ID: 1162765298

View in Genome Browser
Species Human (GRCh38)
Location 19:12915731-12915753
Sequence GGTACAGGGGTGAGTGCAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 226}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162765298_1162765307 2 Left 1162765298 19:12915731-12915753 CCCCTTGCACTCACCCCTGTACC 0: 1
1: 0
2: 0
3: 15
4: 226
Right 1162765307 19:12915756-12915778 ACTCGCTCGCCTAGCCACACTGG 0: 1
1: 0
2: 1
3: 1
4: 38

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162765298 Original CRISPR GGTACAGGGGTGAGTGCAAG GGG (reversed) Intronic
900188428 1:1343458-1343480 AGTGCAGGGGTGGGTGCAGGTGG - Intronic
901066579 1:6497306-6497328 GCTCCATGGGTGAGTGCAGGCGG - Intronic
901393449 1:8963389-8963411 GGTGGAGGGGTGAGGGCTAGAGG - Intronic
901844045 1:11971080-11971102 GGGGCAGGGGTGAGTGGGAGTGG + Intronic
902722436 1:18313033-18313055 GGTACAGGGATGAGTAAAACGGG - Intronic
903254378 1:22083790-22083812 GGGACAGGGCTGACTGCAAAGGG - Intronic
903671485 1:25038305-25038327 GCTACAGGGGTTATTGCATGGGG - Intergenic
904989030 1:34576547-34576569 GGTGCAGGGGTGAATGGGAGTGG - Intergenic
905202957 1:36326157-36326179 GGTGCAGGGGAGAGTGGCAGGGG + Intronic
906644372 1:47463311-47463333 GATACAGGGGTGAGTGGATAGGG - Intergenic
906795695 1:48694869-48694891 TGTACAGAGGTGTGTGCAAGAGG - Intronic
906855928 1:49304526-49304548 GGTACAGGGGAGAGATCTAGAGG + Intronic
907381589 1:54095350-54095372 GGCACAGAGGTGTGTGAAAGTGG + Intronic
909579083 1:77212483-77212505 GGTACAGATGTGTGTACAAGTGG - Intronic
911573533 1:99546804-99546826 GGTTTAGGGGTGAGTGCATATGG - Intergenic
911698725 1:100925599-100925621 GGGTCAGGGTTGAGTGAAAGAGG + Intronic
912953371 1:114135793-114135815 GGGAGAGGGGTGAGGGCCAGGGG - Intronic
913335275 1:117703904-117703926 TGCACAGGGCTGAGTGCAAAAGG - Intergenic
914822715 1:151117266-151117288 GGTACAGTGGTGTGTGCCTGTGG - Intronic
915690854 1:157689122-157689144 TGTACAATGCTGAGTGCAAGTGG - Intronic
916791527 1:168129490-168129512 GGTGAAGGGGGGACTGCAAGGGG + Intronic
917410696 1:174757199-174757221 GGTACAGGGGAAAGTTCTAGTGG - Intronic
917574241 1:176304126-176304148 GGCACAGGCTGGAGTGCAAGTGG - Intergenic
920029379 1:203027221-203027243 GGGACAGGGGTGGGCGCAACAGG + Intronic
920423885 1:205857947-205857969 GGTAAAGAGGTGAGGGCATGAGG - Intergenic
920649143 1:207823773-207823795 GGGGCAGGGGTGGGAGCAAGAGG - Intergenic
921006708 1:211100712-211100734 GGCACTGGGCTGGGTGCAAGGGG + Intronic
921604181 1:217136563-217136585 GGGACAGGGGTGAGGGCGTGCGG - Intronic
923129743 1:231065094-231065116 GGTTCAGGGGTGACTGAAAAAGG - Intergenic
923541098 1:234888742-234888764 GGCACAGGGGTGAGAAGAAGGGG + Intergenic
924824437 1:247524397-247524419 GTTTCAGGGGAGAGCGCAAGTGG + Intronic
1064981913 10:21173973-21173995 GGGCCACGGGTGAGTGCACGGGG + Intronic
1065634108 10:27712795-27712817 GGTGCAGTGGTGAGTGCCTGTGG + Intronic
1066157181 10:32690787-32690809 GGGACTGGGATGAATGCAAGTGG + Intronic
