ID: 1162765738

View in Genome Browser
Species Human (GRCh38)
Location 19:12918420-12918442
Sequence TCACCTCGATGTGCTGCTGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 130}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162765731_1162765738 -1 Left 1162765731 19:12918398-12918420 CCTGCCGACCCTTCAACCCTGGT 0: 1
1: 0
2: 0
3: 5
4: 91
Right 1162765738 19:12918420-12918442 TCACCTCGATGTGCTGCTGCGGG 0: 1
1: 0
2: 0
3: 7
4: 130
1162765728_1162765738 3 Left 1162765728 19:12918394-12918416 CCCTCCTGCCGACCCTTCAACCC 0: 1
1: 0
2: 1
3: 15
4: 242
Right 1162765738 19:12918420-12918442 TCACCTCGATGTGCTGCTGCGGG 0: 1
1: 0
2: 0
3: 7
4: 130
1162765732_1162765738 -5 Left 1162765732 19:12918402-12918424 CCGACCCTTCAACCCTGGTCACC 0: 1
1: 0
2: 2
3: 26
4: 254
Right 1162765738 19:12918420-12918442 TCACCTCGATGTGCTGCTGCGGG 0: 1
1: 0
2: 0
3: 7
4: 130
1162765733_1162765738 -9 Left 1162765733 19:12918406-12918428 CCCTTCAACCCTGGTCACCTCGA 0: 1
1: 0
2: 0
3: 7
4: 105
Right 1162765738 19:12918420-12918442 TCACCTCGATGTGCTGCTGCGGG 0: 1
1: 0
2: 0
3: 7
4: 130
1162765729_1162765738 2 Left 1162765729 19:12918395-12918417 CCTCCTGCCGACCCTTCAACCCT 0: 1
1: 0
2: 0
3: 10
4: 246
Right 1162765738 19:12918420-12918442 TCACCTCGATGTGCTGCTGCGGG 0: 1
1: 0
2: 0
3: 7
4: 130
1162765734_1162765738 -10 Left 1162765734 19:12918407-12918429 CCTTCAACCCTGGTCACCTCGAT 0: 1
1: 0
2: 1
3: 10
4: 106
Right 1162765738 19:12918420-12918442 TCACCTCGATGTGCTGCTGCGGG 0: 1
1: 0
2: 0
3: 7
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162765738 Original CRISPR TCACCTCGATGTGCTGCTGC GGG Intronic
903115440 1:21175991-21176013 TCCCCCCGCAGTGCTGCTGCCGG + Intronic
905301932 1:36991489-36991511 TCACCTCCATGGGAGGCTGCTGG + Intronic
905352175 1:37355507-37355529 TAACTTCCATGTGCTGCTGCAGG + Intergenic
915604855 1:156944082-156944104 AGACCTCCACGTGCTGCTGCTGG - Exonic
917367138 1:174244532-174244554 ACACTTGGATGTGCTTCTGCAGG + Intronic
917437876 1:175039356-175039378 TCACCTCACTGGGCTGCTGTGGG + Intergenic
918375003 1:183900218-183900240 TCACCTCGATGTAGTCCTGAAGG - Exonic
919739986 1:200975495-200975517 CCACCTGGATGAGCTCCTGCTGG + Exonic
920178331 1:204117172-204117194 TTACCTGGATCTGCTGCTGAAGG - Exonic
1070849974 10:79555693-79555715 TCTCCTCGCTATGATGCTGCTGG - Intergenic
1071152554 10:82652185-82652207 CCCCCTCCAGGTGCTGCTGCAGG - Intronic
1077392166 11:2305171-2305193 TCACCTCCTGGAGCTGCTGCCGG + Intronic
1077481902 11:2818871-2818893 TCTCCTAGATGTGATTCTGCTGG - Intronic
1078955036 11:16183882-16183904 TGACCTGGATCTGTTGCTGCAGG + Exonic
1080587942 11:33698224-33698246 TCCTCTCTATGTGCTGCTGAGGG - Intergenic
1081679190 11:44989839-44989861 TCACCTGGGTCTGCTGCTCCAGG - Intergenic
1088847988 11:113683621-113683643 TCACCTGGAGGTGGTGCTGGAGG - Intergenic
