ID: 1162760422

View in Genome Browser
Species Human (GRCh38)
Location 19:12885559-12885581
Sequence CAGCTCTTCCGCGGGCTCCA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 149}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162760422_1162760430 5 Left 1162760422 19:12885559-12885581 CCCTGGAGCCCGCGGAAGAGCTG 0: 1
1: 0
2: 0
3: 7
4: 149
Right 1162760430 19:12885587-12885609 GCCCTTGGTACTGAGGCGCCGGG 0: 1
1: 0
2: 0
3: 10
4: 91
1162760422_1162760433 15 Left 1162760422 19:12885559-12885581 CCCTGGAGCCCGCGGAAGAGCTG 0: 1
1: 0
2: 0
3: 7
4: 149
Right 1162760433 19:12885597-12885619 CTGAGGCGCCGGGTACATCGCGG 0: 1
1: 0
2: 0
3: 0
4: 32
1162760422_1162760434 16 Left 1162760422 19:12885559-12885581 CCCTGGAGCCCGCGGAAGAGCTG 0: 1
1: 0
2: 0
3: 7
4: 149
Right 1162760434 19:12885598-12885620 TGAGGCGCCGGGTACATCGCGGG 0: 1
1: 0
2: 0
3: 2
4: 26
1162760422_1162760435 17 Left 1162760422 19:12885559-12885581 CCCTGGAGCCCGCGGAAGAGCTG 0: 1
1: 0
2: 0
3: 7
4: 149
Right 1162760435 19:12885599-12885621 GAGGCGCCGGGTACATCGCGGGG 0: 1
1: 0
2: 0
3: 6
4: 28
1162760422_1162760429 4 Left 1162760422 19:12885559-12885581 CCCTGGAGCCCGCGGAAGAGCTG 0: 1
1: 0
2: 0
3: 7
4: 149
Right 1162760429 19:12885586-12885608 TGCCCTTGGTACTGAGGCGCCGG 0: 1
1: 0
2: 1
3: 4
4: 81
1162760422_1162760437 24 Left 1162760422 19:12885559-12885581 CCCTGGAGCCCGCGGAAGAGCTG 0: 1
1: 0
2: 0
3: 7
4: 149
Right 1162760437 19:12885606-12885628 CGGGTACATCGCGGGGTACCCGG 0: 1
1: 0
2: 0
3: 1
4: 17
1162760422_1162760427 -10 Left 1162760422 19:12885559-12885581 CCCTGGAGCCCGCGGAAGAGCTG 0: 1
1: 0
2: 0
3: 7
4: 149
Right 1162760427 19:12885572-12885594 GGAAGAGCTGGAAGTGCCCTTGG 0: 1
1: 0
2: 4
3: 39
4: 289
1162760422_1162760428 -2 Left 1162760422 19:12885559-12885581 CCCTGGAGCCCGCGGAAGAGCTG 0: 1
1: 0
2: 0
3: 7
4: 149
Right 1162760428 19:12885580-12885602 TGGAAGTGCCCTTGGTACTGAGG 0: 1
1: 0
2: 2
3: 22
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162760422 Original CRISPR CAGCTCTTCCGCGGGCTCCA GGG (reversed) Exonic
900504449 1:3022357-3022379 AAGCTCCTTCTCGGGCTCCAAGG - Exonic
901079724 1:6577101-6577123 CAGCACTCCCGGGGGCTGCACGG + Intronic
901318348 1:8323976-8323998 CAGCTCCTCTCCGGCCTCCAAGG - Intronic
906484751 1:46225666-46225688 CACTCCTTCCGTGGGCTCCAGGG + Intergenic
907338395 1:53715786-53715808 CAGGTCCTCCACGGCCTCCATGG - Intronic
913319158 1:117576506-117576528 CAGCTCTCCAGTGGTCTCCAGGG - Intergenic
914028028 1:143930362-143930384 AAGCTTTTTCGCGGGCGCCATGG + Intergenic
914490540 1:148148116-148148138 CAGCTCTGCCTCGGCCTCCCCGG - Intronic
