ID: 1162762701

View in Genome Browser
Species Human (GRCh38)
Location 19:12897776-12897798
Sequence CGAGACATGCTGGGGGGGAA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 149}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162762689_1162762701 -1 Left 1162762689 19:12897754-12897776 CCTGGACATCGCCCGCCAGGCCC 0: 1
1: 0
2: 2
3: 20
4: 320
Right 1162762701 19:12897776-12897798 CGAGACATGCTGGGGGGGAATGG 0: 1
1: 0
2: 1
3: 7
4: 149
1162762688_1162762701 0 Left 1162762688 19:12897753-12897775 CCCTGGACATCGCCCGCCAGGCC 0: 1
1: 0
2: 0
3: 11
4: 146
Right 1162762701 19:12897776-12897798 CGAGACATGCTGGGGGGGAATGG 0: 1
1: 0
2: 1
3: 7
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162762701 Original CRISPR CGAGACATGCTGGGGGGGAA TGG Exonic
902122753 1:14181689-14181711 CCAGACAGGCTGGGGGAGAGAGG - Intergenic
903076885 1:20777192-20777214 AGAGACATGCTGTGAAGGAAAGG - Intronic
903734500 1:25521779-25521801 CAAGAAATGCTGGGGAGGAGAGG + Intergenic
904401070 1:30257113-30257135 CCAGACCTGCTGCGGGGGAGGGG - Intergenic
904497129 1:30893306-30893328 TGAGACATGGTGGGGGGGGGGGG - Intronic
904810868 1:33162673-33162695 CGAGAGAGGATGGGAGGGAAAGG + Intronic
905197218 1:36289652-36289674 CGAGACAAGCTGGGAGCGAAAGG + Exonic
906325448 1:44842925-44842947 CGAGTCATGCTGGCGGGGATGGG + Exonic
907294276 1:53439587-53439609 CGGGGCGTGCTGGAGGGGAAGGG - Intergenic
908619661 1:65963351-65963373 CTGGGCATGCTGGGGAGGAAAGG - Intronic
909743875 1:79068209-79068231 CAAGCCATGCTGGGGGGTTAGGG - Intergenic
912053651 1:105567343-105567365 AGAGACATGATGGTGTGGAAAGG - Intergenic
912495399 1:110088482-110088504 AGAGACGTGCTGTGGGGGCAAGG - Intergenic
918565025 1:185918935-185918957 CAAGACATTCTGTGGTGGAAAGG + Intronic
919796282 1:201323259-201323281 GGGGACAGGCTGGGGGGAAAAGG - Intronic
919867275 1:201791963-201791985 TGGGAGATGCTGGGGGGGAGAGG + Intronic
919930981 1:202221475-202221497 AGAGACGTGCAGGAGGGGAATGG - Intronic
922994042 1:229941809-229941831 CCAGAAATGCTGGGGGGGAAGGG + Intergenic
923685437 1:236150379-236150401 CGGGAGGTGCTGGGGGTGAACGG - Intronic
924862211 1:247936690-247936712 CCAGACATGTGGGAGGGGAATGG + Intergenic
1063904247 10:10766407-10766429 AGAGACCTGCAGGGGAGGAAGGG + Intergenic
1067559974 10:47298433-47298455 AGAGGCATTCTGGGGGGGAAGGG + Intergenic
1069716872 10:70526731-70526753 AGAGCCATGCTGGGGAGGACAGG + Intronic
1069717730 10:70531654-70531676 GGAGACAAGCAGGGTGGGAAAGG - Intronic
1070889001 10:79928299-79928321 GGAGACAGGCTGGGGAGGTAGGG - Intergenic
1071596708 10:86933219-86933241 TGAGACATGTTGGGGAGGCAAGG - Intergenic
1071826235 10:89329095-89329117 CTAGAGATGCTTGGTGGGAAAGG - Intronic
1076178655 10:128388092-128388114 CGAGACATGAAGGGTGGGAGGGG + Intergenic
1076526725 10:131116800-131116822 CGAGACATGCTGCTGGAGAGAGG - Exonic
1076581670 10:131516318-131516340 CGAACCAAGCTGGGGGGGCACGG - Intergenic
1080781070 11:35430684-35430706 CCAGACATGGTGGGGGAGACAGG + Intergenic
