232 2:239162113-239162135 CAGTGGGGCTGCTGGGAAGCAGG - Intronic
1168904976 20:1395837-1395859 CTGCTAGGCTTCAGGGAAAACGG - Intergenic
1171244506 20:23600738-23600760 CTGAGGAGCTGCAGTGCAGAGGG + Intergenic
1171392255 20:24809161-24809183 CTGCAGGGCTGCAGGGCAATGGG + Intergenic
1171522482 20:25786431-25786453 CTGGGGGCCTGCAGGGAGGTCGG + Intronic
1171554345 20:26069452-26069474 CTGGGGGCCTGCAGGGAGGTCGG - Intergenic
1171869562 20:30514231-30514253 CTGTGGGGCTGCAGGGGAGGGGG + Intergenic
1171978025 20:31607656-31607678 CTGCGGGTCTGGAGTGAAGGTGG + Intergenic
1172215333 20:33231689-33231711 CGGGAGGGCTCCAGGGAAGATGG + Intergenic
1172814083 20:37672552-37672574 GTGGGGGGCTACAGGGCAGAAGG + Intergenic
1172865118 20:38089968-38089990 CTGGGGGGCTGGGCGGAAGAAGG - Exonic
1172946447 20:38693177-38693199 CTGGGGGCCTGCTGGGAGGAGGG - Intergenic
1173817711 20:46000438-46000460 GTGCTGGGATGCAGGGAAGATGG - Intergenic
1174599174 20:51710477-51710499 CTGGGAGATTGCAGGGAAGAGGG - Intronic
1174744286 20:53046133-53046155 CAAGGGGGCTGCAGGCAAGAGGG + Intronic
1175550510 20:59814275-59814297 ACGCGGGGCTGCAGAGAGGACGG + Intronic
1176087489 20:63304608-63304630 CTGCGCAGCTGGAGGGAGGAAGG - Intronic
1176103677 20:63375888-63375910 CTGCTGGGGTGCAGGGATGGTGG - Intronic
1176383086 21:6123081-6123103 GTGCCGGGCCGCAGGGAAGCTGG + Exonic
1178286252 21:31327933-31327955 CTGCGGGACTGCTGGTGAGATGG - Intronic
1178351308 21:31874250-31874272 CTGCCGGCCTGAAGGGCAGAGGG - Intronic
1179101591 21:38359430-38359452 TTGCGGGTCTGCAGGGCAGTCGG + Intergenic
1179427114 21:41290421-41290443 AAGCGGGGCTGCAGGGCAGTGGG - Intergenic
1179437682 21:41373576-41373598 CTGTGGGGCTGAAGGGCAGAGGG - Intronic
1179603908 21:42499648-42499670 GTGCGGCTCTGCAGGGAGGAGGG + Intronic
1179740383 21:43415158-43415180 GTGCCGGGCCGCAGGGAAGCTGG - Exonic
1180713980 22:17859056-17859078 CTGGGGGGCTGAGGGGAGGAAGG + Intronic
1180844727 22:18974861-18974883 CTGCGGGGCAGCAGGGCAGCGGG + Intergenic
1180968787 22:19804114-19804136 CTAGGGGGCTGCAGGGACCAGGG - Intronic
1181043229 22:20202769-20202791 CTGTGGGACTGCAGGGGAGACGG + Intergenic
1181056744 22:20263851-20263873 CTGCGGGGCAGCAGGGCAGCGGG - Intronic
1181151688 22:20888458-20888480 ATGGGGGGCTGGAGGGAAGCGGG - Exonic
1181278697 22:21703444-21703466 CTGCGGCCCTGCAGAGGAGAGGG - Exonic
1181339311 22:22165680-22165702 GTGAGGGGCAGAAGGGAAGAGGG + Intergenic
1181745536 22:24952957-24952979 CTCCGGGTCTGCAGGGAGGGAGG + Intronic
1182483666 22:30626532-30626554 GTGCGAGGCTGCTGGGATGAGGG - Exonic
1183486285 22:38089224-38089246 CTCGGGGGCTGCGGGGGAGATGG + Exonic
1183489141 22:38107525-38107547 CTGGGAGGCTGCAGTGAGGAGGG + Intronic