915399242 1:155610453-155610475 CAGCTCTCCCGGGGGCTCCTTGG - Exonic
915416357 1:155746033-155746055 CAGCTCTCCCGGGGGCTCCTTGG - Intergenic
915604059 1:156939822-156939844 CAGGTCGTCCTCGGGCTCCTGGG + Exonic
915996133 1:160565814-160565836 CAGCTCCTCAGGGAGCTCCAAGG - Intronic
917480811 1:175410498-175410520 CAACTCTGCCGGGGGCTGCAGGG + Intronic
918338575 1:183547155-183547177 CAGCTCTTCCTCTTCCTCCAAGG - Exonic
922439075 1:225637142-225637164 CATCTCTTCTGTGTGCTCCAGGG + Intronic
922947800 1:229531554-229531576 CAGCTCTTCCCCTGTCTGCAAGG - Intronic
1066366428 10:34781301-34781323 CAGCTCTTCCAAGGACTGCATGG - Intronic
1069748727 10:70732392-70732414 CAGCTGTGCCGTGAGCTCCAGGG + Intronic
1070149562 10:73797507-73797529 CAGCTCTTCTTCGGACTCCCTGG + Exonic
1070327638 10:75398982-75399004 CAGCGCTGCCGCGGCCGCCATGG - Exonic
1071513904 10:86284553-86284575 CAGCTCTTCTGCCAGCTCCCAGG + Intronic
1071919074 10:90329171-90329193 CACCTCCTCCACAGGCTCCATGG - Intergenic
1072636619 10:97182514-97182536 CAGCTCTTTCACGGGCTGCCTGG + Intronic
1076554139 10:131311298-131311320 CACCCCTTCCCCGCGCTCCACGG - Exonic
1076991778 11:279479-279501 CAGCTGCTCCGCGAGGTCCACGG - Exonic
1077167681 11:1151106-1151128 CAGCTCTCCCTCGGGCCCCCTGG + Intergenic
1077256321 11:1585021-1585043 TGGCTCTTCTGGGGGCTCCAAGG - Exonic
1077476339 11:2792154-2792176 CCGCACTCCCGCGGCCTCCAGGG + Intronic
1078065886 11:8079359-8079381 CTGCTCTGCTGCGGTCTCCAGGG + Intronic
1079239705 11:18713961-18713983 CTGGTCTTCCCCGCGCTCCATGG + Exonic
1081605833 11:44526580-44526602 CATCTCTGCCCCGGGCTCCGTGG + Intergenic
1083377703 11:62239335-62239357 CAGCTCTTCCGCCACCACCAAGG - Intergenic
1085123289 11:73981189-73981211 TAGCTCTTCTGCTGGCTCCCGGG + Intronic
1085815617 11:79734150-79734172 CAGCTCTTCTCAGGGCTCCCAGG + Intergenic
1089767148 11:120776297-120776319 CAGCCCTTCCTCCGGCTCCTGGG - Intronic
1091996386 12:4997418-4997440 CAGCTCTTCACTGGGCCCCAGGG - Intergenic
1092491579 12:8950014-8950036 CAGCTCGCCCTCGGGCTCCGCGG + Intergenic
1095879041 12:47112774-47112796 CAATTCTTCCCTGGGCTCCAGGG + Intronic
1095953276 12:47793216-47793238 CAGCTGTTCCATGTGCTCCATGG + Intronic
1096089629 12:48890266-48890288 CAGCTCATCCACGGGCCCCAGGG - Intergenic
1100690031 12:97029950-97029972 AAGCTCTTCCCATGGCTCCAGGG - Intergenic
1102679655 12:114682904-114682926 CACCTCTTCTTCGGGCTCCATGG + Exonic
1104247864 12:127060714-127060736 CGGCTCGCCCGCGGGCTCCCCGG + Intergenic
1105426823 13:20301723-20301745 CAGCCCCTCCGCGGGTCCCATGG + Intergenic
1105520425 13:21126191-21126213 CAGCTGTTTCGAGGGCTCCCTGG - Intergenic