1067076539 10:43189505-43189527 GGTGCAGGGGTGTGTGCCTGTGG - Intergenic
1072465006 10:95655585-95655607 GGTACAGGGGAGAGGTCAGGAGG - Intronic
1073412132 10:103350954-103350976 GGTGCAGGGGTGAGGGCGGGCGG + Exonic
1073423992 10:103445286-103445308 GTTCCAGGGCTGAGAGCAAGTGG + Intronic
1074366991 10:112866462-112866484 GGTACAGGGGAGAGAGGAACAGG + Intergenic
1076280381 10:129241832-129241854 GGTACAGGTGTGCATGCAAAGGG + Intergenic
1076912907 10:133401123-133401145 GGTGCAGGGGTGGGTCCAGGAGG + Intronic
1077110098 11:858526-858548 GGAACCGGGGTGAGTGTCAGCGG - Intronic
1078468595 11:11569355-11569377 GGTATTGGGGTGGGGGCAAGTGG - Intronic
1079786816 11:24683756-24683778 GGGGCAGTGGTAAGTGCAAGAGG - Intronic
1080233410 11:30043199-30043221 GGTCCAGGTGTAAGTGCAACAGG - Intergenic
1081396499 11:42592116-42592138 GGTACAGGGGCCAGAGCCAGAGG + Intergenic
1082700970 11:56430200-56430222 GATACAGGGATGACTGCAATGGG + Intergenic
1084609062 11:70189868-70189890 GGTGCAGGTGTGTGTGCATGTGG + Intergenic
1085193141 11:74646756-74646778 GGTCCTGGGGTGCTTGCAAGTGG + Intronic
1085644684 11:78215402-78215424 GGGACAGGAGTGTGTTCAAGTGG - Exonic
1086517896 11:87634898-87634920 GTTACAGGAATGAGGGCAAGGGG - Intergenic
1086562056 11:88179075-88179097 GGGACAGGGTTGAATGAAAGAGG - Intergenic
1087196779 11:95310865-95310887 GGTCCAGGTGTGAGTTGAAGAGG - Intergenic
1089189000 11:116640889-116640911 GGTACAGGGGAGGGTGTGAGGGG - Intergenic
1091018644 11:132078408-132078430 GGTACCTGGGTGAGTGCCACCGG + Intronic
1091203363 11:133800068-133800090 GGTAGAGTGGTGTGAGCAAGAGG + Intergenic
1091280237 11:134377664-134377686 GATACAGGGCTGCGTGCAGGAGG - Intronic
1091441797 12:516791-516813 GGTGCAGGGGTGGATACAAGGGG + Intronic
1092484744 12:8892888-8892910 AGTACAGGGCTGAGTGGCAGGGG + Intergenic
1096595339 12:52691490-52691512 GGTGCAGGGGCGGGTGCAGGTGG - Intronic
1097066810 12:56326677-56326699 GGGACAGGGATGAGGGAAAGAGG + Exonic
1098743332 12:74202228-74202250 GGTACAGTGTTGAATGAAAGTGG + Intergenic
1100893098 12:99147792-99147814 AGAACAGGGGTGATTGCAAAGGG + Intronic
1101553998 12:105789662-105789684 GGAATAGGGGTGAATACAAGGGG + Intergenic
1102693431 12:114779576-114779598 GGGACAGGGCTGAGGACAAGGGG + Intergenic
1103758602 12:123232012-123232034 GGGACAGGAGTGAATGCAAAGGG + Intronic
1104344247 12:127981667-127981689 GGTACAAGAGAGAGTGAAAGCGG + Intergenic
1104886149 12:132109768-132109790 AGTACAGTGGTGGGTGCCAGGGG - Intronic
1105024528 12:132839379-132839401 TGTGCAGGGGTGAGGCCAAGAGG - Intronic
1105024576 12:132839559-132839581 TGTGCAGGGGTGAGGCCAAGAGG - Intronic
1105024600 12:132839665-132839687 GGTGCAGGGGTGAGGGAGAGGGG - Intronic
1105654506 13:22421289-22421311 GGTATGGGGGTGAGGGGAAGTGG - Intergenic
1109548426 13:63860189-63860211 GCTGCAGGGGTCACTGCAAGTGG - Intergenic
1110654926 13:77986755-77986777 GGCACAGGGGCCAGTGCCAGTGG - Intergenic
1113054278 13:106251354-106251376 GGAACAGGGGTGAGTGTGAAGGG + Intergenic