1184332848 22:43836971-43836993 CTGCGAGGCTGGAGGGCAAAGGG - Intronic
1184341768 22:43890074-43890096 CTGTGGGTGTGCAGGGAAGGAGG + Intronic
1184442126 22:44523316-44523338 ATGAGGGGCTGCGGTGAAGATGG + Intergenic
1184452300 22:44590478-44590500 CTGAGGGGCTGCGGGCAAGGCGG + Intergenic
1184646401 22:45897612-45897634 CTATGGGGCTGTGGGGAAGATGG + Intergenic
1184754353 22:46507863-46507885 CTGGGGGGCTGCATGGAGAAAGG + Intronic
1184786557 22:46674771-46674793 CTGTGTGGCTGCAGGGGAGGGGG + Intronic
1184814090 22:46857371-46857393 CTGCGGGACTACAGCGATGATGG - Intronic
1184986285 22:48137790-48137812 CTGCTGGGCTGCATGGAATTTGG + Intergenic
1185070667 22:48654111-48654133 CCGCGGCTCTGGAGGGAAGAGGG + Intronic
1185222413 22:49635808-49635830 CTGGGGTGCTGCAGGGGTGAGGG + Intronic
1185244343 22:49765292-49765314 CTGGGGGGCTGCAGGGCTGGGGG + Intergenic
1185375698 22:50481822-50481844 GGGCGGGGCTGCAGGGGAGGGGG - Exonic
1185376400 22:50484453-50484475 CTGAGAGGCTGCAGGGTGGAGGG + Exonic
1185377080 22:50487581-50487603 CTGTGGGGCTGCCTGGGAGAGGG + Intronic
1185415285 22:50706057-50706079 CGGTGGGGCTGCAAAGAAGAGGG - Intergenic
950027377 3:9829437-9829459 CTGCAGGGCTGCCTGGAAGAGGG - Intronic
950098390 3:10343255-10343277 CTCGGGGGCTGGAGGGGAGAGGG - Intronic
950439956 3:13004730-13004752 GTGAGGGGCTGCAGGGATGGAGG + Intronic
950507840 3:13406765-13406787 CTGCTGAGGTGCAGAGAAGAAGG - Intronic
952102668 3:30032950-30032972 CTGAGGGGATGGAGGTAAGAGGG + Intergenic
952210597 3:31225796-31225818 CTGTGTGGCAGCAGGGAAGAGGG - Intergenic
952946558 3:38481536-38481558 CTGGGGAGGTGCAGGGATGAGGG + Intronic
953494219 3:43372464-43372486 TTGCGGGGCAGCAGGGGACAAGG - Intronic
954036099 3:47852083-47852105 AGGCGGTGCGGCAGGGAAGAGGG - Exonic
954304197 3:49716948-49716970 CTGCAGGGGGGCAGGGAAGGGGG - Exonic
954389454 3:50260995-50261017 ATGGGGGGCTGCAGGCAGGAAGG + Intergenic
954448380 3:50558752-50558774 TTCAGGGACTGCAGGGAAGAGGG - Exonic
956836803 3:73102411-73102433 TGGGGGTGCTGCAGGGAAGAAGG + Intergenic
958800011 3:98744348-98744370 CTCAGGGGATGCAGAGAAGAGGG - Intronic
959667090 3:108934373-108934395 CGCCGAGGCTGCAGAGAAGAAGG + Intronic
960220869 3:115106798-115106820 CTGGGGGGCAGAGGGGAAGAAGG - Intronic
960382010 3:116974458-116974480 CTGCAGGGCTGCAGACAAGCTGG - Intronic
961044941 3:123701588-123701610 CTGCTGGCCAGCGGGGAAGATGG + Intronic
961168620 3:124780309-124780331 CAGTGGGGCTGCAGGAAGGAAGG + Intronic
961603239 3:128076418-128076440 CTGCGGGCCTGCCGGGAGGGTGG + Intronic
961771673 3:129254653-129254675 TTGTTAGGCTGCAGGGAAGAAGG - Exonic
961811910 3:129526914-129526936 CAGGTGGGCTGCAGGGAAGGGGG + Intergenic
964025253 3:152065652-152065674 TGGCGAGGCTGCAGGGAAGCAGG - Intergenic
