ID: 1162765729

View in Genome Browser
Species Human (GRCh38)
Location 19:12918395-12918417
Sequence AGGGTTGAAGGGTCGGCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 246}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162765729_1162765741 9 Left 1162765729 19:12918395-12918417 CCTCCTGCCGACCCTTCAACCCT 0: 1
1: 0
2: 0
3: 10
4: 246
Right 1162765741 19:12918427-12918449 GATGTGCTGCTGCGGGACGGTGG 0: 1
1: 0
2: 0
3: 13
4: 119
1162765729_1162765744 20 Left 1162765729 19:12918395-12918417 CCTCCTGCCGACCCTTCAACCCT 0: 1
1: 0
2: 0
3: 10
4: 246
Right 1162765744 19:12918438-12918460 GCGGGACGGTGGGGACCCGCAGG 0: 1
1: 0
2: 2
3: 12
4: 129
1162765729_1162765745 28 Left 1162765729 19:12918395-12918417 CCTCCTGCCGACCCTTCAACCCT 0: 1
1: 0
2: 0
3: 10
4: 246
Right 1162765745 19:12918446-12918468 GTGGGGACCCGCAGGAAAGACGG 0: 1
1: 0
2: 2
3: 14
4: 181
1162765729_1162765737 1 Left 1162765729 19:12918395-12918417 CCTCCTGCCGACCCTTCAACCCT 0: 1
1: 0
2: 0
3: 10
4: 246
Right 1162765737 19:12918419-12918441 GTCACCTCGATGTGCTGCTGCGG 0: 1
1: 0
2: 0
3: 6
4: 115
1162765729_1162765746 29 Left 1162765729 19:12918395-12918417 CCTCCTGCCGACCCTTCAACCCT 0: 1
1: 0
2: 0
3: 10
4: 246
Right 1162765746 19:12918447-12918469 TGGGGACCCGCAGGAAAGACGGG 0: 1
1: 0
2: 3
3: 14
4: 202
1162765729_1162765740 6 Left 1162765729 19:12918395-12918417 CCTCCTGCCGACCCTTCAACCCT 0: 1
1: 0
2: 0
3: 10
4: 246
Right 1162765740 19:12918424-12918446 CTCGATGTGCTGCTGCGGGACGG 0: 1
1: 0
2: 0
3: 3
4: 91
1162765729_1162765742 10 Left 1162765729 19:12918395-12918417 CCTCCTGCCGACCCTTCAACCCT 0: 1
1: 0
2: 0
3: 10
4: 246
Right 1162765742 19:12918428-12918450 ATGTGCTGCTGCGGGACGGTGGG 0: 1
1: 0
2: 0
3: 6
4: 87
1162765729_1162765738 2 Left 1162765729 19:12918395-12918417 CCTCCTGCCGACCCTTCAACCCT 0: 1
1: 0
2: 0
3: 10
4: 246
Right 1162765738 19:12918420-12918442 TCACCTCGATGTGCTGCTGCGGG 0: 1
1: 0
2: 0
3: 7
4: 130
1162765729_1162765743 11 Left 1162765729 19:12918395-12918417 CCTCCTGCCGACCCTTCAACCCT 0: 1
1: 0
2: 0
3: 10
4: 246
Right 1162765743 19:12918429-12918451 TGTGCTGCTGCGGGACGGTGGGG 0: 1
1: 0
2: 1
3: 19
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162765729 Original CRISPR AGGGTTGAAGGGTCGGCAGG AGG (reversed) Intronic