1084359097 11:68657978-68658000 CCAGACATGCGGCAGGGGAAAGG + Intergenic
1086971331 11:93084186-93084208 CCAGGGAGGCTGGGGGGGAAGGG - Intergenic
1087011742 11:93520834-93520856 CGTGACATGCTGAAGGTGAAAGG - Intronic
1088904412 11:114143407-114143429 AGACAGAGGCTGGGGGGGAAAGG + Intronic
1089162013 11:116445606-116445628 CCAGACAGGCTGGAGGGGAAGGG - Intergenic
1089196209 11:116695339-116695361 CGAGAAGTGCTGGGTGGGATAGG - Intergenic
1089348817 11:117809578-117809600 CGAGACATGACTGGGGTGAAGGG - Intronic
1093102183 12:15040588-15040610 TGAGATATGCTGGGAGGTAAAGG + Intergenic
1094295432 12:28899677-28899699 TGAGTCATGCTGGAGTGGAATGG - Intergenic
1095240872 12:39857461-39857483 CGAGATATTTTGGAGGGGAATGG - Intronic
1096029337 12:48398094-48398116 GGAGACAGGCTGAGGGAGAATGG - Intergenic
1096073807 12:48789602-48789624 CGTGACAGGCAGGGCGGGAATGG - Intergenic
1096560780 12:52434297-52434319 CGAGACATGGTGGGTGAGGAAGG + Exonic
1096617094 12:52839479-52839501 CCAGACATCCTAGGGGGAAAAGG + Exonic
1098147729 12:67515172-67515194 CGAGGCAGGGTGGGGTGGAAAGG - Intergenic
1100399941 12:94220747-94220769 CCAGACATGGTGGAGGGGGAAGG + Intronic
1101303536 12:103504775-103504797 TGAGACATGCTGGGGGGTACTGG + Intergenic
1101326227 12:103718127-103718149 AGAGACATGCTTGGTGGAAAGGG - Intronic
1103852590 12:123943008-123943030 TGGGATATGCTGTGGGGGAATGG - Intronic
1106028142 13:25974590-25974612 CGAGAGATCCTGGGGCAGAAGGG - Intronic
1108177604 13:47809459-47809481 CAAGACATGCTGGGATGGGAGGG + Intergenic
1113328454 13:109306431-109306453 TGAGACAGGATGGAGGGGAATGG + Intergenic
1113808316 13:113122710-113122732 CGAGACCTGCTGGCGAGGCAGGG - Intergenic
1117591280 14:57270561-57270583 CCAGAAATCCTGGGGGGAAATGG - Intronic
1119138011 14:72238471-72238493 AGAGCAATGCTTGGGGGGAAGGG - Intronic
1121819009 14:96950997-96951019 CTAGACATTCTGGAAGGGAATGG + Intergenic
1122262101 14:100529524-100529546 CAAGCCTTGCTGGGGTGGAAGGG + Intronic
1122579488 14:102762478-102762500 GGGGAAATGCTGGGGGGGAATGG + Intergenic
1122584412 14:102795192-102795214 TGAGACAGGCTGGGGAGGCAGGG - Intronic
1127272974 15:57417704-57417726 CCAGATATACTGGGGGGAAAAGG + Intronic
1130829457 15:87584595-87584617 AGAGTCATTCTGGGGGAGAAGGG - Intergenic
1136228566 16:28874099-28874121 CGAGGCAGGGTGAGGGGGAAGGG + Exonic
1137720337 16:50623995-50624017 CGAGAATTGCTGGAGGGAAATGG + Intronic
1139666962 16:68464036-68464058 CAAGGCCTGCTGGGGGAGAAGGG - Intergenic
1141014252 16:80433542-80433564 AAAGACAAGCTGGGGGGGATGGG + Intergenic
1141093625 16:81147506-81147528 TGACACATCCTGGTGGGGAAAGG + Intergenic
1143304213 17:5933167-5933189 TGAGACATGCAGGGGGAAAAAGG - Intronic
1147249533 17:39144734-39144756 CAACACATGCAGGCGGGGAACGG - Intronic
1148798991 17:50211225-50211247 CCAGACATGCTGGGAGGGGGTGG - Intergenic
1152542239 17:80982199-80982221 AGAGGCATGCAGGGAGGGAAAGG - Intergenic
1155273223 18:24160929-24160951 TGAGACTGGCTGGGGGGAAATGG + Intronic
1160535589 18:79589806-79589828 TGAGACATGCAGGGTGGGGAGGG - Intergenic
