ID: 1162757171

View in Genome Browser
Species Human (GRCh38)
Location 19:12867356-12867378
Sequence CGGAGCCAGGCCTCGGAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 299
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 273}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162757159_1162757171 21 Left 1162757159 19:12867312-12867334 CCTGAACTGAAGAATTGTAGGTT 0: 1
1: 0
2: 0
3: 3
4: 139
Right 1162757171 19:12867356-12867378 CGGAGCCAGGCCTCGGAGGGTGG 0: 1
1: 0
2: 3
3: 22
4: 273

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162757171 Original CRISPR CGGAGCCAGGCCTCGGAGGG TGG Intronic
900384463 1:2403445-2403467 AGGAGCAAGGCCTGCGAGGGAGG + Exonic
901018005 1:6242617-6242639 CCGACCCGGGCCTGGGAGGGCGG - Intergenic
901379320 1:8862507-8862529 TGGAGCCAGGGCTGGGAGGGAGG - Intronic
901529272 1:9843312-9843334 CCGAGCTGGGCCTGGGAGGGTGG + Intergenic
902600897 1:17539720-17539742 CGGGACCAGGCCTCGGAGCGCGG + Intergenic
902621605 1:17654115-17654137 AGGAGACAGGCCTCAGAGAGAGG + Intronic
902688084 1:18091871-18091893 CAGAGCCAAGTCTTGGAGGGAGG - Intergenic
904130801 1:28273871-28273893 TGGAGCCAGGCCTTGGGGAGGGG - Intronic
905223066 1:36462214-36462236 AAGAGCCAGGTCTGGGAGGGTGG - Intronic
905951401 1:41954512-41954534 TGGAGCCAGACCCCGCAGGGTGG - Intronic
906706040 1:47895848-47895870 AGGAGGCAGGCCTGGGAGTGGGG - Intronic
907477733 1:54716908-54716930 CTGAGCCTGACCTTGGAGGGTGG - Intronic
907526153 1:55055299-55055321 CTGAGCCAGGCCTCAGAGAGTGG + Intronic
913987119 1:143575289-143575311 CGGAGCCCTGCCCCGCAGGGAGG - Intergenic
915463559 1:156082957-156082979 CGGAGCCCGGCCGCGGGGAGAGG + Intronic
916961388 1:169893484-169893506 CGGAGTCGGTCCTCGCAGGGAGG - Intronic
918104238 1:181402656-181402678 AGGAGCCAGGCCTGGGGGAGGGG + Intergenic
920455646 1:206099140-206099162 AGGAGTGAGGCCTCGGAGGCTGG + Intronic
920692951 1:208160435-208160457 CTGACCCAGGCATGGGAGGGAGG + Intronic
921080856 1:211737486-211737508 AGGAGCCAGGCCCCTGGGGGTGG - Intergenic
922731836 1:227952589-227952611 ATGAGCCTGGCCTCGGGGGGTGG - Intergenic
1063963872 10:11329500-11329522 CGGCGCCCGCCCCCGGAGGGAGG + Intronic
1066080791 10:31928800-31928822 CGCAGGCTGGCCTCTGAGGGAGG + Exonic
1069025615 10:63537728-63537750 CTGAGCCAGGCCACAGATGGAGG + Intronic
1072190366 10:93072941-93072963 TGGAGCCGGGCCTCGGAGCCAGG + Intergenic
1072309395 10:94139736-94139758 GGGAGCCAGGGCTGGGTGGGAGG + Intronic
1073136658 10:101224137-101224159 CTGCGCCAGGCCGCGCAGGGGGG - Intergenic
1074114921 10:110448761-110448783 GGGAGCCAGGCCACTGAGGTTGG + Intergenic
1075447302 10:122522037-122522059 CGGAGCCAGGCATCTGAGATGGG - Intergenic
1075686360 10:124367680-124367702 CGGATCCAGGCATTGGAGCGGGG - Intergenic
