ID: 1162759239

View in Genome Browser
Species Human (GRCh38)
Location 19:12878802-12878824
Sequence AGAAGCCCCCATCGTGGTCA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 101}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162759234_1162759239 13 Left 1162759234 19:12878766-12878788 CCGGTGGAGGGAAGTTAGGTACA 0: 1
1: 0
2: 1
3: 7
4: 90
Right 1162759239 19:12878802-12878824 AGAAGCCCCCATCGTGGTCAAGG 0: 1
1: 0
2: 0
3: 6
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162759239 Original CRISPR AGAAGCCCCCATCGTGGTCA AGG Exonic
905033478 1:34902796-34902818 GGAAGCCCCCAGGGAGGTCAGGG + Intronic
905360779 1:37418825-37418847 AGAAGGCCCCTTTGTGGTGATGG - Intergenic
907090386 1:51718970-51718992 AGCAGCCCCCACCGTTTTCATGG + Intronic
918246237 1:182662042-182662064 AGAAGCACCCATGGAGGTCCAGG - Intronic
921045048 1:211470236-211470258 TGAAGGCCCCCTGGTGGTCACGG - Intergenic
921109169 1:212015233-212015255 CAAAACCCCCATCGTCGTCATGG - Intronic
1063384677 10:5608686-5608708 GGAAGGCCCCATGGAGGTCAAGG + Intergenic
1064442176 10:15363895-15363917 AGAAGCCCCCATGCTGATGAGGG - Intronic
1070140637 10:73734821-73734843 AGAAGCCCCCATGCAGGTCGGGG - Intergenic
1071158069 10:82713965-82713987 AGGAGCCGCCATGGTTGTCATGG + Intronic
1075441212 10:122480532-122480554 TGAAGCCCCCATGCTGGCCATGG + Intronic
1076672737 10:132131947-132131969 AGGAGCCCCCACCTTGCTCACGG - Intronic
1080119196 11:28656879-28656901 AAAAGGCCCCATGGTGGTCTTGG + Intergenic
1083007021 11:59356186-59356208 AGCAGCCCCCATCACTGTCATGG - Intergenic
1084932974 11:72571450-72571472 GGAAGCCCCCTTCATGGTCTGGG + Intergenic
1091025246 11:132135840-132135862 TGAGGCCCCCATCGAGGTGAGGG + Intronic
1093614539 12:21207041-21207063 AAAAGCCCACATCTTAGTCATGG + Intronic
1107510983 13:41084706-41084728 GGAAAACCCCATAGTGGTCATGG - Intergenic
1107635665 13:42389937-42389959 AGAAGCCTCAAGAGTGGTCAAGG + Intergenic
1109813592 13:67548406-67548428 AGAAGTCCAGATCCTGGTCAGGG + Intergenic
1113345999 13:109479207-109479229 AGACACCCCCATCTTGGTCTTGG + Intergenic
1113923554 13:113928209-113928231 AGAAGCTCCCATCGTGGAGGGGG + Intergenic
1114598118 14:23931593-23931615 AGATGGCCCCATCGGGGTGATGG - Intergenic
1118752237 14:68815949-68815971 TCAAGTCCCCATGGTGGTCAGGG + Intergenic
1122647296 14:103203666-103203688 AGACCTCCCCATCCTGGTCAAGG + Intergenic
1123460190 15:20462906-20462928 AGAAGCCTCCATCGTTATTATGG + Intergenic
1123657872 15:22537511-22537533 AGAAGCCTCCATCGTTATTATGG - Intergenic
1124311783 15:28632710-28632732 AGAAGCCTCCATCGTTATTATGG - Intergenic
1126245491 15:46499822-46499844 GCAAGCCACCATCGTGGTCAGGG + Intergenic
1128113851 15:65093440-65093462 AGAAGGCCCCAGCCTGGCCATGG + Intronic