1090365946 11:126205684-126205706 TCACCTTGTGGTGTTGCTGCTGG + Exonic
1090763561 11:129857383-129857405 TCATCACCATGTGCTTCTGCTGG + Exonic
1090770061 11:129912120-129912142 TGACCTGGATGTGCTGCACCTGG + Exonic
1093762615 12:22927069-22927091 GAACCTGCATGTGCTGCTGCTGG - Intergenic
1094494568 12:30981272-30981294 TTACATCCACGTGCTGCTGCTGG - Intronic
1095296859 12:40536536-40536558 TGAGATGGATGTGCTGCTGCTGG - Intronic
1096865900 12:54562603-54562625 TCACCTCACTGTTCTTCTGCAGG - Intronic
1096866100 12:54564272-54564294 TCACCTCACTGTTCTTCTGCAGG + Intronic
1097603149 12:61719841-61719863 CCATCTCCATGTGCTGCTTCTGG - Intronic
1097878985 12:64670241-64670263 CCACTTTGATGTGCTGCTCCTGG - Intronic
1101765713 12:107697239-107697261 TAACCATGCTGTGCTGCTGCTGG - Intronic
1102992867 12:117327464-117327486 TCCACTGGATGTGCTGCTGGAGG + Intronic
1113056950 13:106278444-106278466 TCAACTAGATGAGCTGCTGGTGG + Intergenic
1113599128 13:111555728-111555750 CCACCTCACTGAGCTGCTGCAGG + Intergenic
1121873507 14:97430515-97430537 TCACCAGGATGTCCTGCTGCTGG - Intergenic
1122318910 14:100841575-100841597 TCACCTCCAGGGCCTGCTGCCGG - Intergenic
1132884460 16:2176518-2176540 TCACCAGGATGTCCTGCGGCCGG - Intronic
1135150437 16:20000613-20000635 TCACCTCTACCTGCTGATGCTGG - Intergenic
1135786416 16:25353165-25353187 TCACCTGGGTGTGTTGCAGCTGG + Intergenic
1136278258 16:29192127-29192149 TCCCCTGGGGGTGCTGCTGCTGG + Intergenic
1136933769 16:34440039-34440061 TCAACTCACTGTGCTGCTGAAGG + Intergenic
1136970803 16:34971775-34971797 TCAACTCACTGTGCTGCTGAAGG - Intergenic
1141615912 16:85209345-85209367 TGACCTCGATGTGCACCTCCTGG + Intergenic
1142082636 16:88158161-88158183 TCCCCTGGGGGTGCTGCTGCTGG + Intergenic
1143492028 17:7290247-7290269 TCACCTCTATAGGCTGCTGCTGG + Exonic
1143964824 17:10749703-10749725 GCACCACGACATGCTGCTGCAGG - Intergenic
1145245799 17:21268575-21268597 TGACCTCTCTGTGCTGCTCCAGG + Intergenic
1146062793 17:29615839-29615861 TCTCCAGGGTGTGCTGCTGCTGG + Exonic
1146790011 17:35745792-35745814 TGACCTGGATGTCCAGCTGCTGG + Exonic
1147530433 17:41271402-41271424 GCAGCAGGATGTGCTGCTGCAGG - Intergenic
1147563137 17:41521140-41521162 CCACCTCGAGGGGCTGCTGGAGG - Exonic
1151917595 17:77129879-77129901 TCCCCTGGCTGTGCAGCTGCGGG - Intronic
1152685906 17:81693794-81693816 TCCCCTGGATGTGCTGCGGTGGG + Intronic
1152701613 17:81822545-81822567 TGACCCTGAGGTGCTGCTGCTGG - Exonic
1153772445 18:8426451-8426473 TCACCTCGAGGAGCAGCTGTAGG - Intergenic
1160454741 18:78992645-78992667 TCTGCTCGATGAGCTGCAGCTGG - Exonic
1160618211 18:80150142-80150164 TCACCTCAGGGTGCTGGTGCAGG - Intronic
1161159629 19:2754782-2754804 TCACCGCCATGAGCGGCTGCAGG + Exonic
1161270651 19:3387713-3387735 CCAGCTCCATGTGCTGCTCCTGG - Intronic
1162765738 19:12918420-12918442 TCACCTCGATGTGCTGCTGCGGG + Intronic