964443316 3:156734834-156734856 CGGCTGGGCTGCAGAGAAAAAGG + Intergenic
964622651 3:158732402-158732424 CGGCGGGGCTGCATGGACGCAGG + Exonic
965597055 3:170419959-170419981 CTGCGGGGCTGCGGTGACGCCGG + Intronic
966010345 3:175067599-175067621 CTGCAGGGCTGCAGAGAAAAAGG + Intronic
966775854 3:183542058-183542080 CTGAGGGCCTGCAGGGCAGCCGG - Intronic
967180425 3:186898397-186898419 CTGCTGGGGTGTAAGGAAGATGG - Intergenic
967494982 3:190133079-190133101 CTGTGTGGTTGCAGGGAAAAAGG - Intergenic
967955890 3:194876918-194876940 CTTGGGGGATGCAGGGAAGCTGG + Intergenic
968353206 3:198080253-198080275 CTGCGGGGCTGCGGGGAAGCCGG + Intergenic
968394654 4:223737-223759 CTCTGGGGTTGCAGAGAAGAAGG + Intergenic
968407002 4:349660-349682 CTCTGGGGTTGCAGAGAAGAAGG + Intronic
968419234 4:468689-468711 CTCTGGGGTTGCAGAGAAGAAGG - Intronic
968534043 4:1112873-1112895 GTGGGGGGCTGCAGGGAGGAAGG - Intronic
968612439 4:1563416-1563438 CTCTAGGGCTGCAGGGAGGACGG - Intergenic
968844877 4:3035410-3035432 CGGCTGGGCTGCAGGGGCGAGGG + Exonic
968908339 4:3464516-3464538 CTCCGGGGCTGCAGGGGACCTGG + Intronic
969337356 4:6519489-6519511 CTGTGTGGCTGCAGAGGAGAGGG - Intronic
970360982 4:15308557-15308579 TCCCGAGGCTGCAGGGAAGAGGG + Intergenic
975035681 4:69677320-69677342 GTGAGGGGCTGGAGGGAGGAAGG + Intergenic
975359515 4:73451554-73451576 CTGGGAGGCTGCAGGGATGCAGG + Intronic
975810890 4:78168434-78168456 CAGGGGTGCTGCAGGGAAGTGGG - Intronic
977615426 4:99083097-99083119 CTGCAGTTTTGCAGGGAAGATGG + Intronic
978349000 4:107801671-107801693 CTGAGTGGCTGCATGGAAGAGGG - Intergenic
978777682 4:112519349-112519371 CTGCGGGGGTGGGGGGAAGAGGG + Intergenic
978802277 4:112766650-112766672 CTGCTGGGCTTGAGGGTAGAGGG - Intergenic
979101899 4:116627697-116627719 TAGCGAGGCTGCAGGGAAAAGGG - Intergenic
979346915 4:119598836-119598858 CTGGGGGGTTGGAAGGAAGATGG + Intronic
979856426 4:125638921-125638943 CTGCTGAGCTGCAGGCAACAAGG + Intergenic
981067219 4:140498062-140498084 CTTCGGGGCTGCAGGAATGCAGG - Intronic
982088417 4:151859807-151859829 CTGCGGTGCTGCAGGACAGTCGG - Intergenic
982360297 4:154512232-154512254 CTGGAGGGCTGGAGGGAGGATGG + Intergenic
982994353 4:162322255-162322277 CTGCGAGGTGGAAGGGAAGATGG - Intergenic
983060076 4:163149871-163149893 TTGGGGGACTGCAGAGAAGAGGG + Intronic
983319694 4:166180289-166180311 TTGCGGGGCAGCGGGGGAGATGG - Intergenic
984615918 4:181897112-181897134 CTGGCAGGCTGAAGGGAAGAAGG - Intergenic
984699074 4:182807091-182807113 CTGGGGAGCTGCGGGGAAGCGGG - Intergenic
984874733 4:184357020-184357042 CTGTGGGGATGCAGCAAAGATGG + Intergenic
984981615 4:185287433-185287455 CAGTGGGGCTGCAGGGGAGAGGG + Intronic
