ID: 1162769487

View in Genome Browser
Species Human (GRCh38)
Location 19:12940534-12940556
Sequence CGGGCTTGTCCCAGTCCTGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 202}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162769487_1162769498 18 Left 1162769487 19:12940534-12940556 CCCCCAGGACTGGGACAAGCCCG 0: 1
1: 0
2: 0
3: 12
4: 202
Right 1162769498 19:12940575-12940597 ATGCTAAGAAGCCCGAGGACTGG 0: 1
1: 0
2: 0
3: 6
4: 91
1162769487_1162769496 13 Left 1162769487 19:12940534-12940556 CCCCCAGGACTGGGACAAGCCCG 0: 1
1: 0
2: 0
3: 12
4: 202
Right 1162769496 19:12940570-12940592 CCCTGATGCTAAGAAGCCCGAGG 0: 1
1: 0
2: 0
3: 14
4: 199
1162769487_1162769499 19 Left 1162769487 19:12940534-12940556 CCCCCAGGACTGGGACAAGCCCG 0: 1
1: 0
2: 0
3: 12
4: 202
Right 1162769499 19:12940576-12940598 TGCTAAGAAGCCCGAGGACTGGG 0: 1
1: 0
2: 0
3: 7
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162769487 Original CRISPR CGGGCTTGTCCCAGTCCTGG GGG (reversed) Exonic
900154370 1:1198121-1198143 GCGGCTGGGCCCAGTCCTGGGGG + Intergenic
900966987 1:5965715-5965737 AGGGCTGGTTCCAGTCCTGAGGG - Intronic
901039109 1:6353740-6353762 CAGGCCTGGCCCAGTTCTGGAGG + Intronic
902359190 1:15932837-15932859 CAGGCTTGTCCCTGTCCTCTGGG - Exonic
902686821 1:18082843-18082865 CAGGCCTGGTCCAGTCCTGGGGG - Intergenic
902783994 1:18721332-18721354 GGGGCTGGTCCCAGGCCTTGGGG - Intronic
903043331 1:20548573-20548595 TGGTCTGGTCCCAGTCATGGAGG - Intergenic
904271780 1:29354908-29354930 CCCGCCTGACCCAGTCCTGGTGG + Intergenic
908655317 1:66382446-66382468 CTGTGCTGTCCCAGTCCTGGGGG - Intergenic
914970308 1:152303688-152303710 CGGGCTGGGCCCAGTACTGGAGG - Exonic
915409421 1:155688810-155688832 CGGGACTGTTCCATTCCTGGCGG + Intronic
921944071 1:220874499-220874521 CAGGGCTGTCCCAGTTCTGGCGG + Intergenic
1063286558 10:4694822-4694844 CAGGCTGCTCCCAGTCCTGGTGG - Intergenic
1069722763 10:70560211-70560233 GGGGCTTGTCATAGGCCTGGAGG + Intronic
1074976765 10:118587464-118587486 TGGGCCTGCCCCAGCCCTGGTGG + Intergenic
1075090127 10:119439497-119439519 CAGGCATTTCCCAATCCTGGAGG - Intronic
1076595239 10:131620911-131620933 GAGGGTTGCCCCAGTCCTGGGGG - Intergenic
1076779196 10:132714609-132714631 AGGGCAGGTCCCAGCCCTGGAGG + Intronic
1077186839 11:1239307-1239329 CGGGCTTGTCCCAGACATGCAGG - Intronic
1078026532 11:7700883-7700905 CGGGGTTCTCCCATTCCTGAAGG - Intronic
1078026651 11:7701831-7701853 AGGGCTTGTCTCATTCATGGAGG + Intronic
1078617742 11:12881085-12881107 CGGGCTGGTCCCAGCCCACGTGG + Intronic
1078709436 11:13776652-13776674 CAGGCTGGTCACAGTCCTGCTGG - Intergenic