1076196277 10:128520550-128520572 CTCAGCCAGGCCTCAGAGGCAGG - Intergenic
1076605793 10:131689187-131689209 GGCAGGCAGGCCTCGGAGGTGGG - Intergenic
1077058245 11:606301-606323 CGGAGCCAGGGCTGTGGGGGAGG + Intronic
1077066689 11:644187-644209 CAGTGCCAGCCCTCGGGGGGGGG - Intergenic
1077844824 11:6013146-6013168 TGCAGCCATGCCTGGGAGGGTGG + Intergenic
1078390347 11:10931342-10931364 CGGAGGCCGCCCTAGGAGGGAGG + Intergenic
1081782741 11:45724406-45724428 TGGAGGCAGGCATGGGAGGGAGG - Intergenic
1083594045 11:63910698-63910720 CTGAGCCTGGCCTGGGAGCGGGG - Exonic
1083658446 11:64241387-64241409 CGGAGCCCGGCGGCGGGGGGCGG + Intronic
1084431864 11:69115753-69115775 CGGTGCCAGGACAGGGAGGGCGG + Intergenic
1084649214 11:70478847-70478869 CAGAGCCAGACCTGGGAGTGGGG + Intronic
1084740941 11:71139219-71139241 CGGTGCCAGGCCTCAGGGAGAGG + Intronic
1085188082 11:74592969-74592991 CGGAGACCGGGCGCGGAGGGAGG + Intronic
1085319358 11:75564623-75564645 AGGAGCCAGAGCTGGGAGGGAGG + Intronic
1087401034 11:97667312-97667334 CCGAGCCCTGCCTCGCAGGGAGG - Intergenic
1090077975 11:123591355-123591377 GGGAGCCAGGCGTCGTTGGGAGG + Intronic
1090387125 11:126363868-126363890 CGGTGCCGGGCCTGGGAGGGTGG - Intronic
1091299393 11:134497883-134497905 AAGAGCCAGGCCTTGGAGGCTGG + Intergenic
1091680716 12:2524745-2524767 AGCAGCCAGGCCTGGGAGTGTGG + Intronic
1092178274 12:6426187-6426209 CAGATGCTGGCCTCGGAGGGCGG - Intergenic
1095177709 12:39112130-39112152 CAGAGCCAGGCCTCTGAGAAAGG + Intergenic
1095943335 12:47740109-47740131 CAGAGCCAGGCCGGGCAGGGTGG + Intronic
1096642441 12:53005419-53005441 CTGTGGGAGGCCTCGGAGGGAGG + Intergenic
1097187406 12:57203144-57203166 GGGAGACAGGCCCAGGAGGGTGG - Intronic
1098590912 12:72211027-72211049 AGGAGTCAGGTCTAGGAGGGTGG - Intronic
1098885843 12:75960246-75960268 AGGACCCAGGCCTCTGAGGCAGG + Intergenic
1102472184 12:113165600-113165622 CAGAGCCAGGACTCAGAGCGTGG + Intronic
1104480464 12:129103392-129103414 GGAAGCCAGGCCTCCGAGGTGGG - Intronic
1108574280 13:51778121-51778143 CAGAGCCAGGGTTCAGAGGGAGG - Intronic
1113643764 13:111977271-111977293 CGGAGCAATGGCTCGGAGGCTGG - Intergenic
1113655135 13:112063160-112063182 CGGAGCGAGGGCGAGGAGGGAGG - Intergenic
1113697209 13:112354900-112354922 CGGAGCAAGGCCTCAGGGGAGGG + Intergenic
1114070214 14:19099497-19099519 GGGAGCGGGGCCTCGGAGGCTGG + Intergenic
1114092050 14:19300505-19300527 GGGAGCGGGGCCTCGGAGGCTGG - Intergenic
1114736800 14:25050284-25050306 CCGCCCCAGGCCTCGGAGCGCGG + Exonic
1121252996 14:92513618-92513640 CGGGGCCGGGCCTCGGGGCGGGG - Intergenic
1122070149 14:99200833-99200855 CTGTGCCAGGCCTCGGGGGAGGG - Intronic
1123676628 15:22715360-22715382 AGCAGGCAGGCCTCGGAGGCAGG - Intergenic