985637011 5:1040829-1040851 GTGCTGTGCTGCAGGCAAGATGG + Intergenic
985657961 5:1141991-1142013 CTGCAGGGCTGCAGGGAAGAGGG - Intergenic
986066491 5:4239740-4239762 CTGCTGTGTTGCAGGGATGAGGG - Intergenic
986522881 5:8640755-8640777 TTGCGAGGCTGCAGAGAAAAAGG + Intergenic
987097435 5:14562183-14562205 CTGGGGGGATGGAGGGGAGATGG + Intergenic
991499495 5:67262956-67262978 CTCTGGGGCTGAAGGTAAGAAGG + Intergenic
992218347 5:74547395-74547417 CAGGGAGGCTGCATGGAAGAGGG + Intergenic
992397063 5:76378120-76378142 CTGCGTGGTGGCAGGGAAGAGGG + Intergenic
992942779 5:81779279-81779301 CTGCGGAGCTGCAGGTCAGGAGG - Intergenic
993971341 5:94423178-94423200 CTGGGGGGTTGGAGGGATGAAGG + Intronic
995514536 5:112940904-112940926 CTGCAGGGCTGCAAGAAAAAGGG + Intergenic
995599850 5:113783425-113783447 TTGAGGGGCTTCAGGAAAGATGG + Intergenic
996566218 5:124881891-124881913 TTGTGTGGCTGCAGGAAAGAGGG - Intergenic
997201301 5:132011597-132011619 CTGCGGGGCTGCGGGGCTGCGGG - Exonic
997360249 5:133290476-133290498 CTGCTGGCCTGCTGGGAAGCAGG - Intronic
999246134 5:150155722-150155744 CTGCTGGGCAGCAGGGCTGAGGG + Exonic
999450883 5:151677298-151677320 CTTTGTGGCTGCAGGGGAGATGG - Intronic
999697358 5:154198851-154198873 GGGCAAGGCTGCAGGGAAGAAGG - Intronic
999905371 5:156135428-156135450 CTGTAAGGCTACAGGGAAGAGGG - Intronic
1000026197 5:157361323-157361345 CTCTGGGCCTGCAGGTAAGAGGG + Intronic
1000233503 5:159336520-159336542 CTGTGGGGCTGCAGGGGTCATGG + Intergenic
1000639765 5:163687816-163687838 CTGCCAGGCTGCGGGAAAGATGG + Intergenic
1001247160 5:170113368-170113390 CTTCGGGGCTGAAGGAAAGCAGG - Intergenic
1001647678 5:173294497-173294519 CCTCGGGGCTGCAGGGCAGATGG + Intergenic
1001948226 5:175797488-175797510 GTGGGGGTCTGGAGGGAAGACGG - Intronic
1002535845 5:179874926-179874948 CTGCTGGGCTGCAGCGACGAGGG - Exonic
1002563904 5:180099624-180099646 CTCTGGGGCAGCAGGGAAGGAGG - Intergenic
1003282432 6:4705689-4705711 GTGCAGGGGTGCAGGGAGGATGG - Intergenic
1004267643 6:14163065-14163087 CTGGGAGGCTGCAGAGCAGAAGG - Intergenic
1005907559 6:30277748-30277770 GTGGGGGGCTGAAGGGAAGGTGG - Intergenic
1006093035 6:31639423-31639445 CTGAAGGGATCCAGGGAAGAGGG + Intronic
1006327393 6:33364920-33364942 CTCCAGGCCTGCAGGGAAGGAGG + Intergenic
1006639979 6:35484858-35484880 ATGAGGGGCTGCAGGGTAGGAGG + Intronic
1006735556 6:36270343-36270365 CTCCGGGGTGGCAGGGAAGCTGG + Intronic
1006785938 6:36667339-36667361 TTTCAGGGCTGCAGGGAAGTGGG + Intergenic
1007574488 6:42916208-42916230 CTGATGGGCTGCAGGGAGGCAGG + Intronic
1007658489 6:43467533-43467555 CTACATGGCGGCAGGGAAGAGGG - Intergenic
1007809859 6:44478064-44478086 GTGCCAGGCTGGAGGGAAGAGGG + Intergenic