1080774546 11:35373356-35373378 CGGGTTTGTCCCATTCATGAGGG - Intronic
1085772145 11:79335246-79335268 GGGGCTTTCCCCAGTCATGGTGG - Intronic
1089194611 11:116686913-116686935 CGGGATTGGCCCCGTCCTCGGGG + Intergenic
1089267530 11:117276310-117276332 CGGCCTTGTTCCAGTTCTGAGGG - Intronic
1103336545 12:120194500-120194522 CGGGCTTGGCCCGGCCCGGGCGG - Intronic
1105070239 12:133229998-133230020 CAGGCTGGTCCTAGTCTTGGAGG - Intronic
1105280689 13:18960951-18960973 CTGGGTTTTCTCAGTCCTGGGGG + Intergenic
1105303499 13:19154356-19154378 TGGGCTTTTCCCAGCCCAGGGGG + Intergenic
1105809600 13:23983178-23983200 CTTGATTGTCCCAGTGCTGGGGG + Intronic
1107560488 13:41553062-41553084 AGGGCTTGTCCAGGTCATGGTGG - Intergenic
1113497927 13:110747936-110747958 AGGGTTTGTCCCACTCCTGTTGG - Intergenic
1114426458 14:22627987-22628009 CCTGTATGTCCCAGTCCTGGTGG + Intergenic
1118720324 14:68589473-68589495 GGGGCTTGTGGCAGTCATGGGGG - Intronic
1121021678 14:90584098-90584120 CAGGCTTGACCCAGCCCTGCAGG - Intronic
1122188377 14:100019816-100019838 GGGGTTTATCCCAGTCATGGGGG + Intronic
1123998073 15:25732945-25732967 CGGCCTTCTCCTAATCCTGGAGG - Intronic
1127960643 15:63887898-63887920 GGGGCCTGTCCCAGGCCTTGTGG - Intergenic
1129361901 15:75029579-75029601 ATGGCTTATCCCAGCCCTGGGGG - Intronic
1130582614 15:85152163-85152185 AGCTCTTCTCCCAGTCCTGGAGG - Intergenic
1131783120 15:95881682-95881704 CGGGATTGTCCTAGGCCTGTTGG - Intergenic
1132679079 16:1132405-1132427 CGAGGTGGTCCCAGTGCTGGGGG - Intergenic
1132696379 16:1204003-1204025 GGGGCCTGGCCCAGTCCTGCGGG - Exonic
1132897459 16:2235864-2235886 GGGGCTTCTGCCAGCCCTGGCGG + Exonic
1132925156 16:2425456-2425478 GGGCCTTGTCACAGTCCCGGAGG + Intergenic
1133989632 16:10694582-10694604 TGGACTGGTCCCAGTCGTGGGGG + Exonic
1135609713 16:23855771-23855793 TTGGCTTGTCCCAGTTCTGAAGG - Intronic
1136395884 16:29992155-29992177 GGGGCTGCTCCCAGGCCTGGGGG + Intronic
1137275437 16:46930176-46930198 CAGGCTTCTCCCAGTACAGGAGG + Exonic
1151156228 17:72124339-72124361 CGGGTTGTTCCCAGTGCTGGGGG - Exonic
1152801452 17:82332719-82332741 CGGTCTAGCCCCAGGCCTGGGGG - Intronic
1153140986 18:1972240-1972262 GGGGCTGGTTCCAGGCCTGGTGG - Intergenic
1158959704 18:62579421-62579443 CGCCCTTGACGCAGTCCTGGTGG + Intronic
1160866763 19:1259650-1259672 CTGGCTTGACCCAGCCCTGGGGG + Intronic
1162118289 19:8445338-8445360 CGGGGTTGGCCCCGGCCTGGAGG - Intronic
1162291226 19:9782179-9782201 AGGGCTAGTGCCATTCCTGGTGG - Intronic
1162371765 19:10284115-10284137 CGGGCTGTTCCCAGTCTCGGAGG + Exonic
1162769487 19:12940534-12940556 CGGGCTTGTCCCAGTCCTGGGGG - Exonic