1124328846 15:28789623-28789645 AGCAGGCAGGCCTCGGAGGCAGG - Intergenic
1128504434 15:68256787-68256809 GGGAGCCATCCCTAGGAGGGAGG - Intronic
1128982520 15:72197734-72197756 CGGAGCGAGGCCACCGAGGAGGG - Exonic
1129117772 15:73374840-73374862 CAGAGCCAGGCCAGAGAGGGAGG + Intergenic
1129155072 15:73712577-73712599 TTGGGCCAGGCCTTGGAGGGTGG + Intronic
1129160551 15:73745281-73745303 AGGAGGCAGGCCTGGCAGGGTGG - Intronic
1129607857 15:77033544-77033566 CGTAGCCAGGCCTTTGAGGGAGG + Intronic
1131154350 15:90065532-90065554 TCGAGCCACGCCTCGGAGGCTGG + Intronic
1131360150 15:91783675-91783697 GGGAGGCAGGCCTCAGGGGGTGG - Intergenic
1132646067 16:999853-999875 GAGAGCCTGGCCTGGGAGGGTGG + Intergenic
1132802735 16:1762305-1762327 CTCAGCCAGCCCTCGGAGGCCGG - Intronic
1133210630 16:4261642-4261664 CGGTGCCAGGCCTAGGAGTGGGG - Intronic
1133756156 16:8764088-8764110 CGGAGGCAGGATTCCGAGGGCGG - Exonic
1133944714 16:10338642-10338664 CCCAGCCAGGTCTGGGAGGGAGG + Intronic
1134108578 16:11500747-11500769 AGCAGCCAAGCCACGGAGGGAGG + Intronic
1134522446 16:14924841-14924863 AAGAGCCAGGCCGCGGTGGGGGG - Intronic
1134710116 16:16323492-16323514 AAGAGCCAGGCCGCGGTGGGGGG - Intergenic
1134717330 16:16363492-16363514 AAGAGCCAGGCCGCGGCGGGGGG - Intergenic
1134949487 16:18345153-18345175 AAGAGCCAGGCCGCGGTGGGGGG + Intergenic
1134957422 16:18388667-18388689 AAGAGCCAGGCCGCGGCGGGGGG + Intergenic
1135679429 16:24443875-24443897 CAGAGCAAGGCCTAGGAGAGGGG - Intergenic
1137531614 16:49281903-49281925 GGGGGCAGGGCCTCGGAGGGAGG - Intergenic
1138595687 16:58027802-58027824 AGGAGCCAGGCCCTGGTGGGAGG + Intronic
1138681208 16:58684685-58684707 CGGAGACAGGCTCTGGAGGGTGG - Exonic
1139478886 16:67217334-67217356 CAGAGCCAGGACTAGGAGGAAGG - Intronic
1141841469 16:86576778-86576800 AGGAGCAGGGCCGCGGAGGGAGG + Intronic
1141982807 16:87560674-87560696 TGGAGCCAGGCTTCCTAGGGTGG + Intergenic
1142581253 17:944413-944435 TGGAGGCAGTCCTCGGACGGGGG - Intronic
1142876206 17:2853419-2853441 CGGGGCCGGGCCGGGGAGGGCGG + Intronic
1142890183 17:2938055-2938077 CGGAGCCAGGGCTGGGAGGAAGG + Intronic
1143575350 17:7789339-7789361 AGGAGTCAGGCCTGGCAGGGCGG + Intronic
1143751700 17:9032779-9032801 CGAAGCCAGACCTCAGAGGTGGG + Intronic
1145863358 17:28225637-28225659 CGGAGGCAGGCCTGGGAGCAGGG - Intergenic
1146398383 17:32486361-32486383 CGGACCCTGGCCTCGGCGGAGGG + Intergenic
1146400018 17:32494706-32494728 GGGACCCAGGACTCGGAGTGTGG + Exonic
1146659732 17:34657649-34657671 AGGAGCCTGGCCTGGGAGAGCGG + Intergenic
1148742100 17:49898693-49898715 CAGAGCCAGGCCTCCCAGGCTGG - Intergenic
1150581869 17:66481545-66481567 CAGAGACAGGCCTAGGAGAGAGG - Intronic