1105941792 13:25154167-25154189 CAGCTCTGCCCAGGTCTCCAGGG - Intergenic
1119113686 14:71998517-71998539 CAGCTCTTTCTCGGCCTTCATGG + Intronic
1122280794 14:100621081-100621103 CACCTCTTCAGCAGCCTCCAAGG - Intergenic
1122389622 14:101371272-101371294 CAGCTGTCCCGAGGTCTCCAGGG - Intergenic
1122635611 14:103128311-103128333 CAGCTCTGCGGCGGGCTCACAGG - Intronic
1202899213 14_GL000194v1_random:26027-26049 CAGCTCTTGCGCTGGGCCCAGGG - Intergenic
1125198661 15:37078230-37078252 CTGCTCTTCCTTGGGCTACAAGG - Intronic
1125608704 15:40956850-40956872 CAGCTCTTCCTCCAGCTGCAGGG + Intergenic
1129878340 15:78991732-78991754 CAGCTGCTCCGCGATCTCCAGGG + Exonic
1130297553 15:82657829-82657851 CAGCCCTGCCTCTGGCTCCAGGG - Intergenic
1130983755 15:88831215-88831237 CACCCCTTCCCAGGGCTCCAAGG - Intronic
1132196513 15:99918012-99918034 GAGCTCTTCTGCAGGCTCCGAGG - Intergenic
1132391595 15:101442868-101442890 CAGCCCTGCCGCCAGCTCCACGG + Intronic
1135265240 16:21019788-21019810 CAGATCTTTCTCTGGCTCCAAGG - Exonic
1136318427 16:29467099-29467121 CTGCGCGTCCGCGCGCTCCAGGG + Exonic
1136433002 16:30206448-30206470 CTGCGCGTCCGCGCGCTCCAGGG + Exonic
1136585971 16:31185051-31185073 CACCCCTGCCGCGGCCTCCACGG - Exonic
1137603796 16:49774109-49774131 CAGCTCTTTCCCAGGCTCCTTGG + Intronic
1138206736 16:55130918-55130940 CAGCTCTTACTGGGGATCCATGG + Intergenic
1140223716 16:73063004-73063026 CGGCTCTTCTTCGGGCTCCTCGG + Intergenic
1140227907 16:73093443-73093465 CAGCTCTTTTGGGGGTTCCAGGG + Intergenic
1141952696 16:87348854-87348876 CAGTTGTTCTGCGGGATCCAGGG - Intronic
1142034138 16:87853488-87853510 CACCTCTTCCCAGGGCTCCCAGG + Intronic
1143463967 17:7123294-7123316 CAGCTCTCCCACGGGCTCCTTGG - Intergenic
1143582040 17:7833328-7833350 CTGCTCTCCCGGAGGCTCCAGGG + Intronic
1143627974 17:8121878-8121900 CAGCTCTTCTCCGCGCTGCACGG - Exonic
1143632787 17:8148359-8148381 CAGCTCTGCCCCGGGCACTATGG + Intronic
1144386147 17:14751016-14751038 CAGGGCTCCCGCTGGCTCCATGG - Intergenic
1147392971 17:40121791-40121813 CCGCTCCTCCGCGCGCTCCTCGG + Intergenic
1147587756 17:41662493-41662515 CAGCTGTCCCTCGGGTTCCATGG - Intergenic
1147886561 17:43688234-43688256 CAGTGCTTCTGCAGGCTCCAGGG + Intergenic
1148640581 17:49184219-49184241 CAGGTCTCCCACTGGCTCCATGG + Intergenic
1152128683 17:78462783-78462805 CAGCTCCTGCGAGGCCTCCAGGG + Intronic
1152639671 17:81444341-81444363 CAGCCCTGCCGCCGGCGCCAAGG - Intronic
1156479542 18:37427382-37427404 CAGCTCTCCCCAGGGCTGCATGG + Intronic
1156543338 18:37938941-37938963 TAGCTCTTCCTGGGGCTACATGG - Intergenic
1157283381 18:46360648-46360670 CAGCTCTTCCCTGGGGGCCAGGG + Intronic