1163845701 19:19637195-19637217 ATGGGTTGTCCCAGTCCTAGGGG - Intronic
1164569840 19:29365948-29365970 CAGGCTGGTCCCAGCCCTGGGGG + Intergenic
1165026668 19:32967615-32967637 CAGGCTGGCCCCAGACCTGGAGG - Intronic
925591442 2:5513824-5513846 CTGGCTTCTCCAAGGCCTGGAGG + Intergenic
926207737 2:10846001-10846023 CACCCTTGTCCCAGCCCTGGGGG + Intergenic
928773303 2:34728389-34728411 CTGGCTTATACCAGTTCTGGAGG + Intergenic
931177628 2:59869855-59869877 CCTCCTTGTCCCAGTCTTGGAGG - Intergenic
931649257 2:64454049-64454071 CGGGCCTGTCCGGGTCCGGGAGG - Intronic
934697204 2:96408475-96408497 TGGTCATGTCCCAGTCCTGTTGG - Intergenic
934704084 2:96464175-96464197 CAGGGTTGACTCAGTCCTGGAGG + Intergenic
936066372 2:109335450-109335472 CGAGCATGTCCCAGCCCTGAGGG - Intronic
938292222 2:130156316-130156338 TGGGCTTTTCCCAGCCCAGGGGG + Intronic
938501660 2:131833861-131833883 CGGGCTCATGCCAGGCCTGGAGG + Intergenic
941357528 2:164511912-164511934 AGGGCGAGTCCCAGACCTGGTGG + Intronic
944221481 2:197308909-197308931 AGAGCTAGTCCCAGTCCTGCAGG + Intronic
945891628 2:215436296-215436318 TTGTCTTGCCCCAGTCCTGGCGG - Intergenic
948102306 2:235384741-235384763 CGGCATTGTCCGAGGCCTGGCGG + Intergenic
1168767003 20:388470-388492 AGAGGTCGTCCCAGTCCTGGGGG + Intronic
1175136383 20:56827419-56827441 CAGCCTTGTCCCAGGCCGGGCGG - Intergenic
1175900764 20:62359078-62359100 CGGCTTTGTCCCAGTCCCCGAGG - Intronic
1179893933 21:44351062-44351084 CGCGCCTGTCCCAGTCCTGCTGG + Intronic
1180045250 21:45302160-45302182 GGGGCTTGTCCCAGGGCTGGCGG + Intergenic
1180077283 21:45469168-45469190 AGGGCTTGGCACAGGCCTGGGGG - Intronic
1181365931 22:22377159-22377181 CTGGCTTGTCTCAGCCATGGTGG - Intergenic
1182195016 22:28506751-28506773 TGGGCTTTTCCCATGCCTGGAGG - Intronic
1183987564 22:41577876-41577898 AGCGCTTGTCCCAGCCCTCGGGG + Exonic
1184878733 22:47291756-47291778 TGGGCATGTCCAAGGCCTGGCGG + Intergenic
953352061 3:42223140-42223162 CGGCCCTGTCCCAGCTCTGGGGG - Exonic
954216054 3:49125095-49125117 CGGCCCTGTCCCTGTCCTGAAGG - Exonic
966658738 3:182390315-182390337 CTGGCTTGTTAGAGTCCTGGTGG + Intergenic
968655506 4:1776868-1776890 CGGGCATCTGCCACTCCTGGAGG + Intergenic
968656321 4:1779874-1779896 GGGGCTGCTCCCAGCCCTGGGGG - Intergenic
972419146 4:38869969-38869991 CAGACTTGCCCCAGTCCTGCAGG + Intronic
978258199 4:106718318-106718340 CTGGCTTGCCCCAGCCCTGTGGG + Intergenic
985567836 5:629453-629475 GGGATTTGACCCAGTCCTGGTGG + Intronic
985567870 5:629570-629592 GGGATTTGGCCCAGTCCTGGTGG + Intronic
985567882 5:629609-629631 GGGATTTGGCCCAGTCCTGGTGG + Intronic
985567893 5:629648-629670 GGGATTTGACCCAGTCCTGGTGG + Intronic