1162762701 19:12897776-12897798 CGAGACATGCTGGGGGGGAATGG + Exonic
1165523600 19:36333216-36333238 TCAGCCATGCTGTGGGGGAAGGG + Intergenic
1166768478 19:45266211-45266233 CGAAACAATCTGGGAGGGAAGGG - Exonic
931979759 2:67682003-67682025 TGAGACGTGCACGGGGGGAAAGG - Intergenic
933664206 2:84951466-84951488 CGAGACATGCTTGGAGGAGAAGG - Intergenic
936415802 2:112309791-112309813 CCAAACTTGCTGGGGGGAAAAGG + Intronic
937909390 2:127068247-127068269 CGAGACAGGCTGGGGTGGGGAGG + Exonic
942208316 2:173645976-173645998 TGAGACAGGATGGTGGGGAAGGG + Intergenic
942208410 2:173646721-173646743 TGAGACAGGATGGTGGGGAAGGG - Intergenic
944705849 2:202287646-202287668 CGAGACAGGCTGGGAAGAAAGGG - Exonic
944902886 2:204233772-204233794 CGTGACATACTGGGGTGGGATGG - Intergenic
948013431 2:234668844-234668866 CCAAACATGCTGCTGGGGAATGG + Intergenic
948037891 2:234873888-234873910 AGAGGCAGGCTGGCGGGGAAGGG + Intergenic
948144619 2:235699162-235699184 GGAGAAAAGCTGGAGGGGAAGGG - Intronic
1169731545 20:8791006-8791028 CGAGAAATGCTTGTGTGGAATGG - Intronic
1170983889 20:21240591-21240613 TGAGCCATGGTGCGGGGGAAAGG + Intronic
1172611092 20:36253072-36253094 AGAGAGGTGATGGGGGGGAAGGG - Intronic
1175240249 20:57542146-57542168 ACAGCCATGCTGGGGTGGAAAGG + Intergenic
1175371439 20:58495673-58495695 AGAGACATGTTTGGGGGAAAGGG + Intronic
1175966235 20:62661499-62661521 GGAGACTTGCTGGTGTGGAAGGG - Intronic
1177358972 21:20045049-20045071 ACAGACATGCTGGCAGGGAAGGG - Intergenic
1178991231 21:37358365-37358387 CTAGAAAGGCTGGGTGGGAAGGG - Intergenic
1179243492 21:39611478-39611500 CAGGACGTGCTGGGTGGGAAAGG + Intronic
1180790682 22:18573999-18574021 CGAGAAAAGCTGGTGGGGATGGG - Intergenic
1181231055 22:21421315-21421337 CGAGAAAAGCTGGTGGGGATGGG + Intronic
1181247593 22:21513553-21513575 CGAGAAAAGCTGGTGGGGATGGG - Intergenic
1181456294 22:23061937-23061959 CGAGATATGCTGGGGCAGAGAGG + Exonic
1183329568 22:37212078-37212100 GGACACATCCTGGGGGGGCAGGG + Exonic
949653014 3:6182819-6182841 CGACAGATACTGGGAGGGAAGGG + Intergenic
949928489 3:9060087-9060109 TGAGCCCTGCTGGAGGGGAAGGG - Intronic
951797316 3:26554250-26554272 CCATGCATGCTGGGAGGGAATGG + Intergenic
952233353 3:31454454-31454476 CGAGACAAGCTGGAAGCGAAAGG + Intergenic
954340541 3:49950042-49950064 CGAGATATTTTGGGGGGCAAGGG + Intronic
954416588 3:50396235-50396257 TGAGGGATGCTGGGGTGGAATGG - Intronic
954622755 3:52005280-52005302 GGAGACCTGCTGGGTGGGCAGGG - Intergenic
954693078 3:52406174-52406196 AGACAAATGCTGTGGGGGAAGGG + Intronic
955820131 3:62887889-62887911 TGAGACATGATGGAGGAGAAGGG + Intergenic
959888262 3:111526762-111526784 AGAGACAGGCTGTGGTGGAATGG + Intronic
959995130 3:112672194-112672216 AGAGACATGATGGGGAGAAAAGG + Intergenic
961848168 3:129786470-129786492 TGAGATATGCTGGGGGTGACAGG + Intronic
962410042 3:135133002-135133024 AGAGACGTGCTGTGGGGGGAAGG - Exonic
966236156 3:177704079-177704101 CCAGACATGATGTGGAGGAAGGG - Intergenic
966970553 3:185041545-185041567 GGAAACATGTTGGAGGGGAAAGG - Intronic