1113612495 13:111657061-111657083 GGGACAGAGGTGAGAGGAAGAGG - Intronic
1116628322 14:47295862-47295884 CGTCCAGGCTTGAGTGCAAGTGG - Intronic
1117901952 14:60543461-60543483 GAAGCAGGGGTGGGTGCAAGAGG - Intergenic
1118767429 14:68919300-68919322 GGTTCAGGGGTCAGTGGCAGGGG - Intronic
1119524529 14:75311712-75311734 AGTAGAGGGGTGATTGCCAGAGG + Intergenic
1122315140 14:100821506-100821528 GGCACAGAGGTGGGTGCCAGTGG - Intergenic
1122800891 14:104228990-104229012 GGAGCAGCGGGGAGTGCAAGGGG + Intergenic
1127377081 15:58394751-58394773 GATACAGAGTTGAGAGCAAGGGG + Intronic
1128562162 15:68676027-68676049 GGGACAGGGGTGTGGGCAGGTGG + Intronic
1129210829 15:74066897-74066919 GGTAAAGGGGTGACTGGGAGGGG + Intergenic
1129388850 15:75210496-75210518 GGTACAAGGATGAGAGCAAAGGG - Intronic
1129403182 15:75298432-75298454 GGTAAAGGGGTGACTGGGAGGGG - Intergenic
1129477793 15:75797811-75797833 GGTATAGGGCTGAGTCCAGGAGG + Intergenic
1129832033 15:78676900-78676922 AGTACAGTGGTGAGCGCAAGAGG + Intronic
1130511489 15:84593542-84593564 GGTATAGGGCTGAGTCCAGGAGG - Intergenic
1131283927 15:91042293-91042315 AGTACAGTGGTGAGTGCCAGGGG - Intergenic
1131664160 15:94552319-94552341 GTTTCAGGGGTGCGTGCAAGAGG - Intergenic
1133483196 16:6192100-6192122 GATACAGGGGAGAGAGCAGGAGG - Intronic
1133587132 16:7206786-7206808 GCAACAGGGGAGAGTGAAAGGGG + Intronic
1133616392 16:7480729-7480751 GGCACAGGCTTGACTGCAAGGGG + Intronic
1134040718 16:11066263-11066285 GGACCAGGGGTCAGTGCTAGTGG + Intronic
1134692090 16:16197695-16197717 GGTGCAGGGAGGGGTGCAAGAGG + Intronic
1135482497 16:22832714-22832736 GGTCCTGGGGTGAGTTGAAGGGG + Intronic
1138535555 16:57658408-57658430 GGTTCAGCGCTGAGGGCAAGTGG - Intronic
1140455760 16:75104753-75104775 GGGACAGGGGAGAGTGCAGGAGG - Intronic
1140584276 16:76270294-76270316 GGGAGAGGGGTGGGGGCAAGTGG + Intergenic
1141280783 16:82628032-82628054 GGTGCAGAGGTGACTGCAGGCGG - Intronic
1141841438 16:86576662-86576684 GGTACGCGGGTGAGAGCGAGTGG + Intronic
1141855290 16:86677024-86677046 GGAACTGGGGTGAGGGCATGGGG + Intergenic
1142353328 16:89589706-89589728 GGCACAGGCCTGTGTGCAAGGGG - Intronic
1142376616 16:89710020-89710042 GGGTCAGGGGTGGGTGCAGGAGG - Intronic
1143125452 17:4638836-4638858 GGCCAAGGGGTGAGAGCAAGGGG - Exonic
1143556953 17:7667982-7668004 GGAACAGGGGTGGGTGCTACTGG - Intronic
1144721438 17:17473231-17473253 AATAGAGGGGTGGGTGCAAGGGG - Intergenic
1144794252 17:17880448-17880470 GGCACAGGACTGAGGGCAAGGGG - Intronic
1146699514 17:34944253-34944275 GGTTCAGGGTCAAGTGCAAGTGG - Intronic
1146923069 17:36726747-36726769 GGTGGAGGGGTGGGTGAAAGAGG - Intergenic
1148216391 17:45835984-45836006 GGGAGAGGGGTGAGGGCAGGAGG + Intergenic
1148640215 17:49181944-49181966 GATGCAGGGTTGAGTGGAAGAGG - Intergenic
1149061621 17:52429285-52429307 GGTAGAAGGGTGAGTGAATGAGG - Intergenic
1149232855 17:54555125-54555147 GGTGCAGGAGTGACTGAAAGAGG + Intergenic