985567905 5:629687-629709 GGGATTTGGCCCAGTCCTGGTGG + Intronic
985567926 5:629765-629787 GGGATTTGGCCCAGTCCTGGTGG + Intronic
985567938 5:629804-629826 GGGATTTGGCCCAGTCCTGGTGG + Intronic
985567950 5:629843-629865 GGGATTTGGCCCAGTCCTGGTGG + Intronic
985567962 5:629882-629904 GGGATTTGGCCCAGTCCTGGTGG + Intronic
985567972 5:629921-629943 GGGATTTGACCCAGTCCTGGTGG + Intronic
985567992 5:629999-630021 GGGATTTGACCCAGTCCTGGTGG + Intronic
985568002 5:630038-630060 GGGATTTGACCCAGTCCTGGTGG + Intronic
985568022 5:630116-630138 GGGATTTGACCCAGTCCTGGTGG + Intronic
985568034 5:630155-630177 GGGATTTGGCCCAGTCCTGGTGG + Intronic
985568046 5:630194-630216 GGGATTTGGCCCAGTCCTGGTGG + Intronic
985568058 5:630233-630255 GGGATTTGGCCCAGTCCTGGTGG + Intronic
985568070 5:630272-630294 GGGATTTGGCCCAGTCCTGGTGG + Intronic
985568081 5:630311-630333 GGGATTTGACCCAGTCCTGGTGG + Intronic
985568093 5:630350-630372 GGGATTTGGCCCAGTCCTGGTGG + Intronic
985568115 5:630429-630451 GGGATTTGACCCAGTCCTGGTGG + Intronic
985568127 5:630468-630490 GGGATTTGGCCCAGTCCTGGTGG + Intronic
985568138 5:630507-630529 GGGATTTGACCCAGTCCTGGTGG + Intronic
985568150 5:630546-630568 GGGATTTGGCCCAGTCCTGGTGG + Intronic
985568162 5:630585-630607 GGGATTTGGCCCAGTCCTGGTGG + Intronic
985568174 5:630624-630646 GGGATTTGGCCCAGTCCTGGTGG + Intronic
985568185 5:630663-630685 GGGATTTGACCCAGTCCTGGTGG + Intronic
985568197 5:630702-630724 GGGATTTGGCCCAGTCCTGGTGG + Intronic
985568218 5:630780-630802 GGGATTTGACCCAGTCCTGGTGG + Intronic
985568230 5:630819-630841 GGGATTTGGCCCAGTCCTGGTGG + Intronic
985568241 5:630858-630880 GGGATTTGACCCAGTCCTGGTGG + Intronic
985568263 5:630936-630958 GGGATTTGGCCCAGTCCTGGTGG + Intronic
985568274 5:630975-630997 GGGATTTGACCCAGTCCTGGTGG + Intronic
985568283 5:631013-631035 TGGATTTGACCCAGTCCTGGTGG + Intronic
985568295 5:631052-631074 GGGATTTGGCCCAGTCCTGGTGG + Intronic
985568307 5:631091-631113 GGGATTTGGCCCAGTCCTGGTGG + Intronic
985568319 5:631130-631152 GGGATTTGGCCCAGTCCTGGTGG + Intronic
985568330 5:631169-631191 GGGATTTGACCCAGTCCTGGTGG + Intronic
985568342 5:631208-631230 GGGATTTGGCCCAGTCCTGGTGG + Intronic
985568363 5:631286-631308 GGGATTTGACCCAGTCCTGGTGG + Intronic
985568375 5:631325-631347 GGGATTTGGCCCAGTCCTGGTGG + Intronic
985568386 5:631364-631386 GGGATTTGACCCAGTCCTGGTGG + Intronic
985568398 5:631403-631425 GGGATTTGGCCCAGTCCTGGTGG + Intronic
985568464 5:631637-631659 GGGATTTGGCCCAGTCCTGGTGG + Intronic
985568483 5:631714-631736 TGGATTTGACCCAGTCCTGGTGG + Intronic