1151698106 17:75728294-75728316 CTGAGCCAGCCCTTGGTGGGGGG + Intronic
1151866454 17:76806343-76806365 CGGAGCCCTGCCCCGCAGGGAGG - Intergenic
1152286421 17:79415680-79415702 GGGAGCAGGTCCTCGGAGGGAGG + Intronic
1152291425 17:79442123-79442145 CTGAGCCTGGCCTGGGAGGGAGG + Intronic
1152625695 17:81387031-81387053 CGGAGCTGGGGCGCGGAGGGAGG + Intergenic
1153487029 18:5609455-5609477 CAGGGCCAGGCCTGGGAAGGAGG - Intronic
1155352257 18:24918032-24918054 CGGAGCCAGGATCCGAAGGGAGG - Intergenic
1156675139 18:39518973-39518995 CTGAGCTAGGCCTCTGAGGATGG + Intergenic
1158976703 18:62716470-62716492 CGGGGGCCGGCCTCGGGGGGCGG - Exonic
1160432759 18:78823138-78823160 CGGAGCCATGCCACGGTGGCCGG + Intergenic
1160499390 18:79394701-79394723 TGGAGCCAGGCCTCGGGACGCGG + Intergenic
1160560120 18:79750929-79750951 CAGAGGCAGGCCGGGGAGGGAGG + Intronic
1160560191 18:79751134-79751156 CAGAGGCAGGCCGGGGAGGGAGG + Intronic
1161357344 19:3826311-3826333 CTCAGCCAGGCCTCTCAGGGTGG + Intronic
1161455665 19:4368568-4368590 CAGAGCCAAGCCTTGGAGGAGGG - Intronic
1161709114 19:5837937-5837959 CAGAGCCCGGACTGGGAGGGAGG + Intronic
1162143107 19:8596402-8596424 CGGGGCCAGGCCTGGGAAGACGG + Exonic
1162479338 19:10919698-10919720 CTGAGCCAGGCCTGGGAGGATGG - Intronic
1162757171 19:12867356-12867378 CGGAGCCAGGCCTCGGAGGGTGG + Intronic
1162783702 19:13021241-13021263 CAGAGACAGGCCTCTTAGGGTGG - Intronic
1162818523 19:13209680-13209702 TGTGGCCAGGCCTCTGAGGGTGG + Intronic
1163113224 19:15174108-15174130 CGGAGCCAGGACTAGGCCGGTGG + Exonic
1163284479 19:16337989-16338011 CGGAGCCAGGCCTTGGGGGGCGG - Intergenic
1163556899 19:17998313-17998335 CGGGGCCGGGCCTGGGAGGCAGG - Exonic
1163643268 19:18473859-18473881 AGGAGCAAGGCCTGGGTGGGAGG - Intronic
1163762163 19:19143400-19143422 CAGAGCTGGGCCTTGGAGGGTGG + Intergenic
1165159194 19:33805863-33805885 AGGAGCCAGGCCTCAGAGCCAGG - Intronic
1165828490 19:38719019-38719041 GGGAGCCAGGCCCGGGAAGGAGG - Intronic
1166840394 19:45693436-45693458 CGAAGCCCGGCTGCGGAGGGTGG + Exonic
1167105767 19:47429319-47429341 CCCAGCCACGCCTTGGAGGGAGG - Exonic
1167751887 19:51385816-51385838 CGGAGCCAGCCCTGAGAGAGAGG - Intronic
1167889385 19:52527622-52527644 GGAAGCCAGGCCTGGGCGGGAGG - Intergenic
1168108812 19:54180710-54180732 CAGAGCCAGCCCTTGGAGGTGGG + Intronic
926168404 2:10535822-10535844 TGGAGCCAGGCCACAGAGGCCGG - Intergenic
926176965 2:10602175-10602197 TGGACCCAGGCCTCTGAGGAGGG - Intronic
927186215 2:20484409-20484431 GGGAGCCAGGCTCCCGAGGGAGG + Intergenic
927645369 2:24873805-24873827 GGGATCCAGGGCTGGGAGGGTGG - Intronic
929448687 2:42021523-42021545 TGCAGCCTGGCCTCGGAGGGGGG - Intergenic
929818370 2:45254366-45254388 CAGAGCCAGGCCTCGGACCCAGG + Intergenic