1007842842 6:44730799-44730821 CAGGGGGGCTGGAGGGAAGTAGG - Intergenic
1009032191 6:58073303-58073325 CTGCGGGGGAGTACGGAAGATGG - Intergenic
1012238843 6:96849530-96849552 TAGTGAGGCTGCAGGGAAGAGGG + Intergenic
1013619255 6:111872814-111872836 CCGCGGGGCTGCCGGGGAGTCGG - Intronic
1013888651 6:115000386-115000408 CTTCCGGGCTGCAGTTAAGACGG - Intergenic
1013954995 6:115831498-115831520 CTGTGGGCCTGCAGGGCTGATGG - Intergenic
1016125528 6:140397838-140397860 CTGCAGGGCTGCAGCAAACATGG + Intergenic
1016939443 6:149472298-149472320 CTACTGGGATCCAGGGAAGAGGG + Intronic
1017255495 6:152328851-152328873 CTGCTGTGCTACAGGGAAGCAGG + Intronic
1018071581 6:160168549-160168571 CTACTGGGCTGCAGGCAGGAGGG - Intergenic
1018395912 6:163377921-163377943 CTGCGCTGCTCCAGGGAAGGAGG - Intergenic
1018740298 6:166723283-166723305 CTGAGGTGCCGCAGTGAAGAAGG + Intronic
1018829020 6:167428049-167428071 CTGCAGGGCTGCAGGTCAGCAGG - Intergenic
1019092092 6:169546354-169546376 CTGCTGGGCTGCAGGGACCTGGG + Intronic
1019360984 7:604104-604126 ATGGGGGGCTGCAGGGAATGGGG - Intronic
1019735863 7:2649489-2649511 CTGCTGGGCTGCAGGCCAGAAGG - Intronic
1019900989 7:4020498-4020520 CTGGGGAGGTGAAGGGAAGACGG + Intronic
1019935984 7:4258309-4258331 CTGCCAGGCTGTAGGGAAGCAGG - Intronic
1020009306 7:4799709-4799731 CTGCGGGGCTGCCCGGGAGCAGG + Exonic
1020283541 7:6663779-6663801 GTGGGGGGGTGAAGGGAAGAGGG + Intergenic
1020534671 7:9381887-9381909 TGGCGAGGCTGCAGGGAAAATGG - Intergenic
1021948518 7:25752223-25752245 CTGCAGGGCTGGGGGGAAGTAGG + Intergenic
1022181354 7:27923641-27923663 CTGGGGGGCTGCAGGGGGAATGG - Intronic
1022941854 7:35249369-35249391 CTGCAGGGCTGCAGGGAGGTTGG - Intronic
1023202122 7:37709952-37709974 CTGCGGGCGTGCAGGGAACCCGG - Intronic
1023784555 7:43693148-43693170 CTCCAGGCCTGCTGGGAAGAGGG - Intronic
1024254292 7:47528288-47528310 CTGGGGGTCTGCAGGGAAGGAGG + Intronic
1024292110 7:47812260-47812282 CTGGGCTGCTGCAGGGAAGAGGG - Intronic
1024454475 7:49587691-49587713 CTGCGGGGATGCGGGGATGCGGG + Intergenic
1024511934 7:50211636-50211658 CTGCAGTGCAGCAGGAAAGAGGG + Intergenic
1024633479 7:51268069-51268091 CTGCAGGGCAGGAGGGAGGAAGG - Intronic
1026111595 7:67462851-67462873 CTCCAGGGCAGCAGGGAAGCCGG + Intergenic
1026219237 7:68378090-68378112 CTGAGTGGCTGCAGAGAAGGTGG - Intergenic
1026953393 7:74362131-74362153 TTGGAGGGCTGCAGGGGAGATGG - Intronic
1027269951 7:76513668-76513690 CTGCTGGGCTCCAGGGAGCAGGG + Intronic
1028365713 7:90028293-90028315 GTGGGGGGCTGCAGGGGAGGTGG + Intergenic
1029146124 7:98447381-98447403 GTGGGAGGATGCAGGGAAGAGGG + Intergenic
1029570198 7:101363614-101363636 CTGCGGGGCTGCGGGGTTGCGGG + Intronic