1129701580 15:77771574-77771596 AGAAGCCTCCAACCTGGTCCCGG + Intronic
1132667706 16:1089693-1089715 AGAAGCCCACAGCCTGGTCCTGG - Intergenic
1136235989 16:28914099-28914121 AGAGGCCCCCCTCCTGGTGAAGG - Intronic
1137784208 16:51124450-51124472 AACAGCCCCCATCGTGGTTCTGG - Intergenic
1141040827 16:80671047-80671069 AGAAGCCTCCACTGGGGTCAGGG - Intronic
1144659873 17:17061024-17061046 AGAAGCCCCCATTCTGAGCATGG + Intronic
1144778058 17:17794829-17794851 TGAAGCACCCAGCCTGGTCAAGG + Exonic
1145154955 17:20538780-20538802 AGAGGCCCCCAGTTTGGTCATGG + Intergenic
1147675366 17:42201830-42201852 CGAAGTCCCCATCGGTGTCAAGG + Exonic
1152004130 17:77667076-77667098 AGAAGCCGCCATCGTGGTTGTGG - Intergenic
1152738673 17:82009498-82009520 AGAAGCCCCCTTGGTGACCAAGG + Exonic
1157332699 18:46715032-46715054 AGAAGCCCACATCAGGTTCATGG + Intronic
1157485523 18:48084315-48084337 CTAAGCCCCCATCGTGGGGAGGG - Intronic
1157602658 18:48903445-48903467 AGATGCCCTCATCCTGGTCCTGG - Intergenic
1160949365 19:1658165-1658187 AGATGCCCCCATTGTGCCCAGGG - Intergenic
1162759239 19:12878802-12878824 AGAAGCCCCCATCGTGGTCAAGG + Exonic
1163508888 19:17723912-17723934 AGAGGGCCCCATCGTGCGCAGGG - Intronic
1163767601 19:19172108-19172130 AGAAGCCCCCAGCCTGGCCCAGG - Intronic
1165069012 19:33244769-33244791 AGAAGTTCACATGGTGGTCAGGG - Intergenic
1168292248 19:55362376-55362398 GGAAGCCCACCTCGTTGTCAGGG + Exonic
926140453 2:10364952-10364974 AGAAGGCCCCACAGTGGACAGGG - Intronic
928387282 2:30881201-30881223 AGGAGCCCCCAGCTAGGTCAGGG + Intergenic
931781033 2:65579635-65579657 AGAAGCTCACACCATGGTCAGGG - Intergenic
936032206 2:109081523-109081545 TCAAGCCTCCATCGTGCTCAGGG + Intergenic
938601948 2:132851430-132851452 AGTAGCCCCCAGTGTGATCAGGG - Intronic
947587370 2:231364885-231364907 AGCAGCCCCCAAGGTGGTCAGGG - Intronic
947767472 2:232646898-232646920 AGAAGCCTCCACAGAGGTCAAGG - Intronic
948958725 2:241315634-241315656 ACAAGCCGCCATCTTGGTAAAGG + Intronic
1175488805 20:59364886-59364908 AGGTGCCCCCAGCGTGGACAAGG - Intergenic
1175814875 20:61878120-61878142 CTAAGGCCCCATCGTGGCCATGG + Intronic
1175962149 20:62642623-62642645 AGGTGCCGCCATCGTGGGCAGGG + Intronic
1176055202 20:63141582-63141604 TGAATCCCCCTGCGTGGTCAGGG + Intergenic
1178491388 21:33054636-33054658 AGAAGCCCTGATCCTGGTCTTGG - Intergenic
1178621976 21:34185216-34185238 TGATGCCCCCAGCGTGGCCAAGG - Intergenic
1179925649 21:44532829-44532851 AAAAGCCCCCATTGTGTCCAAGG + Intronic
1180087066 21:45512443-45512465 GGAAGCCCCCACCGTGGGCAGGG + Exonic
1183047224 22:35229729-35229751 ATTAGCCCCCATCGTTGCCAGGG - Intergenic
1184593066 22:45498718-45498740 AGAAGAACCCATCATGGGCACGG - Intergenic
1184615768 22:45637270-45637292 AGAAGCACCAGTCATGGTCAAGG - Intergenic