930946774 2:57084831-57084853 TGGAGCCATGCCTGGGAGGGTGG + Intergenic
934852971 2:97712999-97713021 GGGAGCCAGGGCTGGGAGGCCGG - Intergenic
935056239 2:99570076-99570098 CGGCTCCAGCCCTCAGAGGGGGG - Intronic
937135060 2:119544823-119544845 CGGAGCCAGGCCTACCGGGGCGG + Intronic
941951231 2:171159994-171160016 GGGAGCCAGTCCTGCGAGGGTGG - Intronic
947594016 2:231399700-231399722 GGGAGCCAGGCCTGGGGGTGTGG - Exonic
948368941 2:237475337-237475359 CGGGGCCGGGCCGCGGGGGGCGG + Intergenic
948456597 2:238107327-238107349 CGAATCCAGGCCCTGGAGGGAGG + Intronic
948541027 2:238691529-238691551 CTGAGCCATGCCTGGGATGGAGG - Intergenic
949067437 2:242001698-242001720 GGCAGCCTGGCCTTGGAGGGTGG - Intergenic
1168756878 20:324552-324574 CGGAGCCAGTCCTGGGGGCGTGG - Intergenic
1170539173 20:17370945-17370967 TGGGGACAGCCCTCGGAGGGAGG - Intronic
1170732189 20:18985100-18985122 AGGAGCCAGGCCCTGGAGGTGGG + Intergenic
1171122125 20:22577130-22577152 GCGAGCCGGGGCTCGGAGGGCGG + Intergenic
1171452827 20:25248008-25248030 CGGGGCGGGGCCTCGGGGGGCGG - Intergenic
1172978312 20:38922599-38922621 CAGAGCCAGGCCCCGCACGGTGG - Exonic
1174279804 20:49431134-49431156 TGAAGCCAGTCCTCTGAGGGTGG - Intronic
1175228937 20:57461329-57461351 AGGAGCCAGGCCTGGGATGAAGG + Intergenic
1178309743 21:31519875-31519897 CGGTGCCAGGGCCTGGAGGGAGG + Intronic
1178327016 21:31654416-31654438 CCGAGCCATGCCCCGCAGGGAGG - Intergenic
1179484881 21:41703931-41703953 AGCAGCCAGGCCTACGAGGGAGG + Intergenic
1179892884 21:44345769-44345791 CAGAGCCAGGCCTGGGAGAAGGG + Intergenic
1180003115 21:45004011-45004033 AGAAGCCAGACCTCGGAGTGGGG - Intergenic
1180034212 21:45235012-45235034 TGGTGCCAGGCCTCGGGGGCAGG - Intergenic
1180285465 22:10741568-10741590 GGGAGCCACGCCTCAGCGGGAGG - Intergenic
1180488684 22:15822059-15822081 GGGAGCGGGGCCTCGGAGGCTGG + Intergenic
1180617521 22:17138150-17138172 CGGAGCCTGTCCTTGGAGGAGGG - Exonic
1180980656 22:19876633-19876655 AGGAGCCAGGCCTTGGTGGGAGG + Intronic
1181323294 22:22025382-22025404 CGGAGCCCGGCCTCCCACGGGGG + Intergenic
1181689521 22:24550775-24550797 CTGAGCCAGGCCTTGAAGGCTGG - Intronic
1182049307 22:27300818-27300840 AGGAGCTATGCCTGGGAGGGCGG + Intergenic
1182857933 22:33534663-33534685 GGGACCCAGGCCTCCGAGGCGGG + Intronic
1183382152 22:37495700-37495722 GGGAGCCAGGGCTCAGATGGGGG - Intronic
1183444962 22:37847450-37847472 CTGTGCCAGGCCTCGGAGAAGGG + Intronic
1184284558 22:43462343-43462365 GGGAACCAGGCCTCGGGAGGAGG - Intronic
1184296107 22:43526558-43526580 AGGAGCCAGGGCTTGGAGGCAGG + Intergenic
1184650972 22:45919345-45919367 CGGAGCCAGGACTTGGTGGTCGG - Intergenic
1184745443 22:46453078-46453100 CCCTGCCATGCCTCGGAGGGAGG + Intronic
