ID: 1162757159

View in Genome Browser
Species Human (GRCh38)
Location 19:12867312-12867334
Sequence AACCTACAATTCTTCAGTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 139}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162757159_1162757171 21 Left 1162757159 19:12867312-12867334 CCTGAACTGAAGAATTGTAGGTT 0: 1
1: 0
2: 0
3: 3
4: 139
Right 1162757171 19:12867356-12867378 CGGAGCCAGGCCTCGGAGGGTGG 0: 1
1: 0
2: 3
3: 22
4: 273
1162757159_1162757164 -3 Left 1162757159 19:12867312-12867334 CCTGAACTGAAGAATTGTAGGTT 0: 1
1: 0
2: 0
3: 3
4: 139
Right 1162757164 19:12867332-12867354 GTTGGGGGATCATGCACAATTGG 0: 1
1: 0
2: 0
3: 7
4: 66
1162757159_1162757165 -2 Left 1162757159 19:12867312-12867334 CCTGAACTGAAGAATTGTAGGTT 0: 1
1: 0
2: 0
3: 3
4: 139
Right 1162757165 19:12867333-12867355 TTGGGGGATCATGCACAATTGGG 0: 1
1: 0
2: 0
3: 2
4: 88
1162757159_1162757170 18 Left 1162757159 19:12867312-12867334 CCTGAACTGAAGAATTGTAGGTT 0: 1
1: 0
2: 0
3: 3
4: 139
Right 1162757170 19:12867353-12867375 GGGCGGAGCCAGGCCTCGGAGGG 0: 1
1: 0
2: 3
3: 24
4: 276
1162757159_1162757167 8 Left 1162757159 19:12867312-12867334 CCTGAACTGAAGAATTGTAGGTT 0: 1
1: 0
2: 0
3: 3
4: 139
Right 1162757167 19:12867343-12867365 ATGCACAATTGGGCGGAGCCAGG 0: 1
1: 0
2: 1
3: 3
4: 68
1162757159_1162757168 14 Left 1162757159 19:12867312-12867334 CCTGAACTGAAGAATTGTAGGTT 0: 1
1: 0
2: 0
3: 3
4: 139
Right 1162757168 19:12867349-12867371 AATTGGGCGGAGCCAGGCCTCGG 0: 1
1: 0
2: 1
3: 12
4: 149
1162757159_1162757166 1 Left 1162757159 19:12867312-12867334 CCTGAACTGAAGAATTGTAGGTT 0: 1
1: 0
2: 0
3: 3
4: 139
Right 1162757166 19:12867336-12867358 GGGGATCATGCACAATTGGGCGG 0: 1
1: 0
2: 0
3: 2
4: 64
1162757159_1162757169 17 Left 1162757159 19:12867312-12867334 CCTGAACTGAAGAATTGTAGGTT 0: 1
1: 0
2: 0
3: 3
4: 139
Right 1162757169 19:12867352-12867374 TGGGCGGAGCCAGGCCTCGGAGG 0: 1
1: 0
2: 2
3: 18
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162757159 Original CRISPR AACCTACAATTCTTCAGTTC AGG (reversed) Intronic