969673359 4:8601746-8601768 AGAGGCAGGCTGGGGTGGAAGGG + Intronic
978305437 4:107323237-107323259 TGAGCCAAGCTGGGGTGGAAGGG - Intergenic
980157069 4:129120617-129120639 CGAGGCATGTTGGGGGGTGAGGG - Intergenic
981434599 4:144705821-144705843 GGAGAAATGCTAGAGGGGAAAGG - Intronic
987478743 5:18426659-18426681 TGAGAAAGGCTGGAGGGGAAGGG + Intergenic
996315602 5:122157463-122157485 GGAGAAATGCTGTGGTGGAAGGG + Intronic
998428929 5:142053880-142053902 AGAGACCTGGTCGGGGGGAAAGG + Intergenic
1001406967 5:171483376-171483398 ACAGTCATGCTGGGTGGGAATGG + Intergenic
1003244330 6:4371280-4371302 CGGGACATGCAGGAAGGGAAGGG - Intergenic
1005490510 6:26343336-26343358 GGAGACCTGCTGGAGGGGAGAGG - Intergenic
1006931709 6:37692680-37692702 AGGGACAGGCTGGGGGGGAAGGG - Intronic
1008078112 6:47167156-47167178 GGAGGCATGCTGGGGGTGCAAGG - Intergenic
1010305557 6:74317493-74317515 CTAGAGATGCTGTGGAGGAAAGG - Intergenic
1014486923 6:122010546-122010568 AGAGAGATGTTGGGAGGGAAGGG - Intergenic
1018856714 6:167680233-167680255 TGAGACATGGTGGAGGAGAAGGG - Intergenic
1030239656 7:107307747-107307769 AGGGACATGATGGGGGAGAAGGG + Intronic
1039390866 8:37179906-37179928 AGAGAGAGGCTGGGGGGGATAGG - Intergenic
1043975635 8:86581731-86581753 GGAGACTTGGTGGGGGGGTAAGG - Intronic
1044510730 8:93075507-93075529 AGAGGCTTGCTGGTGGGGAAGGG + Intergenic
1049638912 8:143705533-143705555 CGGGAGGTGCTGGGGGGGACTGG + Intronic
1051027263 9:12627743-12627765 CGAGACTTGCTGGGGTGCAGTGG + Intergenic
1052026187 9:23576021-23576043 TGATAAATGCTGGGGGTGAAGGG - Intergenic
1056489855 9:87095200-87095222 CCAGACATGCAAGGAGGGAAAGG - Intergenic
1056540534 9:87567370-87567392 AGATACAGGCTGTGGGGGAATGG + Intronic
1057189665 9:93079622-93079644 GGGGACATGCTGGGGGACAAGGG + Intronic
1058535043 9:105950218-105950240 TCAGACATGCTGGTGGGGTAGGG + Intergenic
1059301444 9:113316901-113316923 AAAGGCAGGCTGGGGGGGAAAGG + Exonic
1059468141 9:114482614-114482636 GCAGACATGCTGAGGGGGAGGGG - Intronic
1062565154 9:137161042-137161064 CGTCACAATCTGGGGGGGAAGGG - Exonic
1186490005 X:9964149-9964171 GGAGGCATGCTGGGGAGGGATGG - Intergenic
1189009990 X:37037363-37037385 CTATTCATGCTGGGGTGGAAAGG + Intergenic
1189038589 X:37518367-37518389 CTATTCATGCTGGGGTGGAAAGG - Intronic
1194261315 X:91699547-91699569 ACACACATGCTGGTGGGGAAAGG + Intergenic
1195504796 X:105644763-105644785 CGAGGCCTGTTGGGGGGGCATGG - Intronic
1196100531 X:111842864-111842886 CCAGTCATCCTGGGGGGGCAGGG + Intronic
1196507281 X:116462473-116462495 GGAGAGATGGTGGTGGGGAATGG + Intronic
1197977798 X:132183616-132183638 AGAGACAGGTTGGGGTGGAAGGG + Intergenic
1199767895 X:150953957-150953979 GGAGACTGGCTGGGGAGGAAGGG - Intergenic
1200123454 X:153802198-153802220 CTTGAGATGCAGGGGGGGAAGGG + Exonic
1200256644 X:154586002-154586024 GGAGACAGCCTGGGGGGGATGGG + Intronic
1200261125 X:154618401-154618423 GGAGACAGCCTGGGGGGGATGGG - Intronic
1200579966 Y:4938348-4938370 ACACACATGCTGGTGGGGAAAGG + Intergenic