1185040575 22:48501759-48501781 CTGAGCCAGGCCGCTGAGTGTGG + Intronic
1185175662 22:49325159-49325181 AGGAGCCAGGCCTGGCAGGATGG + Intergenic
950241073 3:11370648-11370670 CAGACCCAGGCCTCGATGGGAGG - Intronic
951503756 3:23418352-23418374 CGGATCCAGCCCATGGAGGGTGG - Intronic
953787919 3:45924466-45924488 CAGGGCCAGGGCTCAGAGGGAGG + Intronic
954301775 3:49704146-49704168 GGGAGCAAGGCCTGGGCGGGGGG + Intronic
954420987 3:50418881-50418903 GGGAGCCTGGCCTCTGGGGGAGG + Intronic
956997781 3:74847915-74847937 GGGAGCCAGACCTCAGAGGCTGG + Intergenic
959581928 3:107991355-107991377 CTGAGCCAGGCCACAGAGGGTGG + Intergenic
961932295 3:130547191-130547213 CCGAGCCATGCCCCGCAGGGAGG + Intergenic
962613717 3:137103579-137103601 GTGAGCCAGGCCTCTGGGGGAGG + Intergenic
966872299 3:184299061-184299083 CGGACCCCGCCCTCGGAGGCAGG - Exonic
967318983 3:188177275-188177297 CAGACCCAGGCCTGGGAAGGAGG + Intronic
968565653 4:1311243-1311265 GGGAGCCCGGCCACGGAGGCCGG + Intronic
968904228 4:3444200-3444222 CGGAGCAAGTCCCCGGAGGATGG + Intronic
968919662 4:3515903-3515925 CGGGGCCAGGCTCTGGAGGGAGG - Intronic
968962520 4:3752775-3752797 CTGAGCCTGGCCTGGCAGGGAGG + Intergenic
968968895 4:3783394-3783416 CTGTGCCAGGGCTGGGAGGGAGG + Intergenic
969694732 4:8728174-8728196 TGGAGACAGGCCTGGGAGAGAGG + Intergenic
973317854 4:48780128-48780150 CGGAGCCAGGGGCCCGAGGGCGG - Exonic
974637628 4:64585108-64585130 ATGGGCCTGGCCTCGGAGGGGGG - Intergenic
976898145 4:90137567-90137589 CTGAACCAGGCCTCTGAGGCTGG - Intronic
979253566 4:118589705-118589727 CTGAGGCAGGCTTGGGAGGGTGG - Intergenic
983620694 4:169758020-169758042 CGGTGCCAGGTCTCAGGGGGCGG - Intergenic
983935915 4:173502500-173502522 AGGAGCCAGGCAACGGAGAGCGG - Intergenic
984990097 4:185371866-185371888 CTGAGCTAGGGCTCGGAGAGGGG + Intronic
985064215 4:186105234-186105256 CGGAGCCAGGGCGCGGAGGAGGG - Intronic
985702495 5:1382135-1382157 AGAAGGGAGGCCTCGGAGGGAGG + Intergenic
985781118 5:1872347-1872369 AGGGGCCAGGCCACGGGGGGCGG - Intergenic
990311872 5:54548030-54548052 GGAAGCCAGGCCTCTGAGGTGGG + Intergenic
992062169 5:73063878-73063900 TGGAAGCAGGCCTCGGAGGTGGG - Exonic
992407816 5:76476221-76476243 CAGAGGCAGGCCTGGGAGGAAGG + Intronic
996397826 5:123031386-123031408 GGGAGGCAGGCCTGGGAGGAGGG + Intronic
997255843 5:132427359-132427381 GGGAGCCAGCCCTAGGAGTGTGG - Intronic
998152567 5:139765582-139765604 CGGAGCTTGGGCTTGGAGGGTGG - Intergenic
999144214 5:149381838-149381860 CAGTGCCAGGCCTGAGAGGGAGG + Intronic
999317068 5:150591053-150591075 AGGTGCCAGGCCTGGGATGGGGG + Intergenic
999734987 5:154506298-154506320 TGGAGCCAGGCCTCTGAGCAGGG + Intergenic
999799244 5:155017940-155017962 AGGAGCCTGGCCTAGGATGGAGG + Exonic