1157901204 18:51519660-51519682 CAGCTCTGCCTCCTGCTCCAGGG - Intergenic
1157962817 18:52175761-52175783 CAGCTCCTCCTTAGGCTCCATGG - Intergenic
1160566608 18:79790011-79790033 CAGCTCCACAGCGGGCGCCATGG - Intergenic
1160995075 19:1878705-1878727 CAGCTCTGCCTCGGCCTCCCTGG + Intronic
1161233908 19:3188725-3188747 CAGCTGGTCCGTGGGCTCCCGGG + Intronic
1162459110 19:10803754-10803776 TAGCTCTTCAGCGGGCCCCAGGG - Intronic
1162760422 19:12885559-12885581 CAGCTCTTCCGCGGGCTCCAGGG - Exonic
1165105853 19:33469357-33469379 CAGCTCTGCCGTGAGCTGCAGGG + Intronic
1167013018 19:46821524-46821546 CAGGGCTTCCACCGGCTCCATGG - Intergenic
929159581 2:38818116-38818138 CAGCTTTTCAGAGGGGTCCATGG - Intronic
932451037 2:71811017-71811039 CAGCTCTCCTGAGGTCTCCAGGG - Intergenic
934573246 2:95384968-95384990 GAGCTCTGCCCCGGGCTCCCTGG - Exonic
943059933 2:183031658-183031680 CAGCTCTTACGCTTGCTACAAGG + Intronic
946001801 2:216488608-216488630 CAGCTTTTCTGTGGGCTCTATGG + Intergenic
948871263 2:240799392-240799414 CAGCTCTTCCAGAGGCTACAGGG + Intronic
1171090062 20:22276552-22276574 CAGCTCCTCCGTGGGCACCGAGG + Intergenic
1173827996 20:46059274-46059296 CAGCTCTGCCTTGGGCTCAAAGG - Intronic
1174128735 20:48327106-48327128 CAGTCCTTCCGGAGGCTCCAGGG - Intergenic
1176411610 21:6452172-6452194 CAGCTCCTGCGCGGCCTTCACGG + Intergenic
1178586530 21:33875406-33875428 GAGCTCTTCCGCCTTCTCCAGGG - Exonic
1178617009 21:34143458-34143480 CATCTCTTCCTCGGTCTCCTCGG + Intergenic
1179687104 21:43060494-43060516 CAGCTCCTGCGCGGCCTTCACGG + Exonic
1179791808 21:43760068-43760090 CAGCTCTGCCCAGGGCTACAGGG - Exonic
1181121137 22:20669243-20669265 CAGCTCTGCCTCGGCCTCCCCGG + Intergenic
1181334099 22:22116269-22116291 CAGCTCTGCCTCGGCCTCCCTGG + Intergenic
1181495471 22:23285125-23285147 CAGCTCCTCATCGGGCACCAGGG - Exonic
1184286173 22:43472939-43472961 CAGCCCTTACGTGAGCTCCAGGG - Intronic
1185228328 22:49666396-49666418 CTGCTTTTCCCCTGGCTCCATGG - Intergenic
1185248219 22:49784813-49784835 CAGCCCTTCCCCGGGCGCCTCGG + Intronic
950655234 3:14432453-14432475 CACTCCTTCCGCAGGCTCCAGGG + Intronic
950965440 3:17142743-17142765 CAGCCCTGCTGTGGGCTCCACGG + Intergenic
952091017 3:29886354-29886376 CAGCTCTACCTCGGACTACATGG - Intronic
954434433 3:50488586-50488608 CACCTCTTCCCCCAGCTCCATGG + Intronic
960702409 3:120451130-120451152 CAGGACTCCCGCGGGCTCCCCGG - Exonic
972570738 4:40308374-40308396 CTGCTCATCCCCGGGCACCACGG - Intergenic
973888434 4:55346273-55346295 CCGCTCTTCCGCGGGCTAGCGGG + Exonic
982189015 4:152834655-152834677 CAGCTCTGCCCCAGCCTCCATGG + Intronic
986215223 5:5713175-5713197 CAGATCTCCTGCTGGCTCCATGG + Intergenic
