ID: 1162765854

View in Genome Browser
Species Human (GRCh38)
Location 19:12919027-12919049
Sequence TGATTTCCACACATGGCGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 50}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162765854_1162765861 6 Left 1162765854 19:12919027-12919049 CCACGCGCCATGTGTGGAAATCA 0: 1
1: 0
2: 0
3: 2
4: 50
Right 1162765861 19:12919056-12919078 TCAGTGCGTCAGTCAGGGCCGGG 0: 1
1: 0
2: 3
3: 13
4: 133
1162765854_1162765862 20 Left 1162765854 19:12919027-12919049 CCACGCGCCATGTGTGGAAATCA 0: 1
1: 0
2: 0
3: 2
4: 50
Right 1162765862 19:12919070-12919092 AGGGCCGGGTTCAGTCAGTCAGG 0: 1
1: 0
2: 0
3: 8
4: 110
1162765854_1162765856 0 Left 1162765854 19:12919027-12919049 CCACGCGCCATGTGTGGAAATCA 0: 1
1: 0
2: 0
3: 2
4: 50
Right 1162765856 19:12919050-12919072 GACCCGTCAGTGCGTCAGTCAGG 0: 1
1: 0
2: 0
3: 0
4: 31
1162765854_1162765857 1 Left 1162765854 19:12919027-12919049 CCACGCGCCATGTGTGGAAATCA 0: 1
1: 0
2: 0
3: 2
4: 50
Right 1162765857 19:12919051-12919073 ACCCGTCAGTGCGTCAGTCAGGG 0: 1
1: 0
2: 0
3: 1
4: 36
1162765854_1162765860 5 Left 1162765854 19:12919027-12919049 CCACGCGCCATGTGTGGAAATCA 0: 1
1: 0
2: 0
3: 2
4: 50
Right 1162765860 19:12919055-12919077 GTCAGTGCGTCAGTCAGGGCCGG 0: 1
1: 0
2: 2
3: 13
4: 124
1162765854_1162765864 30 Left 1162765854 19:12919027-12919049 CCACGCGCCATGTGTGGAAATCA 0: 1
1: 0
2: 0
3: 2
4: 50
Right 1162765864 19:12919080-12919102 TCAGTCAGTCAGGAAATTTGAGG 0: 1
1: 0
2: 0
3: 11
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162765854 Original CRISPR TGATTTCCACACATGGCGCG TGG (reversed) Intronic
903183376 1:21616518-21616540 AGATTCCCACACATGCCACGAGG + Intronic
917450514 1:175143977-175143999 GGATTTCCAAACATGGCTCCAGG + Intronic
918823578 1:189291904-189291926 TGTTTTCTACACATGGCCAGTGG - Intergenic
922582396 1:226708587-226708609 TCATTTCCACACAGGACACGAGG + Intronic
1064154200 10:12890084-12890106 TGATTTCCAGATATGGTGGGGGG + Intergenic
1075897132 10:126006442-126006464 TCACTACCACACATGGCACGTGG - Intronic
1079109011 11:17593639-17593661 GGAGGTCCACACATGGCGAGTGG + Exonic
1086003267 11:82004685-82004707 TGACATCCACCCATGGTGCGAGG - Intergenic
1089700189 11:120240027-120240049 TGATTTGCATACATGGAGCTGGG - Intronic
1102811531 12:115828418-115828440 TGATAGCCACACATGGCTTGCGG + Intergenic
1104744636 12:131203126-131203148 TGATGTCCACACATGGCCCCGGG - Intergenic
1119765604 14:77185675-77185697 TGATTTCCCCACAGGGCCCTGGG - Intronic
1120421657 14:84293844-84293866 TGAATTACACACATGGCCCCAGG - Intergenic
1121991649 14:98563615-98563637 TGATGGCCACACATGGCTAGTGG - Intergenic
1122069734 14:99197905-99197927 TGATTTCCATACCTGGCTTGCGG - Intronic