1000622979 5:163505879-163505901 CGGATCCGGGGCTGGGAGGGTGG - Intronic
1001277182 5:170359478-170359500 GCGAGCCAGGACTCGGATGGTGG - Intronic
1001424857 5:171616344-171616366 CGGAGCCAGGGGGCGGGGGGAGG - Intergenic
1001577055 5:172771322-172771344 CGGCGCCTGGCCTGGCAGGGCGG - Intergenic
1001948183 5:175797340-175797362 CACGGCCAGGCCTCGGCGGGCGG - Intronic
1002140988 5:177138927-177138949 CGGAGCCCGGCCTCAGACTGAGG + Intronic
1002305117 5:178278641-178278663 CGGAGGCTGGCCCAGGAGGGTGG - Intronic
1005649464 6:27873391-27873413 CCGTGCCAGGCGTCGGATGGCGG + Exonic
1005875471 6:30007271-30007293 CCGGGCCAGGGCTCGGTGGGCGG + Intergenic
1006411879 6:33878526-33878548 TGAAGCCAGGCCTGGGAAGGAGG + Intergenic
1006572501 6:35017496-35017518 CGGAGCCAGGACTCTGCGGAGGG + Exonic
1007382425 6:41499455-41499477 TGGAGCCAGGCCTTGGAGGCAGG - Intergenic
1007963358 6:45981601-45981623 GGGGGCCAGGCCTAGGTGGGAGG + Intronic
1008497088 6:52144655-52144677 AGGAGCCAGGTCTGGGAGGCTGG - Intergenic
1015626304 6:135182916-135182938 CGGAGCCTGGCCGCGCAGGACGG + Intronic
1018669877 6:166169010-166169032 CAAAGCCAGGCCTTGGAAGGGGG - Intergenic
1018945837 6:168346156-168346178 CAGAGCCAGGCCGGAGAGGGAGG + Intergenic
1018969558 6:168517192-168517214 CGCAGACAGGCCTCAGAGCGAGG - Intronic
1019335605 7:481155-481177 CAGTGCCAGGCTTCGGAGAGGGG - Intergenic
1019518153 7:1448556-1448578 GGGAGCCAGGCCAAGGATGGGGG + Intronic
1019638115 7:2087642-2087664 CTGACCCAGGCCTGGCAGGGCGG + Intronic
1020098751 7:5382669-5382691 TGGGGCCAGGTCTGGGAGGGAGG - Intronic
1020112990 7:5458245-5458267 CAGAGCAAGGCCTTGGGGGGTGG - Intronic
1020143401 7:5624625-5624647 CTGGGCCAGGCCTCGGGGAGAGG + Intronic
1021411136 7:20330982-20331004 CGGAGCCCGGCTTCGCGGGGCGG - Intronic
1021510327 7:21427315-21427337 GGCAGCCAGGCCTCGGTCGGGGG + Intergenic
1022525894 7:31037064-31037086 AGGAGGCAGCCCTGGGAGGGAGG + Intergenic
1024597763 7:50954498-50954520 AAGACCCAGGCCTCGGAGGCAGG + Intergenic
1027053142 7:75032204-75032226 CAGAGCCAGGCCTGGGAGTGGGG + Intronic
1029109149 7:98203426-98203448 CGGCTCCAGGCCTGGGAGGACGG - Intronic
1029249700 7:99226968-99226990 GGGACCCAGGCTTGGGAGGGTGG + Intergenic
1029379662 7:100204828-100204850 TGGAGGGAGGTCTCGGAGGGAGG + Intronic
1029483830 7:100827532-100827554 CGGCGCCGGGCCCGGGAGGGAGG + Intronic
1029607692 7:101609047-101609069 CGGAGCCAGGCTTGGGGTGGAGG + Intergenic
1029810049 7:103038146-103038168 CCGAGCCAGGCATGGGAGGGAGG - Intronic
1029926938 7:104328533-104328555 CGGAGCCCGGGCCAGGAGGGAGG + Intergenic
1030005873 7:105119105-105119127 AGCAGCCAGGTCTCGGTGGGGGG + Intronic
1032403700 7:131641008-131641030 GGGACCCAGGCCTAGGAAGGGGG - Intergenic