985568505 5:631792-631814 GGGATTTGGCCCAGTCCTGGTGG + Intronic
985568524 5:631869-631891 TGGATTTGACCCAGTCCTGGTGG + Intronic
985568536 5:631908-631930 GGGATTTGGCCCAGTCCTGGTGG + Intronic
985568548 5:631947-631969 GGGATTTGGCCCAGTCCTGGTGG + Intronic
985568560 5:631986-632008 GGGATTTGGCCCAGTCCTGGTGG + Intronic
985568581 5:632064-632086 GGGATTTGGCCCAGTCCTGGTGG + Intronic
985568603 5:632142-632164 GGGATTTGGCCCAGTCCTGGTGG + Intronic
985568624 5:632220-632242 GGGATTTGACCCAGTCCTGGTGG + Intronic
985568644 5:632298-632320 GGGATTTGACCCAGTCCTGGTGG + Intronic
985568654 5:632337-632359 GGGATTTGACCCAGTCCTGGTGG + Intronic
985568674 5:632415-632437 GGGATTTGACCCAGTCCTGGTGG + Intronic
985568686 5:632454-632476 GGGATTTGGCCCAGTCCTGGTGG + Intronic
985568698 5:632493-632515 GGGATTTGGCCCAGTCCTGGTGG + Intronic
985568710 5:632532-632554 GGGATTTGGCCCAGTCCTGGTGG + Intronic
985568721 5:632571-632593 GGGATTTGACCCAGTCCTGGTGG + Intronic
985568733 5:632610-632632 GGGATTTGGCCCAGTCCTGGTGG + Intronic
985568754 5:632688-632710 GGGATTTGACCCAGTCCTGGTGG + Intronic
985568766 5:632727-632749 GGGATTTGGCCCAGTCCTGGTGG + Intronic
985568777 5:632766-632788 GGGATTTGACCCAGTCCTGGTGG + Intronic
985568789 5:632805-632827 GGGATTTGGCCCAGTCCTGGTGG + Intronic
985568842 5:633000-633022 GGGATTTGGCCCAGTCCTGGTGG + Intronic
985568863 5:633078-633100 GGGATTTGACCCAGTCCTGGTGG + Intronic
985568885 5:633156-633178 GGGATTTGGCCCAGTCCTGGTGG + Intronic
985568904 5:633233-633255 TGGATTTGACCCAGTCCTGGTGG + Intronic
985568925 5:633311-633333 GGGATTTGGCCCAGTCCTGGTGG + Intronic
985568944 5:633388-633410 TGGATTTGACCCAGTCCTGGTGG + Intronic
985568966 5:633466-633488 GGGGTTTGGCCCAGTCCTGGTGG + Intronic
985568977 5:633505-633527 GGGATTTGGCCCAGTCCTGGTGG + Intronic
985752131 5:1686718-1686740 CGGGGGTGCCCCAGTGCTGGTGG + Intergenic
985902342 5:2806393-2806415 CGGGTTTGTCCCAGACCTGCCGG + Intergenic
992027135 5:72681473-72681495 CTCTCATGTCCCAGTCCTGGTGG + Intergenic
993045228 5:82858770-82858792 AGGGCTTCTCTCTGTCCTGGTGG - Intergenic
994181771 5:96775615-96775637 CTGGCTTTTACTAGTCCTGGCGG - Intronic
996524063 5:124459102-124459124 CAGGCTTGCCCCAGCCCTGCAGG - Intergenic
997941846 5:138165034-138165056 CTGGCTTGTCCCGCTCCTGCTGG + Exonic
998969300 5:147574210-147574232 CTGGCTTGTGTCAGTCCTGGAGG + Intergenic
1000697519 5:164406158-164406180 AGGGCTTTTACCAGGCCTGGGGG - Intergenic
1002940268 6:1709563-1709585 AGGGCTTCTCCTGGTCCTGGGGG - Intronic
1005966967 6:30733451-30733473 TGGGCTTGGGCCAGTCATGGTGG + Intronic
1006054957 6:31377472-31377494 CGGGCTGCTCCCAGTCCTAGGGG - Intergenic