1149867651 17:60159593-60159615 GGAACAGGGGTGGGTGGAGGGGG - Intronic
1151352785 17:73541530-73541552 GGTAGAGGGGTGAGTGCCCGTGG + Intronic
1151369433 17:73638601-73638623 GGGACAGGAGTGAATGCAGGGGG + Intronic
1153134910 18:1905711-1905733 GGTACAGGGGCCACTGCAATGGG + Intergenic
1153788209 18:8553809-8553831 AGTACAGTGGTGGGTGCCAGGGG + Intergenic
1154946613 18:21167908-21167930 GGAACAGGTGTGTGTGCTAGTGG - Intergenic
1155231352 18:23778188-23778210 GGTGAAGGGGTGAGTACTAGAGG + Intronic
1155645044 18:28067361-28067383 GGGAGAGGGGTGAGTGGAATGGG - Intronic
1155865498 18:30959964-30959986 AGTCCAGGGCTGAGTGCCAGGGG - Intergenic
1157500487 18:48187018-48187040 GGAAAAGGGGTGGGTGCGAGAGG + Intronic
1158010212 18:52719808-52719830 GGCAGAGTGGTGAGTTCAAGGGG + Intronic
1158404764 18:57151375-57151397 GTTACAGAGGTGAGTACATGTGG + Intergenic
1160871270 19:1278958-1278980 GGTCCAGCGGTGGGTGCAGGTGG - Exonic
1161657418 19:5524779-5524801 GGTATATGGGTGAGTGTATGGGG - Intergenic
1162765298 19:12915731-12915753 GGTACAGGGGTGAGTGCAAGGGG - Intronic
1164157099 19:22603503-22603525 GGTAAAGGGGTGACTGCAAAGGG - Intergenic
1164946338 19:32296288-32296310 GCTAGAGGGGTGGGAGCAAGGGG - Intergenic
1165319747 19:35077803-35077825 CATGCAGGGGTGAGTGCAAGTGG - Intergenic
1166205343 19:41265343-41265365 GGTACGGGGGTGGGTGGGAGAGG + Intronic
1167458213 19:49609801-49609823 GGTGCAGGGGTGAGTTCCATGGG + Intronic
1167825540 19:51969687-51969709 GGCACAGTGGTGAGTGCCTGTGG + Intronic
1168182234 19:54669779-54669801 GGTACAGTGATCAGTGCAACAGG - Exonic
1168280857 19:55304748-55304770 TGTGCAGAGGCGAGTGCAAGGGG - Exonic
925046832 2:778613-778635 GGCATGGGGGTGAGTGCAGGTGG - Intergenic
927155877 2:20221115-20221137 GGTAGAGGGGAGACTGCAACAGG + Intronic
930229217 2:48826839-48826861 GGAAAAGGGCTGAATGCAAGGGG + Intergenic
931472715 2:62555286-62555308 TCAACAGGGGTGAGTGGAAGGGG + Intergenic
932265353 2:70363094-70363116 GGTGCAGGGGTGAGCCAAAGTGG - Intergenic
934854913 2:97723739-97723761 GGTACAGGTGTGGGTGCTTGGGG + Intronic
935084103 2:99827825-99827847 GGTACAAGGGTGAGTGAAACAGG - Intronic
936385774 2:112027760-112027782 GGAGCAGGGGTGAGGGCAGGGGG - Intronic
937977236 2:127589378-127589400 GGTGCATGGGTGGGTGCATGTGG + Intronic
938662861 2:133505159-133505181 GTTTCAGGGTTGAGAGCAAGAGG + Intronic
940896035 2:159082281-159082303 GGTACAGGGTTGGGTGGCAGTGG - Intronic
942434369 2:175955910-175955932 GGTGCAGGGCTGAGTACAAAAGG + Intronic
942449561 2:176100427-176100449 GGTTCAAGGGAGAGTGTAAGGGG + Intronic
946027426 2:216680173-216680195 GATGCAGGGGTGAGTGGAGGTGG + Intronic
946779467 2:223178151-223178173 ATTAGAAGGGTGAGTGCAAGAGG + Intronic
948229773 2:236341527-236341549 GGAACAGGAGTGTGTGCAGGAGG + Intronic
948470355 2:238173493-238173515 GGCACAGGTGTGTGTGCATGTGG - Intronic
948497643 2:238362797-238362819 GGCACATGGGTAAGTGGAAGAGG + Intronic
1170610010 20:17905190-17905212 GGGACTGAGGTGACTGCAAGTGG + Intergenic