1035236065 7:157498320-157498342 AGAAGCCAGGACTCTGAGGGTGG - Intergenic
1035264845 7:157685018-157685040 CGGAGCCATACCTGGGCGGGAGG + Intronic
1035297086 7:157873385-157873407 CGGAGCAAAGCCTCGGGGCGCGG - Intronic
1035522805 8:288807-288829 CAGTGCCAGGCATCGCAGGGTGG - Intergenic
1037336533 8:17797663-17797685 AGAAGGCAGGCCCCGGAGGGAGG - Intronic
1037879187 8:22564922-22564944 TGAAGCCAGGCCTTGGAGGGCGG + Intronic
1038777840 8:30546915-30546937 AAGAGCCAGGCCTGGGAGGCAGG - Intronic
1039542945 8:38386551-38386573 CGGAGCCCGGCCGAGGAGGTAGG + Exonic
1039800671 8:40951933-40951955 GGGAGTCAGGCCTCTGAGGAGGG - Intergenic
1041693592 8:60714074-60714096 CAGAGCCAGGCCTCGGCGGGCGG + Intronic
1041693755 8:60714599-60714621 CGGAACCAGGCCGCGAAGTGGGG - Intronic
1042560845 8:70071265-70071287 CTGAGCCAGGCTTAAGAGGGCGG + Exonic
1044242410 8:89902565-89902587 GGGAGCCAGGCGCCGGAGGCGGG - Exonic
1044853586 8:96452510-96452532 CGGAGCCCTGCCTCACAGGGAGG - Intergenic
1044930682 8:97248851-97248873 CTGAGGCAGGCCAGGGAGGGAGG - Intergenic
1045222558 8:100213209-100213231 CGGGGCCAGACCCCGGAGGCCGG + Exonic
1048965462 8:139611471-139611493 AGGAGCCAGGCCACAGAGGCTGG + Intronic
1049160477 8:141094715-141094737 CGGAGCAGGGCTTCGGAGAGTGG + Intergenic
1049218140 8:141417107-141417129 CAGAGCCAGGAGTCGCAGGGAGG + Intronic
1049235589 8:141510745-141510767 CAGACCCAGGCCCCGGGGGGTGG - Intergenic
1049575416 8:143387618-143387640 CGGAGGCTGGGCTCGGAGGATGG - Intergenic
1051235326 9:14993182-14993204 CGGCGCCAGGTCTCAGGGGGCGG + Intergenic
1051626334 9:19102924-19102946 CGCCGCCAGGCGTCCGAGGGAGG + Exonic
1055422853 9:76162194-76162216 GGGAGCCAGGCCTTGGAAGGTGG - Intronic
1056853166 9:90101740-90101762 GGGAGGCAGGCCCAGGAGGGCGG - Intergenic
1057276112 9:93676759-93676781 AGCAGCCAGGCCTCGCAGGAGGG + Exonic
1060795325 9:126508972-126508994 GTGAGCCAGGCCCAGGAGGGAGG - Intergenic
1061262603 9:129488453-129488475 CGGACCCAGGCCCCGGAGCCCGG - Intergenic
1061275908 9:129569235-129569257 CGGGGCCAGGCCAGGGAGGGAGG + Intergenic
1062403208 9:136381497-136381519 GGGAGCCAGGCCAGGGTGGGAGG + Intronic
1062403455 9:136382514-136382536 AGGAGCCAGGCCTAGCTGGGAGG - Intronic
1062421021 9:136482854-136482876 CGGAGCCAGGCCGTGGAGGTCGG - Intronic
1062565900 9:137163915-137163937 GGGCACCAGGCCTCGGAGGGTGG - Intronic
1062656240 9:137605640-137605662 CGGGGCCGGGCCTCGGAGCCGGG + Exonic
1190276862 X:48904628-48904650 AGGAGCCAGGCCCCGGAGGGTGG + Exonic
1192357857 X:70420639-70420661 AGGAGCCTGGCCTAGGATGGAGG + Exonic
1196791351 X:119468166-119468188 CTGAGAGAGGCCTCGGAGAGGGG - Intergenic
1200162399 X:154016284-154016306 AGGAGGAGGGCCTCGGAGGGAGG + Intronic
1202202408 Y:22367289-22367311 CGGAGCCCTGCCTTGCAGGGAGG + Intronic