952544802 3:34407311-34407333 ACATGCCCCCAAGGTGGTCAGGG - Intergenic
953198234 3:40753967-40753989 AGAAGCTCCCATTGTGGTAGGGG + Intergenic
958181041 3:90061309-90061331 AGAAGCCCCTATGGTGCTTATGG - Intergenic
960396721 3:117146622-117146644 AGAAGCCCCCATGGTGTACCTGG + Intergenic
965486449 3:169284300-169284322 AGCAGCCTCCTTCGTGGTCTTGG + Intronic
968411097 4:390776-390798 TGAAGCCCCCATAGTGATCCAGG - Intergenic
968522462 4:1040130-1040152 TGCAGCCCACACCGTGGTCAGGG + Intergenic
975826308 4:78322995-78323017 AGAAGCCCCCAGCAAGGTAATGG + Intronic
981348419 4:143700661-143700683 AGAAGCCCCCGCCATGGCCACGG + Exonic
982009314 4:151091575-151091597 AGAAGACCCCAACATAGTCAGGG - Intergenic
985662429 5:1163893-1163915 AGAAACCCCCATGGTGGGCCTGG + Intergenic
985947922 5:3201093-3201115 AGAAGGCACCATCGTGCTGATGG - Intergenic
986691665 5:10318475-10318497 AGAAGCCCTTCTCGTGGTAATGG - Intergenic
995356770 5:111246686-111246708 AGAATCCACCATCCTGGCCAGGG + Intronic
997612847 5:135227312-135227334 AGCAGAACCCAGCGTGGTCAAGG - Intronic
999321138 5:150615772-150615794 TGAATCCACCATCATGGTCAAGG + Intronic
999841969 5:155437783-155437805 AGCAGCCCCCAGTGTGGTCTGGG + Intergenic
1001440678 5:171740441-171740463 AGAAGCCCCCGTTGGGGTCATGG + Intergenic
1006130362 6:31865429-31865451 AGACACCCCCATCCTGGTCCAGG - Intronic
1006822272 6:36906722-36906744 AGAAGCCTCCTTCATTGTCAAGG + Intronic
1009741204 6:67748224-67748246 AGAAGCCCCCCACTTAGTCATGG - Intergenic
1020263258 7:6543405-6543427 AAAAGCCCCCTTTGTAGTCAAGG + Intronic
1022537035 7:31104748-31104770 AGGTGCCCCCATCCAGGTCATGG + Intronic
1034351810 7:150420759-150420781 AGAAGACCCCATAATGGCCAAGG - Intergenic
1035749629 8:1987486-1987508 AGCAGATCCCATTGTGGTCAAGG + Intronic
1036216446 8:6883702-6883724 GGAAGCCCCCATAGGGGTGAGGG - Intergenic
1039356392 8:36821494-36821516 AGGAGCCCCCATCCAGGTCTAGG + Intronic
1040323805 8:46331168-46331190 AGAAGCCCCCATGGCTGTCCTGG + Intergenic
1040326319 8:46343431-46343453 AGAAGCCCCCAGAGTGGTCCAGG + Intergenic
1041794878 8:61736882-61736904 AACAGCCCCCATCTTGGCCAAGG - Intergenic
1048640552 8:136354094-136354116 AGAAGCCCCCACCCTGTTCTAGG + Intergenic
1057826565 9:98376695-98376717 AGAAGACCCCGTCTTGCTCAGGG + Intronic
1061710006 9:132480896-132480918 AGGTGCCCCCATTGTGGTCCGGG + Intronic
1062336858 9:136075096-136075118 AGAAGCCGCCATTGAGGACAAGG - Intronic
1191864940 X:65696466-65696488 AGAAGCCTCCCTAATGGTCAAGG - Intronic
1194199290 X:90935100-90935122 AGAGGCCCCCATCAAGGTCCAGG - Intergenic
1199077173 X:143537030-143537052 AGAAGCCCCAACTGTGCTCATGG - Intergenic
1200068951 X:153518351-153518373 AGCAGACCCCACCGCGGTCATGG + Intronic
1200545287 Y:4511519-4511541 AGAGGCCCCCATCAAGGTCCAGG - Intergenic