1029574664 7:101395558-101395580 CAGCGGGGCTGGAGGGAAAATGG + Intronic
1029813139 7:103069140-103069162 CAGTGGGGCGGCAGGGCAGAGGG - Intronic
1030466103 7:109905839-109905861 CTGCAGGGCGGCAGGGAGGCTGG + Intergenic
1031121425 7:117726792-117726814 CTGTGGGGCTTCAGGGATAAAGG + Intronic
1031484449 7:122310754-122310776 CTGCGGGAATGCAGAGGAGAAGG - Intergenic
1032081808 7:128862889-128862911 CTGCCCGGCTGCAGGGATGGCGG + Exonic
1032100508 7:128972687-128972709 GTGGGGGGTTTCAGGGAAGAAGG + Intronic
1032331325 7:130983216-130983238 CTGAGGGGCTGAAGGGGAGCTGG + Intergenic
1033174783 7:139113964-139113986 CTGAGGCTCTGCAGGGAGGAAGG + Intergenic
1033339219 7:140479083-140479105 CTGCGGCGCGGGAGGGAGGAGGG - Intronic
1033480581 7:141736341-141736363 GTGGGGGGCTGGAGGGAAGGTGG - Intergenic
1033511595 7:142065214-142065236 CTGCGTGACTGGAGGGAACATGG - Intronic
1033569920 7:142617616-142617638 CAGCAAGGCTGCAGAGAAGATGG + Intergenic
1033797699 7:144867263-144867285 TGGCGAGGCTGCAGAGAAGAGGG - Intergenic
1034349148 7:150405273-150405295 CTGCGGCGCTGCAGCGGAGACGG + Intronic
1034459613 7:151191280-151191302 CTGCAGGTGTGGAGGGAAGAGGG - Intronic
1034536673 7:151729705-151729727 CTGCGGGGCTGGACGGCAGCAGG - Intronic
1034885289 7:154794213-154794235 CTGTGGGGGTGGAGGGGAGACGG + Intronic
1034996028 7:155577791-155577813 CTCCCGGGCTGCAGTGAGGATGG + Intergenic
1034996040 7:155577843-155577865 CTCCCGGGCTGCAGTGAGGACGG + Intergenic
1034996052 7:155577894-155577916 CTCCCGGGCTGCAGTGAGGACGG + Intergenic
1034996064 7:155577945-155577967 CTCCCGGGCTGCAGTGAGGACGG + Intergenic
1035018993 7:155789242-155789264 CTGCGCGGCTGCATGAAACAGGG - Intergenic
1035062645 7:156080313-156080335 TTGTGGGGCTGCTGGGAAGCTGG - Intergenic
1035121313 7:156570244-156570266 GTGGGTGGCTGCAGGGAAGGTGG - Intergenic
1035286511 7:157810474-157810496 CAGCGGGGCTGCTGGGCACAGGG + Intronic
1035689465 8:1550300-1550322 GCGCGGGGCTGCAGGGATGGCGG + Intronic
1036696839 8:10980265-10980287 TTGCGGGGCTGCAGGGGAAGGGG + Intronic
1037414414 8:18633897-18633919 CAGTGGGGCTGCAGAGAAAAGGG - Intronic
1037636117 8:20702166-20702188 CTGATGGGGTGCAGGGAATATGG + Intergenic
1037645567 8:20789793-20789815 CTGCGGGGATTCAGGAAGGAGGG - Intergenic
1038134775 8:24773440-24773462 CTGACAGGCTGCAGGGAACAGGG + Intergenic
1038329306 8:26595591-26595613 CTGCAAGGCAGCGGGGAAGAGGG - Intronic
1038427038 8:27470321-27470343 TGGCGGGGCTGCAGGGAGAAGGG + Intronic
1039086007 8:33780576-33780598 CTGCAAGGCTGCAGAGAAAAGGG - Intergenic
1039961903 8:42254832-42254854 CTGTGGGGCGGCCGGGCAGAGGG - Intergenic
1040077161 8:43247460-43247482 CTGCGGGGCTGCGGGGCTGCGGG - Intergenic