988500552 5:31780172-31780194 GAGCTCGTCCCCAGGCTCCAAGG - Intronic
991969598 5:72126243-72126265 CAGCTCTTCAGGGAGCACCATGG - Intronic
994790974 5:104224605-104224627 CAGGGCTCCCGCTGGCTCCATGG + Intergenic
998461167 5:142311241-142311263 CAGCGCTTCCGCGAGCACCCTGG - Exonic
998469795 5:142374843-142374865 CAGCTCCTGAGTGGGCTCCACGG - Intergenic
1001490198 5:172149594-172149616 CTGGTCTTCCTCGGGCTCCCTGG - Intronic
1002195233 5:177497549-177497571 CTGCTCTGCGTCGGGCTCCAGGG + Exonic
1002562203 5:180090223-180090245 CAGCTCAGCCGCGGGCTCTCAGG + Intergenic
1002800112 6:514646-514668 CAGCTGCTCCAGGGGCTCCAGGG + Intronic
1006166343 6:32067917-32067939 CGGCTCCTCAGCGGGCTCCGGGG + Intronic
1007511968 6:42380791-42380813 CAGCCTTTGCACGGGCTCCAGGG + Intronic
1012474945 6:99607757-99607779 TGGCTCTGACGCGGGCTCCAAGG + Intronic
1016017395 6:139200138-139200160 CAGCTTTTCCTCAGGCTCCCTGG + Intergenic
1018067181 6:160132323-160132345 CTGCTCTTCCGCCTGCTGCAGGG + Exonic
1019198469 6:170296006-170296028 CAGATGATCCGCGGGTTCCAGGG - Intronic
1020109415 7:5439768-5439790 CAGCCCTTCCTGGGGCTCCTGGG + Intronic
1026329438 7:69338962-69338984 CTGGTCTTCTGAGGGCTCCAGGG + Intergenic
1026681118 7:72467344-72467366 CAGGCCTTCAGTGGGCTCCAAGG - Intergenic
1032186890 7:129734529-129734551 CAGCTGTTCCGAGGGCTGTAGGG + Intronic
1032306097 7:130733730-130733752 CAGCTCTGGCGAGGGCTCCTGGG - Exonic
1032787363 7:135211470-135211492 CAGCTCGTCAGTGCGCTCCACGG + Exonic
1034691463 7:153017641-153017663 CAGTTGTTCTGCGGGCTCCCAGG - Intergenic
1035787318 8:2271959-2271981 CAGATCTTCCGATGGGTCCAGGG - Intergenic
1035805489 8:2449757-2449779 CAGATCTTCCGATGGGTCCAGGG + Intergenic
1038012118 8:23483558-23483580 CCGCCCTCCCGCCGGCTCCATGG + Intergenic
1038248461 8:25881215-25881237 CAGCTCTTCCTCAAGCGCCATGG - Intronic
1039300462 8:36203314-36203336 CAGCTCTTCAGATGGCTCCTGGG - Intergenic
1039476346 8:37841235-37841257 CAGCTCCTCCCCTGCCTCCAGGG - Exonic
1053077911 9:35150741-35150763 CAGGACTTCCACCGGCTCCATGG - Intergenic
1057228302 9:93304024-93304046 CAGCTGTCCCGTGGGCTCCTGGG + Intronic
1057448651 9:95137338-95137360 CAGCTCCTCCGCAGTCTCCCCGG - Intronic
1061971377 9:134047270-134047292 CAGCTCTTCCCAGGGCCGCACGG + Intronic
1185680558 X:1885378-1885400 CAGCTCTGCGCTGGGCTCCAGGG - Intergenic
1186896454 X:14008979-14009001 CAGCTGCACCGCGGCCTCCATGG + Exonic
1189380289 X:40497904-40497926 CAGCTCTTTATCGGGCTCCAAGG - Intergenic
1195615688 X:106910035-106910057 CAGCTCCTCCCCTGGCTCCTTGG + Intronic
1197563400 X:128051517-128051539 TAGCTCTTTCTCTGGCTCCAAGG + Exonic