1163265237 19:16216916-16216938 GCACCCCGCTGTGCTGCCGCTGG - Intronic
927133079 2:20076974-20076996 TCACTTTGAGGTGCTGCTGTGGG + Intergenic
928114627 2:28538264-28538286 TCACCTCGTGGTCCTCCTGCAGG + Intronic
928325879 2:30319166-30319188 CCACCTCTTTCTGCTGCTGCTGG - Intronic
929218052 2:39436933-39436955 TCAGCTCGAAGTCCTCCTGCGGG + Exonic
933587943 2:84200425-84200447 TCTCAGCGATGTGCTGCTTCTGG + Intergenic
933715131 2:85354465-85354487 GCTCCTGGCTGTGCTGCTGCTGG - Exonic
933749109 2:85591748-85591770 TCACCTCGTTCGCCTGCTGCTGG - Exonic
937776450 2:125782566-125782588 TCACCTAAATGTGTTGGTGCTGG - Intergenic
943741906 2:191419081-191419103 TCACATGTTTGTGCTGCTGCTGG + Intronic
944337005 2:198545925-198545947 TCACCTCAATGTGCTGAGGCTGG + Intronic
944480622 2:200154028-200154050 ACAGCCCCATGTGCTGCTGCTGG + Intergenic
946337601 2:219048993-219049015 TCCCCTTGGTTTGCTGCTGCTGG + Intergenic
948692475 2:239715390-239715412 TCCCCTAGATGTGGAGCTGCCGG + Intergenic
948811676 2:240481587-240481609 TCACCTCGATGGGTTGCTCAGGG + Intronic
1168861242 20:1047476-1047498 TCTCCTCCATGTGGTGATGCAGG - Intergenic
1172098064 20:32470257-32470279 TCCCCTGGATGTGCTTCAGCAGG - Intronic
1173740211 20:45394937-45394959 CCACCTCGCTGAGCGGCTGCCGG + Intronic
1173810545 20:45952594-45952616 TCACCTCAATGTGGTGCAACTGG + Exonic
1179435401 21:41359013-41359035 ACACCTCGATGTGGTACTTCTGG + Intergenic
1181386297 22:22548297-22548319 TCAGCCCGATGAGGTGCTGCAGG + Exonic
1182143230 22:27980615-27980637 TCTGCTCCATGTGCTGCTGGTGG + Exonic
1182280725 22:29216511-29216533 TCACGTTCATGTGCTGCTGTGGG - Intronic
1182296585 22:29313867-29313889 TCTCCGCGATGCGCTGCCGCAGG + Exonic
1182567618 22:31212085-31212107 TCCCCTCGAGGTGCTCCCGCCGG - Intergenic
1183338051 22:37262214-37262236 CCACCACCATCTGCTGCTGCTGG - Intergenic
1183487762 22:38098440-38098462 TCTTCTCCATGTGCTGCAGCAGG + Exonic
1184582343 22:45426148-45426170 TCTCCTGGATTTGCTGCTTCTGG - Exonic
1185294738 22:50047522-50047544 CCACCCCGATGTGGGGCTGCAGG + Intronic
953542656 3:43835838-43835860 TAACCTCAATCTGCTCCTGCTGG - Intergenic
955356746 3:58238004-58238026 TCCACTCGATGCGCCGCTGCAGG - Intronic
959557617 3:107740089-107740111 TCAACTCTATGTGGTGCTGTTGG + Intronic
966890653 3:184405353-184405375 TCCCCTTGCTGTGCTTCTGCAGG + Intronic
968576370 4:1368069-1368091 TCTCCTGGAGGTGCTGCAGCCGG + Intronic
969930628 4:10627653-10627675 TCTCCTCCTTCTGCTGCTGCAGG + Intronic
972094068 4:35326426-35326448 TCTGCTTGATATGCTGCTGCAGG + Intergenic
974326385 4:60419668-60419690 ACACCTCGCTCTGCTTCTGCTGG + Intergenic
977183228 4:93903914-93903936 TCTCCTGGATGTAGTGCTGCTGG - Intergenic
981143310 4:141296084-141296106 ACACCTAGCTGTGCTCCTGCTGG + Intergenic
984570932 4:181392609-181392631 CCAACTTGATGTGCTGCTGATGG - Intergenic
984866317 4:184283747-184283769 GCACCCCGTTGTGCTGCTCCAGG + Intergenic
