ID: 1162757171

View in Genome Browser
Species Human (GRCh38)
Location 19:12867356-12867378
Sequence CGGAGCCAGGCCTCGGAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 299
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 273}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162757159_1162757171 21 Left 1162757159 19:12867312-12867334 CCTGAACTGAAGAATTGTAGGTT 0: 1
1: 0
2: 0
3: 3
4: 139
Right 1162757171 19:12867356-12867378 CGGAGCCAGGCCTCGGAGGGTGG 0: 1
1: 0
2: 3
3: 22
4: 273

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162757171 Original CRISPR CGGAGCCAGGCCTCGGAGGG TGG Intronic