ID: 1162765738

View in Genome Browser
Species Human (GRCh38)
Location 19:12918420-12918442
Sequence TCACCTCGATGTGCTGCTGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 130}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162765734_1162765738 -10 Left 1162765734 19:12918407-12918429 CCTTCAACCCTGGTCACCTCGAT 0: 1
1: 0
2: 1
3: 10
4: 106
Right 1162765738 19:12918420-12918442 TCACCTCGATGTGCTGCTGCGGG 0: 1
1: 0
2: 0
3: 7
4: 130
1162765731_1162765738 -1 Left 1162765731 19:12918398-12918420 CCTGCCGACCCTTCAACCCTGGT 0: 1
1: 0
2: 0
3: 5
4: 91
Right 1162765738 19:12918420-12918442 TCACCTCGATGTGCTGCTGCGGG 0: 1
1: 0
2: 0
3: 7
4: 130
1162765729_1162765738 2 Left 1162765729 19:12918395-12918417 CCTCCTGCCGACCCTTCAACCCT 0: 1
1: 0
2: 0
3: 10
4: 246
Right 1162765738 19:12918420-12918442 TCACCTCGATGTGCTGCTGCGGG 0: 1
1: 0
2: 0
3: 7
4: 130
1162765732_1162765738 -5 Left 1162765732 19:12918402-12918424 CCGACCCTTCAACCCTGGTCACC 0: 1
1: 0
2: 2
3: 26
4: 254
Right 1162765738 19:12918420-12918442 TCACCTCGATGTGCTGCTGCGGG 0: 1
1: 0
2: 0
3: 7
4: 130
1162765728_1162765738 3 Left 1162765728 19:12918394-12918416 CCCTCCTGCCGACCCTTCAACCC 0: 1
1: 0
2: 1
3: 15
4: 242
Right 1162765738 19:12918420-12918442 TCACCTCGATGTGCTGCTGCGGG 0: 1
1: 0
2: 0
3: 7
4: 130
1162765733_1162765738 -9 Left 1162765733 19:12918406-12918428 CCCTTCAACCCTGGTCACCTCGA 0: 1
1: 0
2: 0
3: 7
4: 105
Right 1162765738 19:12918420-12918442 TCACCTCGATGTGCTGCTGCGGG 0: 1
1: 0
2: 0
3: 7
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162765738 Original CRISPR TCACCTCGATGTGCTGCTGC GGG Intronic