985578308 5:683891-683913 TCAGCTGGGTGTGCTGCCGCTGG + Intronic
986084054 5:4425121-4425143 TCACCTCAATGACCTGCTCCGGG - Intergenic
986279011 5:6307363-6307385 TTTCCTGGATGTGCTTCTGCCGG + Intergenic
990771309 5:59249317-59249339 TCATCTTACTGTGCTGCTGCAGG - Intronic
992897174 5:81255196-81255218 TCACATCGATGAGCCGCTGCTGG - Exonic
995462480 5:112418937-112418959 CCACCTTGATGCCCTGCTGCTGG + Exonic
996954160 5:129163798-129163820 GCACCTCCATGTGCTGCCACTGG - Intergenic
997103794 5:130995736-130995758 TCATCTCCATGCGCTGCAGCTGG - Intergenic
1000908474 5:166992820-166992842 TGAGCCAGATGTGCTGCTGCTGG + Intergenic
1003519378 6:6844815-6844837 TCACCTCGCTGAGGTACTGCTGG + Intergenic
1004191364 6:13466631-13466653 TCCCCTTGATCTGCTGCTGATGG + Intronic
1012718128 6:102702249-102702271 TCATCTGGATTTGCTGCTGAGGG - Intergenic
1017676585 6:156820592-156820614 TCACCTCGCAGTGTTGCTGGTGG - Intronic
1024716890 7:52088787-52088809 TCCCTGCGATGTCCTGCTGCAGG + Intergenic
1025943300 7:66088937-66088959 CCACCTCCATCTGCCGCTGCCGG + Intronic
1033686822 7:143647600-143647622 TCCCCTCCAGGAGCTGCTGCTGG + Intronic
1033688912 7:143719707-143719729 TCCCCTCCAGGAGCTGCTGCTGG - Exonic
1033697789 7:143810014-143810036 TCCCCTCCAGGAGCTGCTGCTGG - Intergenic
1037025743 8:14034925-14034947 GCAACTCGATCTGCTGCTGCTGG - Intergenic
1037111009 8:15164453-15164475 TCCCCGCCACGTGCTGCTGCTGG + Intronic
1040055869 8:43056439-43056461 TCTCTTCCTTGTGCTGCTGCTGG - Exonic
1041481415 8:58323922-58323944 CCACCTCCATGTGCTGCAGAAGG - Intergenic
1046750518 8:117922060-117922082 CCAACTGGATTTGCTGCTGCAGG + Intronic
1049061501 8:140279633-140279655 TCAACAAGATGTGCTGCTGTGGG - Intronic
1057197841 9:93124895-93124917 TCACCTGGGTGTCCTACTGCTGG + Exonic
1057991583 9:99776221-99776243 TTTCCTTGATGTGCTGCTGCAGG - Intergenic
1059759834 9:117327345-117327367 TCCCCTCCAGGTGCTGCTGTAGG - Intronic
1060132026 9:121111167-121111189 TGCCTTCGATGTACTGCTGCAGG - Intronic
1060183559 9:121550592-121550614 TCAGCTGGAGGTGCTGGTGCTGG - Intergenic
1060480671 9:124015299-124015321 GCACTTCGAGGCGCTGCTGCAGG + Exonic
1060551088 9:124485800-124485822 TCACCTAGCTGAGCTCCTGCTGG + Intronic
1186300831 X:8198135-8198157 CCACCCCTATGTGCTGATGCTGG - Intergenic
1186508037 X:10109853-10109875 TCTCCTTGATGAGCTGCAGCCGG - Exonic
1187297697 X:18018052-18018074 TCCGGTTGATGTGCTGCTGCTGG + Intergenic
1188823843 X:34805776-34805798 TCTCCACCATGTGCTGCTGGGGG + Intergenic
1194690612 X:96980005-96980027 TCCCCTCTAGATGCTGCTGCAGG - Intronic
1195551139 X:106172860-106172882 TCACCTGTTTGTGGTGCTGCTGG - Intronic
1198146954 X:133867513-133867535 CCACCTAGATATGCAGCTGCTGG + Intronic
1198373830 X:136017797-136017819 TCACCCAGATGAGCTGCTCCAGG - Intronic
1198508066 X:137320924-137320946 TCAACTGGAGGTGGTGCTGCTGG - Intergenic