1040077164 8:43247468-43247490 CTGCGGGGCTGCGGGGCTGCGGG - Intergenic
1040546763 8:48404053-48404075 CTACGGGCCTGGAGGGCAGAGGG - Intergenic
1040981790 8:53251813-53251835 CTGCGGGGCTGGAGGGGACGCGG - Intergenic
1044722814 8:95167445-95167467 ATGCGGCTCTGCAGGGAAGGGGG - Intergenic
1045432214 8:102124394-102124416 CTGCGGGGCTGCAGTGGAGAGGG - Intronic
1048440903 8:134458380-134458402 CTGGGAGGCTGGAGGGAGGAGGG + Intergenic
1049392215 8:142377736-142377758 CTCTGGGGGTGCAGTGAAGAGGG - Intronic
1049469101 8:142767447-142767469 GTGGGGGGTAGCAGGGAAGATGG + Intronic
1049541524 8:143211280-143211302 AAGCGGGGCACCAGGGAAGAGGG + Intergenic
1049594213 8:143475996-143476018 CCCTGGGGCTGCAGGGCAGAGGG + Intronic
1049639817 8:143710423-143710445 CTGCAGGGATGCAGGGATGCAGG - Intronic
1049708603 8:144053856-144053878 CTGAGCAGCTGCAGGGAAGGGGG - Intronic
1049798964 8:144509051-144509073 CTGCGCGGCCGCAGGGAAGGGGG - Intergenic
1050099186 9:2100086-2100108 CTGCAGGGATCCAGGGAGGAGGG + Intronic
1050388139 9:5111644-5111666 CTGCTGGGCGGGAGGGACGAGGG - Intronic
1052009204 9:23385952-23385974 CTGGGGGACTACAGGGAAGGTGG + Intergenic
1052971697 9:34380794-34380816 CTGGGGGCCTGCACGGAAGCTGG + Intronic
1053503194 9:38620015-38620037 CTGCCGGGCTGCAGGGAAGCCGG + Intergenic
1056757388 9:89390362-89390384 CTGCGGGGCTGCGGGGCAGCTGG + Intronic
1057152942 9:92809911-92809933 CCCAGGGGCTGCAGGGAAGCCGG - Intergenic
1057845770 9:98521309-98521331 GTGCGGTGCTGCAGGGAGGGTGG + Intronic
1058785034 9:108378635-108378657 CTGCTTGGCTCTAGGGAAGAAGG + Intergenic
1060969921 9:127732091-127732113 CTGCTCGTCTTCAGGGAAGAAGG + Exonic
1061189805 9:129075819-129075841 CTGCATGGCAGCAGGCAAGAGGG + Intergenic
1061284332 9:129613590-129613612 CTGTTGGACTGCAGGAAAGAGGG + Exonic
1061366238 9:130173518-130173540 CGGAGAGGCTGCAGGGAAGGGGG - Intronic
1061369817 9:130191948-130191970 ATGGGGGGCTGGAGGGCAGAAGG + Intronic
1061532898 9:131228774-131228796 CTGGGGGGCTGCAGGGGAGCAGG - Intronic
1061636332 9:131911946-131911968 CTGTGGGGCAGCAGGGAAGTTGG - Intronic
1061666457 9:132163200-132163222 CTGCGGGGCTGCCGGGTCGTCGG + Intronic
1061897502 9:133656055-133656077 GTGCGGGGCTGCAGTGGAAAGGG + Intronic
1062035262 9:134380061-134380083 CAGAGGGGCTGCAGGGGAGAGGG - Intronic
1062483342 9:136762535-136762557 CTTCCGGGCTGCAGGGAAAGAGG - Intronic
1062567758 9:137170829-137170851 GTGAGGGCCTGCAGGGAGGACGG + Intronic
1062569952 9:137180413-137180435 CTGCGGGGCGGCCGGGCAGCGGG + Intronic
1186880025 X:13855839-13855861 CTGCGGTGGTGCAGTGAACATGG + Intronic
1187098638 X:16170350-16170372 CTTAGGGGCAGCAGGCAAGAGGG - Exonic
1187344360 X:18449491-18449513 CTGGGGGGCGGCAGGGGGGAAGG - Intronic