1143302025 17:5917573-5917595 TGAATTCCGCACATGGAGCCTGG - Intronic
1143768349 17:9152054-9152076 GGATTGCCACTCATGGCCCGCGG - Intronic
1145803237 17:27705195-27705217 TGATTCCCACACATTGTGTGTGG - Intergenic
1158474432 18:57767383-57767405 TAATAGCCACACATGGCTCGTGG - Intronic
1161154118 19:2723371-2723393 GGGTCTCCACACATGGCCCGCGG + Intronic
1162765854 19:12919027-12919049 TGATTTCCACACATGGCGCGTGG - Intronic
1166575686 19:43835375-43835397 TGAATTCCATAAATGGTGCGTGG + Intronic
928045840 2:27930792-27930814 TGATTTCCACACTAGGCTAGAGG - Intronic
928684451 2:33733599-33733621 TGATTTCAACACTTGGCTTGAGG + Intergenic
944940236 2:204617215-204617237 TGATTTCCACAGAAGGCTTGAGG - Intronic
946683152 2:222239203-222239225 TGGATTCCACAGATGGAGCGTGG - Intronic
1170825715 20:19793348-19793370 CGATTGCCACACAGGGCCCGTGG + Intergenic
1171357651 20:24561817-24561839 TGATGCCCACACATGGCTTGTGG + Intronic
1177431228 21:20995000-20995022 TGCTTTCCACACATGCTGTGTGG + Intergenic
1180712509 22:17848939-17848961 TCCTTTCCACACATGGCTCTGGG - Intronic
1182794036 22:32977364-32977386 GGATTTCCACACATGGGATGAGG + Intronic
951693063 3:25417396-25417418 GAATTCCCACACATGGCGGGAGG + Intronic
961401494 3:126648669-126648691 TAATTTCCATACATGGCGTTAGG - Intronic
970529546 4:16967963-16967985 GGGTTTCCACACATGGCAGGCGG - Intergenic
991431768 5:66555472-66555494 TGATTTCCTCACATGGCAGGTGG - Intergenic
996872337 5:128205299-128205321 TGTTTTCAACACATGGTGCTGGG - Intergenic
999907013 5:156152432-156152454 TAATTGCCACACATGGCCAGTGG - Intronic
1000315633 5:160087777-160087799 TGATTTCCATACATGCCACAAGG + Intronic
1002587399 5:180258511-180258533 TGATGTCTTCACATGGAGCGGGG - Intronic
1004422042 6:15479191-15479213 TGATGCCCACACAGGCCGCGGGG + Intronic
1013771825 6:113636443-113636465 TGTTTTCCAGACATGGCCAGAGG - Intergenic
1015344570 6:132140513-132140535 AGATTTCTACACATGAAGCGTGG + Intergenic
1016331267 6:142954375-142954397 TGATTTACACACATGACGTTTGG - Intergenic
1019369366 7:652931-652953 TGATTTCCACACAGGGTGGTTGG + Intronic
1019388653 7:773187-773209 TGATTTACACGCATTCCGCGAGG - Intronic
1020578133 7:9960307-9960329 TCATTCACACACATGGCTCGTGG + Intergenic
1024700916 7:51903152-51903174 TGATAACCACACATTGCTCGGGG + Intergenic
1039695211 8:39903225-39903247 TCATTACCACAGATGGCGCAGGG - Intronic
1052041140 9:23740466-23740488 TAATTTCCACACATGGCCAAAGG - Intronic
1055414487 9:76065805-76065827 TGATTTCCATATAGGGTGCGAGG + Intronic
1192493643 X:71598385-71598407 TCATTCCCACACATAGAGCGGGG - Intronic
1198100610 X:133418856-133418878 TGATTTCCAAATATGGGGCTGGG + Intergenic
1201322679 Y:12717479-12717501 TGGTTTCCTCACATGGCGGTTGG + Intronic