1174442796 20:50569381-50569403 CGTCCAGGGGTGCCTGCAAGTGG - Intronic
1178535846 21:33409796-33409818 GGGACATGTGTGAGAGCAAGAGG - Intronic
1179554408 21:42163201-42163223 TGTGCAGGGGTGAGTGAGAGAGG + Intergenic
1180109216 21:45640172-45640194 GGGACAGGGGAGAGGGCATGAGG + Intergenic
1181786529 22:25231306-25231328 TGTACTGGGGTCAGAGCAAGGGG - Intronic
1181818693 22:25459133-25459155 TGTACTGGGGTCAGAGCAAGGGG - Intergenic
1183498055 22:38161683-38161705 GGGACAGAGGTGTGTGCATGGGG + Intronic
1184124644 22:42478508-42478530 GGAAGTGGGGTGAGTGAAAGGGG + Intergenic
1185215817 22:49599463-49599485 GGTACAGGGGTGAGGTCTGGAGG - Intronic
950517148 3:13474786-13474808 GGTAGGGGTGTGAGTGCAGGGGG + Intergenic
950675851 3:14554021-14554043 GGGACAGTGGTGTGTGCATGGGG + Intergenic
951595740 3:24316474-24316496 GGAACAAGGGTGAGAGCAAGAGG - Intronic
952845114 3:37681787-37681809 AGGACAGGGGTGAGTGAACGGGG - Intronic
952945753 3:38477138-38477160 CGTCCAGGGGTGAGTGCAGGAGG + Intronic
956705812 3:71998145-71998167 GGTGCTGGAATGAGTGCAAGAGG - Intergenic
956769198 3:72510162-72510184 GGCACAGGGCTGAGTGCCGGAGG - Intergenic
961180865 3:124876486-124876508 GGCAGAGGGGTGGGTGCAGGAGG + Intronic
961315829 3:126035037-126035059 GGTAAAGCGGTGAGGGCAGGAGG + Intronic
961843676 3:129740754-129740776 GGAACAGTGGTAAGTACAAGAGG - Intronic
964304526 3:155326206-155326228 GGTGCAGGGGCGAGTGGGAGTGG - Intergenic
966422263 3:179745271-179745293 GGGACAGGGGTAAGGGAAAGGGG + Intronic
967359664 3:188615048-188615070 GGTACAGAGATGACTGCCAGAGG - Intronic
968005186 3:195237917-195237939 GGGGCAGGGGTGAGAGGAAGCGG - Intronic
968899822 4:3425924-3425946 GGCACAGGGGAGAGGGCGAGTGG + Intronic
968899870 4:3426054-3426076 GGCACAGGGGAGAGGGCGAGCGG + Intronic
971390883 4:26184282-26184304 GGTACAGGGATCACTGCAATGGG + Intronic
976772638 4:88670527-88670549 AGTACAGTGGTGATTGCTAGGGG + Intronic
977997757 4:103515311-103515333 GGGAGAGGGGTGAGTGAAATAGG - Intergenic
984845748 4:184106643-184106665 GGTACTGGGGTGGGGGCAACAGG - Intronic
985272410 4:188206776-188206798 GGTACTGGGGTGAGTGAGTGTGG + Intergenic
985490083 5:174165-174187 GGGACTGGGGTGAGAGCCAGGGG + Intronic
988237262 5:28561639-28561661 GGTACTGGGGGGAGTGAAATTGG - Intergenic
988639919 5:33030487-33030509 GGCACAGTTGTGAGTTCAAGAGG + Intergenic
996383554 5:122886066-122886088 GGGACAGGGTTCAGAGCAAGTGG + Intronic
997193658 5:131963025-131963047 GGAACAAGGGTGTGTGCAAGAGG - Intronic
998203483 5:140143548-140143570 GGAACAGGGGTGAGGGAAGGAGG - Intergenic
999774303 5:154799890-154799912 GGCACTGGGGTGACTGCACGAGG - Exonic
1002307288 5:178291305-178291327 GGACCAGTAGTGAGTGCAAGAGG + Intronic
1003554216 6:7125690-7125712 GGTATTGGGGTGATTGTAAGAGG + Intronic
1006174737 6:32115104-32115126 GTTGCAGGGGTGGGGGCAAGGGG + Intronic
1008333899 6:50276408-50276430 GGTATAGGGATCACTGCAAGGGG - Intergenic
1010061015 6:71623455-71623477 GATACAGGGATAAGTGCAATCGG - Intergenic
