ID: 1162765731

View in Genome Browser
Species Human (GRCh38)
Location 19:12918398-12918420
Sequence ACCAGGGTTGAAGGGTCGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 91}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162765731_1162765737 -2 Left 1162765731 19:12918398-12918420 CCTGCCGACCCTTCAACCCTGGT 0: 1
1: 0
2: 0
3: 5
4: 91
Right 1162765737 19:12918419-12918441 GTCACCTCGATGTGCTGCTGCGG 0: 1
1: 0
2: 0
3: 6
4: 115
1162765731_1162765746 26 Left 1162765731 19:12918398-12918420 CCTGCCGACCCTTCAACCCTGGT 0: 1
1: 0
2: 0
3: 5
4: 91
Right 1162765746 19:12918447-12918469 TGGGGACCCGCAGGAAAGACGGG 0: 1
1: 0
2: 3
3: 14
4: 202
1162765731_1162765740 3 Left 1162765731 19:12918398-12918420 CCTGCCGACCCTTCAACCCTGGT 0: 1
1: 0
2: 0
3: 5
4: 91
Right 1162765740 19:12918424-12918446 CTCGATGTGCTGCTGCGGGACGG 0: 1
1: 0
2: 0
3: 3
4: 91
1162765731_1162765738 -1 Left 1162765731 19:12918398-12918420 CCTGCCGACCCTTCAACCCTGGT 0: 1
1: 0
2: 0
3: 5
4: 91
Right 1162765738 19:12918420-12918442 TCACCTCGATGTGCTGCTGCGGG 0: 1
1: 0
2: 0
3: 7
4: 130
1162765731_1162765744 17 Left 1162765731 19:12918398-12918420 CCTGCCGACCCTTCAACCCTGGT 0: 1
1: 0
2: 0
3: 5
4: 91
Right 1162765744 19:12918438-12918460 GCGGGACGGTGGGGACCCGCAGG 0: 1
1: 0
2: 2
3: 12
4: 129
1162765731_1162765741 6 Left 1162765731 19:12918398-12918420 CCTGCCGACCCTTCAACCCTGGT 0: 1
1: 0
2: 0
3: 5
4: 91
Right 1162765741 19:12918427-12918449 GATGTGCTGCTGCGGGACGGTGG 0: 1
1: 0
2: 0
3: 13
4: 119
1162765731_1162765743 8 Left 1162765731 19:12918398-12918420 CCTGCCGACCCTTCAACCCTGGT 0: 1
1: 0
2: 0
3: 5
4: 91
Right 1162765743 19:12918429-12918451 TGTGCTGCTGCGGGACGGTGGGG 0: 1
1: 0
2: 1
3: 19
4: 179
1162765731_1162765745 25 Left 1162765731 19:12918398-12918420 CCTGCCGACCCTTCAACCCTGGT 0: 1
1: 0
2: 0
3: 5
4: 91
Right 1162765745 19:12918446-12918468 GTGGGGACCCGCAGGAAAGACGG 0: 1
1: 0
2: 2
3: 14
4: 181
1162765731_1162765747 30 Left 1162765731 19:12918398-12918420 CCTGCCGACCCTTCAACCCTGGT 0: 1
1: 0
2: 0
3: 5
4: 91
Right 1162765747 19:12918451-12918473 GACCCGCAGGAAAGACGGGCAGG 0: 1
1: 0
2: 1
3: 4
4: 119
1162765731_1162765742 7 Left 1162765731 19:12918398-12918420 CCTGCCGACCCTTCAACCCTGGT 0: 1
1: 0
2: 0
3: 5
4: 91
Right 1162765742 19:12918428-12918450 ATGTGCTGCTGCGGGACGGTGGG 0: 1
1: 0
2: 0
3: 6
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162765731 Original CRISPR ACCAGGGTTGAAGGGTCGGC AGG (reversed) Intronic