1006611500 6:35296965-35296987 TGGGCGTGTCCCAGTCCTTTTGG + Intergenic
1007389286 6:41541048-41541070 CAGCCTCGCCCCAGTCCTGGGGG + Intergenic
1009540061 6:64943279-64943301 TGGGCTTGTTCCAGTCCTCCAGG - Intronic
1018669273 6:166166554-166166576 CTCGCTGGTCCCAGACCTGGCGG + Intronic
1018685357 6:166299789-166299811 AGGGCCTGTCCCAGTGCTGTGGG - Intergenic
1020793247 7:12652186-12652208 CTGGCTTATCACAGTCATGGAGG - Intronic
1021754961 7:23842999-23843021 GGGGCTTGTCACAGCCCTGTAGG + Intergenic
1025929048 7:65980483-65980505 AGGGCTTGTGCTAGGCCTGGGGG - Intronic
1029117329 7:98244100-98244122 CTGGCTTCTCCCAGTCCCAGGGG + Intronic
1034971799 7:155423994-155424016 CGGGCTGGTCCCAGTGGTGGGGG - Intergenic
1035051136 7:155999587-155999609 GGGGCTTGTCCCGGAACTGGAGG + Intergenic
1037583594 8:20261449-20261471 CGGGCCCCTCCCCGTCCTGGTGG - Intronic
1039057506 8:33548461-33548483 CTGCCTTGTCCCTGTTCTGGGGG - Exonic
1040033000 8:42843037-42843059 CGGGCTTGTCCTTGTCGTAGCGG + Exonic
1040587301 8:48756125-48756147 CGGGCTGCTCCCATTCCCGGTGG + Intergenic
1043163049 8:76870234-76870256 TGACCTTGTCCCAGGCCTGGAGG + Intergenic
1046067211 8:109211320-109211342 GCTGCGTGTCCCAGTCCTGGCGG - Intergenic
1048871211 8:138800831-138800853 GGGTCTTGTCCCAGACATGGAGG + Intronic
1049160634 8:141095571-141095593 CGGGATGGTCCCAGGCCTGATGG + Intergenic
1049311506 8:141936149-141936171 GGGGCAGGTCCTAGTCCTGGAGG - Intergenic
1049492280 8:142911813-142911835 CTGGCAAGCCCCAGTCCTGGAGG + Exonic
1049686121 8:143939969-143939991 AGGGCCTGGCCCAGGCCTGGAGG - Intronic
1050338859 9:4615886-4615908 CGGGTTTTCCCCAGTTCTGGTGG + Intronic
1052725333 9:32221977-32221999 GGGGCTCTTCCCTGTCCTGGGGG + Intergenic
1055763306 9:79633353-79633375 CTGGCTAGTCCCAGTTTTGGAGG - Intronic
1057224147 9:93278490-93278512 GGCGCTTGCCTCAGTCCTGGAGG + Intronic
1057699919 9:97356245-97356267 TCGGCTTGTCCTAGTCCTAGTGG - Intronic
1058774283 9:108268472-108268494 AGGGGTTGACCAAGTCCTGGAGG - Intergenic
1060435570 9:123589899-123589921 CTGGCTTGTCCCCGACCAGGGGG + Intronic
1061988289 9:134143139-134143161 TGGGGATGGCCCAGTCCTGGTGG + Intronic
1062497274 9:136837754-136837776 CCTGCTTGTCCCAGTCCCGTGGG + Intronic
1190243785 X:48677174-48677196 GGAGCCTGTCCCAGCCCTGGGGG + Intronic
1190844883 X:54182714-54182736 CAGGCTTGTGCCTATCCTGGCGG - Exonic
1195342435 X:103918759-103918781 CGGGCGCCGCCCAGTCCTGGTGG + Intergenic
1195364382 X:104112852-104112874 CGGGCGCCGCCCAGTCCTGGCGG - Exonic
1200003650 X:153074217-153074239 CGGGCTTGAGCCCCTCCTGGAGG - Exonic
1200004073 X:153075792-153075814 CGGGCTTGAGCCCCTCCTGGAGG + Intergenic