1012023600 6:93959436-93959458 GGAAAAGGGGAGAGTGGAAGAGG + Intergenic
1015939200 6:138431748-138431770 GGCACAGGGGTGAGTGCTGTGGG + Exonic
1016347021 6:143124756-143124778 AGGACAGGAGTGGGTGCAAGTGG + Intronic
1016865933 6:148766372-148766394 GGTGCGTGGGTGAGAGCAAGTGG - Intronic
1017850922 6:158305117-158305139 AGTAGAAGGGTGAGTGCCAGGGG - Intronic
1018688796 6:166326440-166326462 GGCACAGGAGTGAATGCAAGAGG + Intronic
1019364262 7:623723-623745 GGTACAGGGATCACTGCAATGGG - Intronic
1026475691 7:70733507-70733529 AGTACAGGTGGGAGTGGAAGAGG - Intronic
1029506834 7:100968026-100968048 GCTCCAGGGGTGAGAGAAAGGGG - Exonic
1030890859 7:114997262-114997284 GGTACATGGTTGAGTGCTATTGG + Intronic
1031923675 7:127619392-127619414 GGTACAGGGGAGACTGCAGAGGG + Intergenic
1033621197 7:143063257-143063279 AGTACATGGGTGAGTGAAGGCGG + Intergenic
1034461226 7:151199078-151199100 GGTACAGGCGTGTGTGCCCGAGG - Intronic
1034558822 7:151866856-151866878 GGTGCAGAGGTGTGTGCGAGGGG - Intronic
1035767620 8:2119718-2119740 GGCAGAGGGGTCAGTGGAAGAGG + Intronic
1035994014 8:4525373-4525395 GGTTCAGCTGTGAGTGGAAGGGG - Intronic
1037881524 8:22575592-22575614 GGGACAGGTGTGTGTGTAAGAGG + Exonic
1038044141 8:23751957-23751979 TGTACATGTCTGAGTGCAAGTGG + Intergenic
1038057587 8:23875357-23875379 GGGACAGAGGTGAATACAAGGGG - Intergenic
1038328315 8:26588906-26588928 GGTAAGGGAATGAGTGCAAGAGG - Intronic
1042068940 8:64909368-64909390 GGTACAGAGGTGTGGGAAAGTGG + Intergenic
1045215666 8:100145953-100145975 GGTGCAGGGGTGAGCGAGAGAGG - Intergenic
1050829135 9:9989651-9989673 GGCACAGGTGTGGGTGCAAGAGG + Intronic
1053185558 9:36013345-36013367 AGTACATGGGTGTGTGCAGGCGG - Intergenic
1056067666 9:82953733-82953755 GGTGAAGGGGTGGGTGCAGGTGG + Intergenic
1057843781 9:98506550-98506572 GACACAGGGGTGAGTCCCAGGGG + Intronic
1058404575 9:104657536-104657558 AGTACATGGGGGTGTGCAAGTGG + Intergenic
1059338928 9:113586507-113586529 GGGACAGGGGAGGGTGCCAGTGG - Intronic
1060721718 9:125984034-125984056 TGTGCAGGTGTGAATGCAAGGGG + Intergenic
1062557058 9:137117905-137117927 GGTAGAATGGTGAGTGCCAGGGG - Intergenic
1062561626 9:137144735-137144757 GGGACAGGAGTGAGAGGAAGGGG + Intronic
1062561687 9:137144911-137144933 GGGACCGGGGTGAGAGGAAGGGG + Intronic
1062561708 9:137144968-137144990 GGGACAGGAGTGAGAGGAAGGGG + Intronic
1062561728 9:137145025-137145047 GGGACAGGAGTGAGAGGAAGGGG + Intronic
1062561750 9:137145082-137145104 GGGACCGGGGTGAGAGGAAGGGG + Intronic
1062561772 9:137145139-137145161 GGGACCGGGGTGAGAGGAAGGGG + Intronic
1062561794 9:137145196-137145218 GGGACCGGGGTGAGAGGAAGGGG + Intronic
1062561815 9:137145253-137145275 GGGACAGGAGTGAGAGGAAGGGG + Intronic
1062561835 9:137145310-137145332 GGGACAGGAGTGAGAGGAAGGGG + Intronic
1185775193 X:2797425-2797447 GGCCCAGGGCAGAGTGCAAGCGG - Intronic
1194515105 X:94842928-94842950 GGTAAAGGGATGAATGCAAGTGG - Intergenic
1201979910 Y:19895270-19895292 GGTAAAGGGGTCAGTTCAACAGG + Intergenic