1187940308 X:24374689-24374711 CTCTGAAGCTGCAGGGAAGAGGG + Intergenic
1189179107 X:38986767-38986789 CAGAGGGGCTGCAGGGAGGAGGG - Intergenic
1189189530 X:39088500-39088522 ATGGGGGGCGGCAGGCAAGATGG + Intergenic
1189294847 X:39910849-39910871 GTGCAGAGCTGCAGGGAACAGGG + Intergenic
1190396861 X:49993851-49993873 CTGTGGGGCAGCTGGGAAGCAGG + Intronic
1191855269 X:65620302-65620324 CTGCGGGGCGGCAGCGAGGCTGG - Intronic
1191911925 X:66160680-66160702 GTGGAGGGGTGCAGGGAAGAGGG - Intergenic
1192156943 X:68753692-68753714 CTGGGGGCCTGCAAGGAGGAGGG + Intergenic
1192656909 X:73002739-73002761 CTGCGGGGCTGCCGGGCTGCGGG - Intergenic
1192656912 X:73002747-73002769 CTGCGGGGCTGCGGGGCTGCCGG - Intergenic
1192656914 X:73002755-73002777 CTGCGGGGCTGCGGGGCTGCGGG - Intergenic
1192656917 X:73002763-73002785 CTGCGGGGCTGCGGGGCTGCGGG - Intergenic
1192656920 X:73002771-73002793 CTGCGGGGCTGCGGGGCTGCGGG - Intergenic
1192656923 X:73002779-73002801 CTGCGGGGCTGCGGGGCTGCGGG - Intergenic
1192656926 X:73002787-73002809 CTGCGGGGCTGCGGGGCTGCGGG - Intergenic
1192656929 X:73002795-73002817 CTGCGGGGCTGCGGGGCTGCGGG - Intergenic
1192656932 X:73002803-73002825 CTGCGGGGCTGCGGGGCTGCGGG - Intergenic
1192656935 X:73002811-73002833 CTGCGGGGCTGCGGGGCTGCGGG - Intergenic
1192665185 X:73080190-73080212 CTGCGGGGCTGCGGGGCTGCGGG + Intergenic
1192665188 X:73080198-73080220 CTGCGGGGCTGCGGGGCTGCGGG + Intergenic
1192665191 X:73080206-73080228 CTGCGGGGCTGCGGGGCTGCGGG + Intergenic
1192665194 X:73080214-73080236 CTGCGGGGCTGCGGGGCTGCGGG + Intergenic
1192665197 X:73080222-73080244 CTGCGGGGCTGCGGGGCTGCGGG + Intergenic
1192665200 X:73080230-73080252 CTGCGGGGCTGCGGGGCTGCGGG + Intergenic
1192665203 X:73080238-73080260 CTGCGGGGCTGCGGGGCTGCGGG + Intergenic
1192665206 X:73080246-73080268 CTGCGGGGCTGCGGGGCTGCGGG + Intergenic
1192665208 X:73080254-73080276 CTGCGGGGCTGCGGGGCTGCCGG + Intergenic
1192665211 X:73080262-73080284 CTGCGGGGCTGCCGGGCTGCGGG + Intergenic
1195483115 X:105370874-105370896 TTGCAAGGCTGCAGTGAAGAGGG - Intronic
1195791134 X:108587753-108587775 CTGCAAGGATGCAGAGAAGAGGG - Intronic
1196768111 X:119268074-119268096 CTGGGGGGTAGCAGCGAAGATGG - Intergenic
1198627355 X:138591875-138591897 CTACTGTGCAGCAGGGAAGAGGG + Intergenic
1199117342 X:144008361-144008383 CTGCAGGGCTGCAGGGCTGCAGG + Intergenic
1200049850 X:153422975-153422997 CTGCAGGGCTAAGGGGAAGAGGG - Intergenic
1200118184 X:153778340-153778362 CATCGGGGCTGCGGGGAAGGGGG + Intronic
1200284268 X:154805438-154805460 CTGCGGGGCTGCGGAGAAGGCGG + Exonic
1200764348 Y:7067849-7067871 CTGAGGGGCTGCTGATAAGAAGG - Intronic
1200795268 Y:7335256-7335278 CTGGGGAGGTGCAGGGAAGGGGG + Intergenic