ID: 1162772432

View in Genome Browser
Species Human (GRCh38)
Location 19:12957195-12957217
Sequence TCGCACGGACGCCGCCATCT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 27
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 23}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162772422_1162772432 30 Left 1162772422 19:12957142-12957164 CCACGGGAACCCGGGGCCAGGGT 0: 1
1: 0
2: 1
3: 15
4: 173
Right 1162772432 19:12957195-12957217 TCGCACGGACGCCGCCATCTTGG 0: 1
1: 0
2: 0
3: 3
4: 23
1162772425_1162772432 14 Left 1162772425 19:12957158-12957180 CCAGGGTCGCCGCCACACCTAGT 0: 1
1: 0
2: 0
3: 3
4: 58
Right 1162772432 19:12957195-12957217 TCGCACGGACGCCGCCATCTTGG 0: 1
1: 0
2: 0
3: 3
4: 23
1162772428_1162772432 2 Left 1162772428 19:12957170-12957192 CCACACCTAGTAGGCTGCGTGCC 0: 1
1: 0
2: 0
3: 3
4: 85
Right 1162772432 19:12957195-12957217 TCGCACGGACGCCGCCATCTTGG 0: 1
1: 0
2: 0
3: 3
4: 23
1162772423_1162772432 21 Left 1162772423 19:12957151-12957173 CCCGGGGCCAGGGTCGCCGCCAC 0: 1
1: 0
2: 1
3: 18
4: 224
Right 1162772432 19:12957195-12957217 TCGCACGGACGCCGCCATCTTGG 0: 1
1: 0
2: 0
3: 3
4: 23
1162772427_1162772432 5 Left 1162772427 19:12957167-12957189 CCGCCACACCTAGTAGGCTGCGT 0: 1
1: 0
2: 0
3: 6
4: 77
Right 1162772432 19:12957195-12957217 TCGCACGGACGCCGCCATCTTGG 0: 1
1: 0
2: 0
3: 3
4: 23
1162772429_1162772432 -3 Left 1162772429 19:12957175-12957197 CCTAGTAGGCTGCGTGCCTGTCG 0: 1
1: 0
2: 0
3: 5
4: 50
Right 1162772432 19:12957195-12957217 TCGCACGGACGCCGCCATCTTGG 0: 1
1: 0
2: 0
3: 3
4: 23
1162772424_1162772432 20 Left 1162772424 19:12957152-12957174 CCGGGGCCAGGGTCGCCGCCACA 0: 1
1: 0
2: 4
3: 12
4: 225
Right 1162772432 19:12957195-12957217 TCGCACGGACGCCGCCATCTTGG 0: 1
1: 0
2: 0
3: 3
4: 23

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162772432 Original CRISPR TCGCACGGACGCCGCCATCT TGG Exonic
1076997310 11:304346-304368 GCACGCGGAGGCCGCCATCTTGG + Intergenic
1119512227 14:75220530-75220552 TCGCACGGCTGCTGCCAGCTCGG - Intergenic
1129519006 15:76174100-76174122 TGGCACGGAAGCAGCCATCTTGG - Intronic
1129772185 15:78209328-78209350 TCGCAAGAACGGCGCCACCTTGG - Intronic
1143237984 17:5419633-5419655 TCCCTCGGCGGCCGCCATCTTGG + Exonic
1152541578 17:80979398-80979420 TGGCACGGTGGCCTCCATCTTGG - Intergenic
1157764843 18:50288082-50288104 CTTCACGGGCGCCGCCATCTTGG + Intronic
1160714992 19:572520-572542 GCGCACGCACGGCGTCATCTCGG - Intronic
1162772432 19:12957195-12957217 TCGCACGGACGCCGCCATCTTGG + Exonic
1163291122 19:16379621-16379643 TCACACTGACACGGCCATCTAGG + Intronic
1166095199 19:40534108-40534130 CCGCACGGAGGCCGCCAGTTCGG - Exonic
932613113 2:73214262-73214284 GCACATGGAGGCCGCCATCTTGG - Exonic
935990962 2:108718815-108718837 TCGCCCAGACGGCGCAATCTCGG + Intergenic
1172983412 20:38962363-38962385 TCCCACGGGCGCAGCCATGTTGG - Exonic
1181335142 22:22123543-22123565 TCGCACTGCAGTCGCCATCTCGG + Intergenic
1183713648 22:39521041-39521063 CCGCCCTGCCGCCGCCATCTTGG - Exonic
953173039 3:40524909-40524931 GCCCCCGGAGGCCGCCATCTCGG - Exonic
965950792 3:174305669-174305691 TCTCACGGATGCCACTATCTAGG + Intergenic
981081266 4:140641811-140641833 CCGCAGGAAGGCCGCCATCTGGG - Intronic
1018134542 6:160767113-160767135 TCGCCCCTACGCCGCCAGCTGGG - Intergenic
1023805419 7:43869478-43869500 GCACACGGAGGCCGCCATCTTGG + Exonic
1049658099 8:143807740-143807762 TGGCACGGGCGCCTCCATCCTGG + Intronic
1049766814 8:144358787-144358809 TCGGAGGGGCGCCGCCCTCTCGG - Exonic
1059268360 9:113056754-113056776 GCGCACGGGCGCGGCCATCTTGG + Intronic
1185619250 X:1443340-1443362 TTGGACAGACACCGCCATCTTGG + Intronic
1185619259 X:1443397-1443419 TTGGACACACGCCGCCATCTTGG + Intronic
1185619265 X:1443435-1443457 TTGGACAGACACCGCCATCTTGG + Intronic